ID: 961129601

View in Genome Browser
Species Human (GRCh38)
Location 3:124453632-124453654
Sequence CTTTTGGACTGGAGGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961129601 Original CRISPR CTTTTGGACTGGAGGAAAGT GGG (reversed) Intronic
900314997 1:2052004-2052026 CTTTTGGCCTGGAGGTCAGCAGG + Intronic
902135820 1:14304139-14304161 CTTTTGGAGTGGTAGAAAATGGG + Intergenic
903265076 1:22153362-22153384 CTCTTGGGCTGGTGGAAGGTAGG + Intergenic
904763755 1:32825299-32825321 CTTTTTGCCTGCAGGAAGGTGGG + Exonic
904860370 1:33533249-33533271 CTGTTGGACTGGAGGAGATTAGG + Intronic
906199612 1:43950998-43951020 TTTTGTGAATGGAGGAAAGTAGG + Intronic
909979304 1:82079515-82079537 TGAGTGGACTGGAGGAAAGTGGG - Intergenic
910396964 1:86803259-86803281 CTTTAGGACAGGAGGATAGATGG - Intergenic
911327225 1:96482494-96482516 CTTTTCTGCTGGAGGCAAGTGGG - Intergenic
911460396 1:98181991-98182013 CCTTTGGTATGGAGGAAAATGGG - Intergenic
914976982 1:152375017-152375039 ATTTTACACTTGAGGAAAGTTGG - Intergenic
918643636 1:186876049-186876071 CTTATGGCCTTGAGGAAAGAAGG + Intronic
919344793 1:196361636-196361658 CTTTCTGACTGCAGCAAAGTGGG - Intronic
923236114 1:232034965-232034987 CATTTGAACTTGAGGAAAATGGG - Intronic
1067420669 10:46142980-46143002 CTTTTAGAGTGGAATAAAGTTGG + Intergenic
1067425352 10:46206553-46206575 CTTTTAGAGTGGAATAAAGTTGG - Intergenic
1067490459 10:46695124-46695146 CTTTTAGAGTGGAATAAAGTGGG + Intergenic
1067506009 10:46849449-46849471 CTTTTAGAGTGGAATAAAGTGGG + Intergenic
1067604203 10:47645241-47645263 CTTTTAGAGTGGAATAAAGTGGG - Intergenic
1070887436 10:79916460-79916482 CTTTTAGAGTGGAATAAAGTTGG + Intergenic
1071281899 10:84111034-84111056 CTATTGGACTGAAGGGAACTAGG + Intergenic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1073834245 10:107422826-107422848 CTGTTGGAGTGGAGGTTAGTGGG - Intergenic
1074154011 10:110782750-110782772 CTTTTGGACAGGATGAGAGATGG - Intronic
1075239344 10:120764045-120764067 CTTTTGGAGTGGGGGAAACAGGG + Intergenic
1077804647 11:5578507-5578529 CTCTGGGACTGGAGGAAATGAGG + Intronic
1079797956 11:24830423-24830445 CTTTTGGCCTTCAGGCAAGTTGG - Intronic
1080777890 11:35403158-35403180 GTTTTGGAATGGATGAAAGCAGG - Intronic
1081676162 11:44970994-44971016 TTCTTGGACTGGAGGGAGGTAGG - Intergenic
1086019885 11:82214978-82215000 CTTATGGAGGGGAAGAAAGTAGG + Intergenic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1087971193 11:104487000-104487022 CTTTTGCATTAGAGGAAAGGAGG - Intergenic
1088790116 11:113217368-113217390 GGAGTGGACTGGAGGAAAGTCGG - Intronic
1091132890 11:133161167-133161189 CTTTGGGACTGAGGGGAAGTTGG + Intronic
1092902202 12:13070508-13070530 CACTTGGGCTGGAGGAAATTGGG + Intronic
1095749886 12:45697940-45697962 AGTTTGAAGTGGAGGAAAGTAGG + Intergenic
1097342922 12:58459633-58459655 CTTTTTTACTGGAGGAATTTTGG + Intergenic
1097438448 12:59579568-59579590 AGTAGGGACTGGAGGAAAGTAGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101086651 12:101243071-101243093 AATTTGGACTGGAGGTAAGGAGG - Intergenic
