ID: 961134115

View in Genome Browser
Species Human (GRCh38)
Location 3:124494350-124494372
Sequence TCCCCACATCCCCCCAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961134112_961134115 -5 Left 961134112 3:124494332-124494354 CCACAGTCCTAGGTGGCCTCCCC 0: 1
1: 0
2: 0
3: 29
4: 215
Right 961134115 3:124494350-124494372 TCCCCACATCCCCCCAGAAGTGG 0: 1
1: 0
2: 5
3: 39
4: 332
961134111_961134115 -4 Left 961134111 3:124494331-124494353 CCCACAGTCCTAGGTGGCCTCCC 0: 1
1: 0
2: 1
3: 14
4: 163
Right 961134115 3:124494350-124494372 TCCCCACATCCCCCCAGAAGTGG 0: 1
1: 0
2: 5
3: 39
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961134115 Original CRISPR TCCCCACATCCCCCCAGAAG TGG Intronic
900418306 1:2545067-2545089 TTCCCACAGCCCCACAGAAAGGG + Intergenic
901232926 1:7651269-7651291 CCCCCACAGCCCTCCAGAAAAGG + Intronic
901261435 1:7874656-7874678 CCCCACCATCCCCCCAGCAGCGG + Intergenic
901881938 1:12199208-12199230 TCCTCACAACCCCACAAAAGGGG - Intronic
904265668 1:29317304-29317326 ACCCCACACCCTCCAAGAAGCGG - Intronic
904268450 1:29332002-29332024 TCCCTACTTACTCCCAGAAGTGG + Intergenic
904271475 1:29353157-29353179 TCCCCACCTCCCCCAAGAGAGGG - Intergenic
904409568 1:30317343-30317365 TCCCCATATCCCTCCTGCAGGGG + Intergenic
904941281 1:34166174-34166196 TCCCCACCTCTCCCCAGTAGCGG + Intergenic
905207491 1:36351194-36351216 ACCTCACATAACCCCAGAAGAGG + Intronic
906135170 1:43494327-43494349 TCCCCACATTCCACAAGAACCGG + Intergenic
906355862 1:45105902-45105924 TCCTCACTTCCTCCCAGACGGGG - Intronic
908251909 1:62272545-62272567 GCACCACATCCACCCAGAGGGGG - Intronic
909282085 1:73769854-73769876 TCCCCACACCCTCCCTGCAGTGG - Intergenic
913600097 1:120414640-120414662 CCCCCAGCTCCCCCGAGAAGTGG - Intergenic
915069070 1:153251165-153251187 TCCCCTCATCCCCCCGGCAATGG + Intergenic
916070569 1:161167344-161167366 TCTCCACATGCCCTCAGAAGAGG - Intronic
916320556 1:163499219-163499241 TCCTCACTTCCTCCCAGACGTGG + Intergenic
918701632 1:187615791-187615813 TCCTCACTTCCTCCCAGATGGGG - Intergenic
919283280 1:195519032-195519054 TGGCCCCATCCCCACAGAAGGGG + Intergenic
919897416 1:202017993-202018015 TGCCCCCAGCCCTCCAGAAGAGG - Intergenic
920557972 1:206918162-206918184 TCCCCTCATCCTCTCAGCAGCGG + Intronic
921047010 1:211484928-211484950 CGCCCACTTCCCCACAGAAGGGG - Intronic
922171419 1:223158971-223158993 TCCCCTCATCTCCCCACCAGAGG + Intergenic
922190704 1:223316281-223316303 CCCTCACTTCTCCCCAGAAGTGG - Intronic
922368026 1:224884321-224884343 TCATCACATCACCTCAGAAGAGG - Intergenic
923147356 1:231207546-231207568 TCCCCACTGCCTCCAAGAAGAGG + Intronic
923338779 1:232990938-232990960 TCCCCACATCCTGCCAGGTGAGG - Intronic
923343137 1:233024430-233024452 TCCCCCCATACTCCCAGAATAGG + Intronic