1101541215 12:105667161-105667183 TTGTTGGATTGGAAGAAAGTGGG - Intergenic
1102288739 12:111681543-111681565 CTCTTGTCCTGAAGGAAAGTGGG - Intronic
1106061854 13:26300896-26300918 GTTTGGTACTGTAGGAAAGTGGG + Intronic
1107099517 13:36574738-36574760 CATTTGGTATGGAAGAAAGTAGG - Intergenic
1107191829 13:37597275-37597297 CATTTGGGCTGGAGGATAGAGGG + Exonic
1108705461 13:52981493-52981515 CTTTTGAACTGGAAGACAGTGGG + Intergenic
1110441553 13:75532115-75532137 CTTTTGGGGTGGAGAGAAGTGGG + Intronic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1113866635 13:113530870-113530892 CTATTAGACTTGAGTAAAGTAGG + Intronic
1115809191 14:37087373-37087395 CTTTTGGAGAGTAAGAAAGTTGG + Intronic
1116808640 14:49518274-49518296 CTTTTGGAAAGTTGGAAAGTTGG - Intergenic
1117078606 14:52128657-52128679 CTTTTTGTCTGGGGGAACGTTGG + Intergenic
1120313629 14:82863416-82863438 CTTTTGAAAAGTAGGAAAGTAGG + Intergenic
1124392869 15:29275882-29275904 CTTTTCCAGTGGAAGAAAGTGGG + Intronic
1126991947 15:54388199-54388221 ATTTTGGTCTGGAGGAAGGAAGG - Intronic
1127376548 15:58390114-58390136 CTGTTGGACTGGAAGGGAGTTGG - Intronic
1127417650 15:58772266-58772288 CTTTTGGGGTGGAGGAAAACGGG + Intronic
1128890546 15:71328021-71328043 CTATTGTAATGGAGGAAAGAAGG - Intronic
1129766868 15:78175153-78175175 CTGTTGGACAGAAGGAAAGAAGG - Intronic
1131193148 15:90333394-90333416 CCATTGGACAAGAGGAAAGTGGG + Intergenic
1132933262 16:2469222-2469244 CTTCTGGGGTGGGGGAAAGTAGG - Intergenic
1136685125 16:31989501-31989523 CCTGTGCACTGGAGGAAATTTGG + Intergenic
1136785738 16:32933036-32933058 CCTGTGCACTGGAGGAAATTTGG + Intergenic
1136884033 16:33920768-33920790 CCTGTGCACTGGAGGAAATTTGG - Intergenic
1138708421 16:58941399-58941421 CGATTGGAGAGGAGGAAAGTGGG - Intergenic
1139102138 16:63781062-63781084 AATTTGGCTTGGAGGAAAGTAGG + Intergenic
1141186353 16:81790263-81790285 GGTTTGGACTGGAGGGGAGTAGG + Intronic
1143188516 17:5024475-5024497 CTTTTCAAGTGGGGGAAAGTGGG + Exonic
1144042347 17:11423140-11423162 ATTTTGGACCTGAGCAAAGTGGG + Intronic
1145996587 17:29108322-29108344 CTTTTGGCTTGGAGCAAAGTGGG + Intronic
1147535473 17:41318415-41318437 CTTTTGCAATGCAGGAGAGTGGG + Intergenic
1151053727 17:71008193-71008215 CATTTAAACTGGTGGAAAGTTGG - Intergenic
1153434617 18:5056192-5056214 CATTTGTACTGGGGGTAAGTAGG + Intergenic
1156029735 18:32698583-32698605 CTTTTTAAATGGAGGGAAGTGGG - Intronic
1157236213 18:45967414-45967436 CATTTGCACTGGAGGAAGGCAGG + Intergenic
1157298890 18:46465581-46465603 CTTATGAACTGGAGGGAAGATGG - Intergenic
1157812439 18:50707054-50707076 CTTTTAAACAGCAGGAAAGTGGG - Intronic
1158864678 18:61626875-61626897 CTGTTACAGTGGAGGAAAGTGGG + Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1162700749 19:12513261-12513283 GTTGTGAACTGGAGGAAAGCTGG + Intronic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