924095344 1:240545255-240545277 TCCGCAAAACCCCCCAAAAGGGG + Intronic
1062800136 10:372850-372872 GCCCCACCTCCCCACAGACGTGG + Intronic
1065557320 10:26929745-26929767 TCCCCTCAACCCCCCACAACAGG - Intergenic
1066141262 10:32506200-32506222 TCCTCACTTCCTCCCAGACGGGG + Intronic
1067086494 10:43243144-43243166 TCCTCACTTCCTCCCAGACGGGG - Intronic
1069028610 10:63571365-63571387 TCCCCTAAACCCTCCAGAAGGGG - Intronic
1069769306 10:70887714-70887736 TCCCCACACCTCGCCAGAGGAGG - Intronic
1070287651 10:75095329-75095351 TCACCACATCCCTCCATAAGAGG - Intronic
1070764915 10:79050865-79050887 TCCCCACCCACCCCCAGATGGGG + Intergenic
1071872013 10:89806364-89806386 TCCCCTGATCCCCTCAGAAAAGG - Intergenic
1072408371 10:95176438-95176460 TCCTCACATCCCCGCAGATGGGG + Intergenic
1073143600 10:101264804-101264826 TCCCAGCAGCTCCCCAGAAGGGG + Intergenic
1073288516 10:102402235-102402257 TCCCCATTTACCCCCAGCAGAGG + Exonic
1073441158 10:103553622-103553644 TCCCCAGACCCACTCAGAAGTGG + Intronic
1075728740 10:124623870-124623892 TCACCGCAGCCCCCCAGAACTGG - Intronic
1076754761 10:132563373-132563395 GACCCACATCCCCACAGAAAAGG - Intronic
1077144361 11:1037969-1037991 GCCCCACCTGCCCCCGGAAGAGG + Intergenic
1077531051 11:3095088-3095110 CCCCCAAATCCCTCCAGAGGGGG + Intronic
1078550581 11:12277468-12277490 TTCCCACAGCCTCCCAGAGGAGG + Intronic
1079157405 11:17961043-17961065 TCCCCAGCTCTCCCCAGAAAGGG + Intronic
1079882551 11:25944826-25944848 TTCCCACATGCCCCCAGGATAGG + Intergenic
1081852182 11:46281451-46281473 TCCCCACACCCTCCCAGCTGGGG - Intronic
1084553590 11:69863352-69863374 TCCCCACATCACCGCACCAGTGG + Intergenic
1084952887 11:72676449-72676471 ACTCCACAGCCACCCAGAAGTGG + Intergenic
1086838281 11:91653207-91653229 TCTCCCCATCACCCCAGTAGTGG - Intergenic
1087636937 11:100712522-100712544 CCCCCTTCTCCCCCCAGAAGTGG + Intronic
1089092622 11:115890754-115890776 TCCCCACAACTCCCGAGAAAAGG - Intergenic
1089398740 11:118152556-118152578 TCCCCCCACCCCCAAAGAAGGGG - Intronic
1090118521 11:124000423-124000445 TCCCCACATTGCCCCAAAAGAGG - Intergenic
1090666214 11:128916621-128916643 TCAGCACAGCCCCCCAGCAGTGG - Exonic
1091157184 11:133384776-133384798 TCGCCAAAGCCCCTCAGAAGTGG + Intronic
1091387717 12:105281-105303 TCCCCACAAGCCCCCTGCAGTGG + Intronic
1091815133 12:3432054-3432076 CCCCCAAGTCCCCCTAGAAGGGG + Intronic
1093915187 12:24794243-24794265 TCCACACCTCCCCACAGTAGTGG - Intergenic
1097089660 12:56494862-56494884 TCCTCACTTCCTCCCAGACGGGG + Intergenic
1097325496 12:58271768-58271790 TCCCCATAGCCCCACAGAATAGG - Intergenic
1101352173 12:103941271-103941293 TCCCCACCTCCCGCCAGTAAAGG + Intronic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1104749484 12:131229402-131229424 TCCCCACCCCACCCCAGCAGTGG - Intergenic