928826338 2:35425917-35425939 GTTTTGGAGTGGAGGAGAGGAGG - Intergenic
930656167 2:54009183-54009205 TTTGAGGACTCGAGGAAAGTAGG + Intronic
933645840 2:84812021-84812043 CTTTTGGCCTGGAGGAGTGCTGG + Intronic
934024609 2:87990705-87990727 CATCTAGACTGGAGTAAAGTGGG - Intergenic
935686526 2:105688733-105688755 CTTTTGTAAAGGATGAAAGTAGG + Intergenic
936073053 2:109384164-109384186 CTTAAGGACTGGATGAACGTGGG - Intronic
938066171 2:128283130-128283152 TTTTTCAACTGCAGGAAAGTGGG - Intronic
938707385 2:133944364-133944386 CTTTTGGACTGGATTAAATATGG - Intergenic
940336146 2:152529627-152529649 CTTTTGGAGTTTTGGAAAGTTGG + Intronic
940345680 2:152625327-152625349 CTTTGACACTGGAGGAAGGTTGG - Intronic
940349067 2:152660850-152660872 CTCTTGAACTGGGGGAAAATAGG + Intronic
942267740 2:174245464-174245486 CTTTTAGATTGGTGGCAAGTAGG - Intronic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
943934263 2:193894629-193894651 CTTTTTGGCTGAAGGAAATTGGG + Intergenic
945032201 2:205676136-205676158 GCTTTGGACTAGAGGAAAGAGGG + Intergenic
946162876 2:217846768-217846790 CTTTTGGGAGAGAGGAAAGTGGG - Intronic
946309451 2:218874671-218874693 TATTTGGACTGGAGGAAAGTTGG - Intergenic
946664250 2:222032676-222032698 CTTCTGCCCTGGAAGAAAGTAGG - Intergenic
948109740 2:235445079-235445101 CATTTTGTCTGGAGGAAAGAGGG - Intergenic
1169358040 20:4924370-4924392 CTTTTGGGCTGGATGAGGGTGGG - Intronic
1169682623 20:8232766-8232788 GTTTTGGACTGGAGGAAAGATGG + Intronic
1169829408 20:9807286-9807308 CATTTGAAATGGAGGAAACTAGG - Intronic
1172441429 20:34969128-34969150 CCACTGGACTGGAGGAAAGAGGG + Intergenic
1174082615 20:47981432-47981454 CTTTTGGACAGGAAGAAGGGAGG + Intergenic
1174657594 20:52184554-52184576 GCTTTGGAAAGGAGGAAAGTTGG - Intronic
1174844096 20:53926922-53926944 CTGTTGGACTGGATGAGGGTAGG - Intergenic
1175977076 20:62716390-62716412 CGTTGGGACAGGAGGAAGGTCGG + Intronic
1178221064 21:30660774-30660796 ACTAAGGACTGGAGGAAAGTGGG + Intergenic
1178464671 21:32836191-32836213 CTTTGGCTCTGTAGGAAAGTTGG - Intergenic
1178785910 21:35653024-35653046 CTCTTGGACTGGAGGAACAATGG - Intronic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
949611352 3:5706953-5706975 CTTCAGGACTGGAGGATAGATGG - Intergenic
950974670 3:17227933-17227955 CTTGGGGAGTGGAGGATAGTGGG + Intronic
951350182 3:21597515-21597537 ATTTTTGACTGGTGGAAAGAAGG + Intronic
951575714 3:24111661-24111683 CCTCTGGACTGGGGGAAACTAGG + Intergenic
952981036 3:38736182-38736204 CTTTTTGGCTGGAGCAAAGTGGG + Intronic
953330381 3:42048059-42048081 CTCTTGGAGTGGAGGAGAGAGGG - Intronic
953510957 3:43538680-43538702 CTTTTGGACTTGAGGGTGGTTGG + Intronic
955896896 3:63709981-63710003 CTTGTGGGTTGGAGGAATGTTGG - Intergenic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
963323587 3:143836391-143836413 CTTGTGGACTTGGAGAAAGTTGG - Intronic
963970477 3:151424119-151424141 CTTTTGAAGTGGAAGAAATTAGG + Intronic
966586824 3:181635488-181635510 CTTTTGGTCTTGTGGGAAGTAGG - Intergenic
967035120 3:185643283-185643305 CTTTTTAAGTGGAGGAAAGGGGG - Intergenic
969030482 4:4209056-4209078 CTTTAGGACTGCAGTAAAGCAGG - Intronic
970457034 4:16234601-16234623 CATTTTGACTTGAGGAGAGTGGG + Intergenic
970694451 4:18660914-18660936 CTTGAGAACTGGAGGAAGGTGGG + Intergenic
972293607 4:37715234-37715256 CTTTTGGATTGGAAGAAATTTGG + Intergenic
972616488 4:40703466-40703488 CTTTTGGACTGGAGCTAACCAGG + Intergenic
976089944 4:81446750-81446772 CTTTTGGAAGGAAGGAAAGAGGG - Intronic
978036189 4:103998217-103998239 CTTATGGAATGGAGAAAGGTGGG + Intergenic
982245801 4:153349118-153349140 CCTTTGGTTTGGAGGAAATTTGG + Intronic
983270913 4:165560570-165560592 ATTTTGTAATGGTGGAAAGTTGG + Intergenic
984899296 4:184570446-184570468 CTTCTGACCTGGAGGAAACTTGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986848051 5:11778836-11778858 CTTTAATAATGGAGGAAAGTGGG + Intronic
987476878 5:18401479-18401501 TTTTTGGCCTGGAGGCAAGAGGG - Intergenic
987960991 5:24808593-24808615 CTTTTGGAGTGGAGGAAAGGTGG - Intergenic
988627354 5:32891868-32891890 TGTTTGGAGTGGAGGAAAGTGGG - Intergenic
988716107 5:33829817-33829839 CTTTGGGAATTGAGGAAAGCTGG - Intronic
989342184 5:40388410-40388432 CAGCTGGACTGGAGCAAAGTAGG - Intergenic
990683063 5:58267924-58267946 CTTTGGGACTGGAAGAAACTAGG - Intergenic
992757954 5:79926655-79926677 CTTTTTTCCTGAAGGAAAGTAGG - Intergenic
992979028 5:82147783-82147805 CTTTCTGACTGGAGGAAACTGGG - Intronic
993054206 5:82962849-82962871 CTTTAAGACTGGAGGAAAACGGG - Intergenic
993870699 5:93250680-93250702 CTTTTGCATTAGAGGAAACTAGG + Intergenic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
994998584 5:107098114-107098136 ATTTTGTAGTGGAGGAAACTAGG + Intergenic
995184606 5:109258904-109258926 CTTTTGGCCCGAAGGAAAATGGG + Intergenic
999242574 5:150136364-150136386 CTTTTGGGCTGGAGGGAACTGGG + Intronic
1000110250 5:158101358-158101380 CTCATGGTCTAGAGGAAAGTAGG + Intergenic
1000936181 5:167305072-167305094 CTTTTGGAGAGGAGGAAAAGAGG - Intronic
1001416703 5:171549901-171549923 CTTCTGCACTGGGTGAAAGTAGG + Intergenic
1004583095 6:16973387-16973409 CTTTGGGACTGGAAGACAGTGGG - Intergenic
1005056732 6:21736419-21736441 ATTTTGGATTGGAGGGAAATGGG + Intergenic
1006920447 6:37624390-37624412 CCTCTGGACTGGAGGGAGGTGGG - Intergenic
1007071480 6:39041419-39041441 CTTTTTCTCTGGAGGAAAGGTGG - Intergenic
1011271209 6:85581151-85581173 CCATTTGATTGGAGGAAAGTGGG + Intronic
1012141789 6:95634740-95634762 TTTCTGGACTGGAGGAAAACAGG - Intergenic
1012952803 6:105536968-105536990 GTTTTGGACTACAGTAAAGTAGG + Intergenic
1013711454 6:112904908-112904930 TGTTTGGTCTGGATGAAAGTAGG + Intergenic
1015037110 6:128669216-128669238 TATGTGGTCTGGAGGAAAGTAGG - Intergenic
1016140603 6:140605453-140605475 ATTTTGGAATGGAGCAAAGATGG - Intergenic
1022811614 7:33874116-33874138 CTTTCAGACTGGAGGAAATAAGG - Intergenic
1024232943 7:47376640-47376662 TTTTTGGAGTGGAGGGAGGTTGG - Intronic