1105267714 13:18836896-18836918 TCCTCACTTCCTCCCAGATGGGG + Intergenic
1105300372 13:19128492-19128514 TCCCCACCGCCCCCCACCAGTGG - Intergenic
1105723876 13:23142123-23142145 TCCACACATCCCGCAAGCAGGGG - Intergenic
1110491860 13:76118661-76118683 GCCACACATCCCCCCAAGAGAGG + Intergenic
1110973108 13:81792161-81792183 TCCCCTCACCCTGCCAGAAGTGG - Intergenic
1111333527 13:86792240-86792262 TCCACACCTCCCGCCAGCAGAGG - Intergenic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113741757 13:112716243-112716265 CCCCCACTTCCCACCAGATGGGG - Intronic
1114834423 14:26186603-26186625 TCCTCAAATCCCCACTGAAGTGG + Intergenic
1118877690 14:69798400-69798422 TCCCCACCTCCACCCAACAGTGG - Intergenic
1118920911 14:70149321-70149343 TCCCCACGCATCCCCAGAAGAGG - Intronic
1119206083 14:72794556-72794578 AGCACACATCCTCCCAGAAGTGG + Intronic
1120541927 14:85761472-85761494 TCCCCACATACCCCGACAAATGG - Intergenic
1121634517 14:95444834-95444856 TGGCCACATCCCTCCAGAACTGG + Intronic
1122746504 14:103900061-103900083 TGCCCACATCCGCCCAGGTGGGG + Intergenic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1123057623 14:105579561-105579583 TCCCCACATCCCCTCACAGCAGG + Intergenic
1123080739 14:105692374-105692396 TCCCCACATCCCCTCACAGCAGG - Intergenic
1123081902 14:105699494-105699516 TCCCCACATCCCCTCACAGCAGG + Intergenic
1126054171 15:44713903-44713925 TCCCCACAGCCTCCCAGACAAGG + Intronic
1126612579 15:50544528-50544550 CCCCCACTTCCCCACAGATGAGG - Intronic
1126649597 15:50908103-50908125 TCCCCAAATCCCAGGAGAAGAGG + Intergenic
1127180441 15:56410638-56410660 CCCCCACACCTCCCAAGAAGAGG + Intronic
1129060493 15:72856898-72856920 TCCCCACCTCCCTCCACCAGGGG + Intergenic
1129428533 15:75481591-75481613 TCCCCACCTCCCTCCGGACGGGG - Intronic
1129467342 15:75731497-75731519 TCCCTGCATTCCCCCAGGAGAGG + Intergenic
1129681926 15:77662990-77663012 TCCCCACCTTCCCCCAGAGGCGG - Intronic
1129719865 15:77872114-77872136 TCCCTGCATTCCCCCAGGAGAGG - Intergenic
1129999456 15:80034456-80034478 TGCCCCCTTCCCCCCTGAAGTGG + Intergenic
1130108921 15:80949199-80949221 TCCCCAAACCCCCACTGAAGAGG - Exonic
1130132168 15:81153295-81153317 TCCCCACTTCTCCCCAGGAGAGG - Intergenic
1130388526 15:83434416-83434438 CTCACACATCCCCCCAGGAGGGG - Intergenic
1130946522 15:88553212-88553234 CCCCCACCTCCCTCCAGATGGGG + Intergenic
1130975302 15:88769235-88769257 TCTGCACAGCCCCCCAGGAGGGG - Intergenic
1131111943 15:89770068-89770090 GCCCCACACCCATCCAGAAGTGG + Intronic
1132093730 15:98966576-98966598 TCCCCCCATCCCCCAATATGTGG + Intergenic
1132517851 16:374189-374211 ACCCCACATCCCTGCAGGAGGGG + Intronic
1132684491 16:1156626-1156648 GCCCCGCATCCCTCCTGAAGAGG + Intronic
1133211360 16:4264910-4264932 TCCCCACATCTCTCCTGAGGGGG - Intronic