1024548376 7:50540700-50540722 CTTATGGGCTGGAGAAAGGTGGG - Intronic
1029353079 7:100029458-100029480 TCCTTGGACTGGAGGAAATTAGG + Intronic
1031020377 7:116621111-116621133 CTCTGGGACTGGGGCAAAGTTGG - Intergenic
1034311820 7:150095117-150095139 CTTTCAGGCTGGAAGAAAGTAGG - Intergenic
1034564168 7:151900061-151900083 CTTCTGGAGTGGAGGGAAGGAGG - Intergenic
1034795034 7:154005537-154005559 CTTTCAGGCTGGAAGAAAGTAGG + Intronic
1035851023 8:2919362-2919384 CATTTTGACTGAAGGAAAGAAGG - Intergenic
1038069048 8:23993027-23993049 GTTTGGGCCTGGAGGAGAGTGGG + Intergenic
1038124893 8:24662532-24662554 CTTTTGGTCCTGAGGAAAGTGGG - Intergenic
1039030095 8:33299520-33299542 CTTTTGGGCTGCATGAGAGTTGG + Intergenic
1039608687 8:38902151-38902173 CTTTAGGACTGGAGGAGAAAAGG - Intronic
1040864248 8:52032198-52032220 TTTTAGGGCTGGAGAAAAGTGGG + Intergenic
1041435181 8:57831577-57831599 GTTTTGGACTGAAGGAAACGAGG + Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1043613384 8:82093539-82093561 CTTTAGGACAGGAGGATAGATGG - Intergenic
1044079951 8:87871256-87871278 CTTTAGGACTGGTGGATGGTTGG - Exonic
1046620288 8:116521950-116521972 ATTCTGGTCTGGAGGAAACTTGG - Intergenic
1047850339 8:128850565-128850587 CTTTGGTACTGGTGGAAAATTGG - Intergenic
1048169779 8:132095023-132095045 GTTTTGGAGTGGAAGAATGTTGG - Intronic
1048475537 8:134739211-134739233 CTTTTGGGCTGGTGGCAAGGTGG - Intergenic
1052319419 9:27151533-27151555 CTTTTAGTCTAAAGGAAAGTTGG - Intronic
1055399545 9:75908482-75908504 CTTTTTGACCAGAGGAAAGGGGG - Intronic
1055634700 9:78264994-78265016 CTTGAGGACTGGAGGAAAGGTGG + Intronic
1055637625 9:78294390-78294412 TTGTTGAACTGGAGGAAATTTGG + Intergenic
1056914657 9:90735595-90735617 GATTGGGACAGGAGGAAAGTGGG + Intergenic
1060276074 9:122183806-122183828 GTTTCTGACTGAAGGAAAGTTGG - Intronic
1060289263 9:122285324-122285346 CTTTTGGAATGGAGGAGACTGGG + Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061421983 9:130477622-130477644 CTCTTGGCCTGGAGGAAGGATGG + Intronic
1185893899 X:3842446-3842468 ATTTTGGACAGGAGGAAGCTAGG - Intronic
1185899014 X:3880870-3880892 ATTTTGGACAGGAGGAAGCTAGG - Intergenic
1185904131 X:3919299-3919321 ATTTTGGACAGGAGGAAGCTAGG - Intergenic
1186511334 X:10132074-10132096 GTTTTGCACTGGTGGAAAGAGGG + Intronic
1189081311 X:37975560-37975582 CTTTTGAACCTGATGAAAGTTGG + Intronic
1189603150 X:42648629-42648651 CTTTTGGAGTGGGGAACAGTGGG + Intergenic
1191151405 X:57223806-57223828 TTGTTGGACTGGATGAATGTTGG - Intergenic
1194188997 X:90811252-90811274 TTTTTTGCCTGGAAGAAAGTAGG - Intergenic
1194633073 X:96310571-96310593 CTTATGGACAGGAGGACACTAGG + Intergenic
1194995385 X:100586563-100586585 CTTTGGGACTAAATGAAAGTGGG - Intronic
1198602505 X:138299262-138299284 CATTTGGCCTTGTGGAAAGTTGG + Intergenic
1198806857 X:140502217-140502239 GTCAGGGACTGGAGGAAAGTGGG + Intergenic
1200535578 Y:4393153-4393175 TTTTTTGCCTGGAAGAAAGTAGG - Intergenic