1133405078 16:5517287-5517309 TCCACACAGCCCCTGAGAAGGGG - Intergenic
1134123219 16:11599118-11599140 TCCCCCCACCCCCCCATAAAAGG - Intronic
1134257867 16:12626497-12626519 TCCCCACCCCCCCCCAAAAAGGG + Intergenic
1134492776 16:14708011-14708033 TCCTCACATCCCCACAGATGGGG - Intergenic
1134498157 16:14747133-14747155 TCCTCACATCCCCACAGATGGGG - Intronic
1134582416 16:15381960-15381982 TCCTCACATCCCCACAGAAGGGG + Intergenic
1135313734 16:21426011-21426033 TCCTCGCATCCCCACAGATGGGG + Intronic
1135366658 16:21858291-21858313 TCCTCGCATCCCCACAGATGGGG + Intronic
1135445157 16:22512867-22512889 TCCTCGCATCCCCACAGATGGGG - Intronic
1135563155 16:23492322-23492344 CCCCCACATCCCCCCACCTGTGG + Intronic
1136193878 16:28637406-28637428 TCCTCGCATCCCCACAGATGGGG - Intergenic
1136270646 16:29146376-29146398 TCCCCGCGTCCCCACAGACGTGG - Intergenic
1136270672 16:29146466-29146488 TCCCCACATCCCCACAGACATGG - Intergenic
1136310399 16:29404714-29404736 TCCTCGCATCCCCACAGATGGGG + Intergenic
1136323846 16:29506502-29506524 TCCTCGCATCCCCACAGATGGGG + Intergenic
1136398093 16:30003983-30004005 CCCCCACACCACCCCAGCAGCGG + Intronic
1136438531 16:30246485-30246507 TCCTCGCATCCCCACAGATGGGG + Intronic
1136617985 16:31410400-31410422 TCCCCACAGCCCCCAGGAAGAGG - Exonic
1137547083 16:49411736-49411758 TCCCCACAGGGCCCCAGCAGTGG + Intergenic
1137869352 16:51934461-51934483 TCCCCCATTCCCCCCAGGAGAGG - Intergenic
1138307314 16:55989363-55989385 TCCTCACTTCCTCCCAGACGGGG - Intergenic
1139858081 16:69997100-69997122 TCCTCACATCCCCACAGATGGGG + Intergenic
1140509328 16:75495659-75495681 ACCCCAAATCCCCAGAGAAGGGG + Intergenic
1141520296 16:84574278-84574300 TCCCCACATCCCGCCTCCAGGGG + Intronic
1141790783 16:86232682-86232704 GCCCCACCTCCCCCCAGATGTGG - Intergenic
1142074224 16:88108157-88108179 TCCCCACATCCCCACAGACGTGG - Intronic
1142074251 16:88108247-88108269 TCCCCACATCCCCACAGACATGG - Intronic
1142189494 16:88711345-88711367 TCCCAACAACGCCCCAGGAGAGG - Intronic
1142688452 17:1591181-1591203 TTCCCACCTCACCCCAAAAGGGG - Intronic
1142963615 17:3566812-3566834 TCCTCACTTCTCCCCGGAAGCGG + Exonic
1143610236 17:8013863-8013885 TCCCCTCATGCCTCCAGAAGTGG + Exonic
1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG + Intergenic
1145980385 17:29007638-29007660 TCCCCAGAGCCCACAAGAAGAGG - Intronic
1146039748 17:29440399-29440421 GCTCCACAACCCCCCAAAAGTGG + Intronic
1146063186 17:29617614-29617636 TCTCCCCCTCCCCCCAGGAGAGG - Exonic
1146270390 17:31481501-31481523 TCCCCACCTCCTCCCAGACTTGG - Intronic
1147391697 17:40113268-40113290 GCCCCACATTCACCCTGAAGGGG + Intergenic
1147919108 17:43905734-43905756 ACTCCACCTCCCCCCAAAAGAGG + Intronic
1148227753 17:45910801-45910823 TCCCCAGTTCAGCCCAGAAGGGG - Intronic
1148848619 17:50543304-50543326 TCCACATAAACCCCCAGAAGGGG - Exonic
1148937236 17:51173282-51173304 TCCCTACAACCTCCAAGAAGAGG + Intergenic
1149621798 17:58050856-58050878 TCCCCACACCACCCCCGAAGAGG - Intergenic
1149633090 17:58142737-58142759 CCCCCACCTCCCCCCAGGATGGG - Intergenic
1151783260 17:76261745-76261767 TCTCCCCATCCCCACAGAGGCGG + Intergenic
1151933249 17:77246736-77246758 TCCTCACTTCCCCCCTGCAGGGG - Intergenic
1152409484 17:80115883-80115905 TCCCCACCTCGCCCCAGCAAAGG - Intergenic
1154003470 18:10506339-10506361 TCCTCACTTCCTCCCAGAGGGGG + Intergenic
1154003584 18:10506755-10506777 TCCTCACTTCCTCCCAGAGGGGG + Intergenic
1154119527 18:11640372-11640394 TCCTCACATCCCCACAGATGGGG + Intergenic
1160427905 18:78790858-78790880 TCCCCAAATCCCGCCAGCTGTGG + Intergenic
1160879141 19:1311600-1311622 TCCCCACCTCCCAGCGGAAGCGG - Intergenic
1161075515 19:2283298-2283320 TCCCCCAATCCCCTGAGAAGGGG + Intronic
1162796279 19:13089225-13089247 TGCCCACCTCTCTCCAGAAGTGG - Intronic
1162921674 19:13906617-13906639 TCCCCGCCTCCCCCCAGGTGAGG + Intronic
1163036322 19:14571286-14571308 TCCCCACGTCCCCCAAGACTTGG + Intronic
1163526230 19:17823179-17823201 TCCCCCCTGCCCCCCAGAAAAGG - Intergenic
1164679465 19:30124083-30124105 TCCCCACACCCCCGCTGGAGGGG - Intergenic
1165079329 19:33298581-33298603 TCCCCCTTTCCCCCCAGAACAGG - Intergenic
1165708235 19:37991469-37991491 TCCCCACATCCCCAGAGCAAAGG + Intronic
1166351512 19:42200809-42200831 TCCCCACATCTGCGCAAAAGAGG + Intronic
1166531428 19:43545787-43545809 TCCCCCCATCCCTCCTGAAGTGG - Intronic
1166531936 19:43548059-43548081 CCCCCACCTCCCCCCCGACGGGG - Intronic
1166855011 19:45779044-45779066 CCCCCAGATCACCCCAGAAACGG + Intronic
1168515207 19:57005097-57005119 TCCCCCCCTCCCCCCACAACAGG + Intergenic
925308271 2:2865273-2865295 TCCCCACACCACCCCAGACAGGG - Intergenic
927475213 2:23409402-23409424 TCCCCACATCCCCACACAGACGG + Intronic
927737310 2:25535166-25535188 TCCTCACTTCCTCCCAGACGGGG + Intronic
927737358 2:25535360-25535382 TCCTCACTTCCTCCCAGACGGGG + Intronic
927737389 2:25535474-25535496 TCCCCACTTCCTCCCAGACAGGG + Intronic
927737545 2:25536049-25536071 TCCCCACTTCCTCCCAGACGGGG + Intronic
929281853 2:40088263-40088285 CTCCCTCATCCCCCCAGCAGTGG - Intergenic
929650769 2:43677885-43677907 TCCCCACCTCCCTCCAGGACGGG + Intronic
932888123 2:75565517-75565539 TCCCCACATCCTACCACATGAGG - Intronic
933201032 2:79449104-79449126 TCCCCACTCCCCCCAAAAAGGGG + Intronic
933609123 2:84415817-84415839 TCCCCAAATTCCCCCAAAAATGG + Intergenic
933897575 2:86825303-86825325 CCCCCATAGCCCCCCAGTAGGGG - Intronic
935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG + Intergenic
937081885 2:119146165-119146187 TCCCCATCTCCCCTCAGTAGAGG - Intergenic
938307530 2:130265618-130265640 ACCCCACATCCCCCCAGAGCGGG - Intergenic
938447802 2:131391224-131391246 ACCCCACATCCCCCCAGAGCGGG + Intergenic
940913007 2:159225405-159225427 TCCCCACATCCCACCCGGAAGGG + Intronic
942961149 2:181830946-181830968 TCCCCCCATGCCTCAAGAAGAGG - Intergenic
944212003 2:197216116-197216138 TCCTCACAAGCCTCCAGAAGAGG - Intronic
945049952 2:205814234-205814256 TTCCCACATCCTCCCACATGAGG - Intergenic
945150876 2:206789765-206789787 TACCCATCTCCCCTCAGAAGAGG + Intronic
945333644 2:208566938-208566960 TCTTCACCTCCCCACAGAAGTGG - Intronic
946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG + Intergenic
946403457 2:219480869-219480891 TCCCCACACCCCTCCATAAGAGG + Intronic
946448232 2:219757993-219758015 TGCCCACAACCTACCAGAAGAGG + Intergenic
948099179 2:235359881-235359903 TCCCCACAGCCCTCTGGAAGGGG + Intergenic
948376616 2:237525115-237525137 TCCGGACATCCCTCCAGCAGAGG - Intronic
948854128 2:240722177-240722199 TCACCACTTCCACCCACAAGTGG - Intronic
1169077120 20:2768144-2768166 TCCTCACACCCCACCAGATGAGG - Intergenic
1169410725 20:5367466-5367488 ACCCCACCACCACCCAGAAGTGG - Intergenic
1169935931 20:10883330-10883352 TCCCCCCATCCCCCCACCACTGG + Intergenic
1170355184 20:15484661-15484683 TCCCCTCATGCTTCCAGAAGTGG - Intronic
1172044347 20:32069730-32069752 TTCCCAGTTCCCACCAGAAGAGG + Intronic
1172212758 20:33212517-33212539 TCCCCAAATCCACCCAGCTGGGG - Intergenic
1174270323 20:49363755-49363777 TTCTCTCTTCCCCCCAGAAGAGG - Intergenic
1175285723 20:57835602-57835624 CCCCCGCATTCCCCCAGATGAGG + Intergenic
1176089414 20:63312303-63312325 ACCCCACGACCCCCCAGAAACGG - Intronic
1176123244 20:63463625-63463647 TCCCCACCTCCTCCCAGGACAGG + Intronic
1176852874 21:13935772-13935794 TCCTCACTTCCTCCCAGATGGGG + Intergenic
1176852963 21:13936073-13936095 TCCTCACTTCCTCCCAGACGGGG + Intergenic
1176853081 21:13936526-13936548 TCCTCACTTCCTCCCAGACGTGG + Intergenic
1177960487 21:27660463-27660485 TCCCCACATTTCCCCAAGAGAGG - Intergenic
1180125180 21:45785447-45785469 CCCCCACCTCCTCCCAGACGGGG - Intronic
1180214765 21:46317120-46317142 TCCCCACCTCCCCCTGGAGGTGG + Intronic
1181778270 22:25175348-25175370 TACCCACATTTCCCCAGAGGAGG + Intronic
1182884460 22:33761468-33761490 TCCCAGCATCCTCTCAGAAGTGG + Exonic
1183397644 22:37581648-37581670 TCCCCACATCCTGCCCGGAGTGG - Intronic
1183535125 22:38397059-38397081 TCCCCCCCACCCCCCAGAAAAGG - Intronic
1183740236 22:39664931-39664953 TTCCCCCATCCGCCCAGGAGGGG - Intronic
1184152092 22:42645172-42645194 TCCCCACAAGTCTCCAGAAGTGG + Intronic
1184288966 22:43488083-43488105 TCCTCACACCCCCCCAAGAGAGG - Intronic
1184786166 22:46673009-46673031 TCCCCCCATCCCCGCAGCTGGGG - Intronic
1184840337 22:47048760-47048782 GCCCCACCTCCCCCCAGAGCTGG - Intronic
949919740 3:8991342-8991364 ACCCCCAATCTCCCCAGAAGAGG + Intronic
950446933 3:13043891-13043913 TCCCCACTCCCCCTCAGATGAGG + Intronic
951467154 3:23013908-23013930 TCCCCACATCTCTTCAGAAAAGG + Intergenic
953675707 3:45000290-45000312 TCCCCAGAGCCCAACAGAAGGGG - Intronic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
958407237 3:93764730-93764752 TCCTCACTTCCTCCCAGATGGGG + Intergenic
958766630 3:98376883-98376905 TCCTCACTTCCCCGCAGTAGTGG - Intergenic
958936824 3:100264041-100264063 TCTCATCAGCCCCCCAGAAGAGG + Intronic
961134115 3:124494350-124494372 TCCCCACATCCCCCCAGAAGTGG + Intronic
961476109 3:127147366-127147388 CCCCCACACCCACCAAGAAGAGG - Intergenic
967214043 3:187194971-187194993 AGGCCACATCTCCCCAGAAGAGG - Intergenic
969033355 4:4230661-4230683 TCCCCACCCCACCCCACAAGAGG + Intergenic
972321486 4:37977177-37977199 TCCCAACTTCCCGCCAGCAGCGG + Intronic
972700812 4:41491787-41491809 TCCTCACTTCCTCCCAGACGGGG + Intronic
972700832 4:41491864-41491886 TCCTCACTTCCTCCCAGATGGGG + Intronic
973021320 4:45208051-45208073 TCCTCACTTCCTCCCAGATGGGG - Intergenic
974260466 4:59518727-59518749 TCTCCACACCCTCCCAGCAGTGG + Intergenic
975556602 4:75672404-75672426 TCCCCCCATCCCAACAAAAGCGG + Intronic
978731315 4:112030169-112030191 TCCCCAAATCCTACCACAAGTGG - Intergenic
979734679 4:124068627-124068649 TCCCCACATCTCCCCAGTCTTGG - Intergenic
980508965 4:133760039-133760061 TCCCCACCGCCCCCCAAAAAAGG + Intergenic
982206472 4:153000781-153000803 TCCCCTCATCCCCAGAGAACTGG - Intergenic
983717914 4:170808259-170808281 TCCCCAAATGCCCCCACAATAGG - Intergenic
984063137 4:175017018-175017040 AGACCACAGCCCCCCAGAAGTGG + Intergenic
984108039 4:175574790-175574812 ACACCACAGCCCCCCAGAAGTGG + Intergenic
985685055 5:1277588-1277610 CCCCCACATCCCCGCTGCAGCGG - Intronic
985838591 5:2289062-2289084 TCCCCAGGTCTCCCTAGAAGCGG - Intergenic
985840505 5:2301860-2301882 TCCTCCCCTCCCCCCAGCAGTGG + Intergenic
988532568 5:32039867-32039889 TCCTCACTTCCTCCCAGATGGGG - Intronic
988532580 5:32039907-32039929 TCCTCACTTCCTCCCAGATGGGG - Intronic
988532767 5:32040626-32040648 TCCTCACTTCCTCCCAGACGGGG - Intronic
988532797 5:32040743-32040765 TCCTCACTTCCTCCCAGACGGGG - Intronic
989070203 5:37502354-37502376 TCCCCACCTCTCCCAAGAATTGG - Intronic
989075950 5:37563613-37563635 CCCCCACCTCCCCCCGGATGGGG + Intronic
989735642 5:44701269-44701291 CCAACACATCCCCCCAGTAGTGG - Intergenic
990709453 5:58564541-58564563 TCCTCACTTCCTCCCAGACGGGG + Intergenic
993544218 5:89191000-89191022 TCCCCAAACCCCCCAAGATGTGG - Intergenic
993727224 5:91381855-91381877 TCCTCACCACCCCCCAGAACTGG + Intronic
994968432 5:106703785-106703807 TCCCCTCCTCCCCCAGGAAGAGG - Intergenic
997373697 5:133382103-133382125 TGCCCAGATACCCCCTGAAGAGG + Intronic
998441032 5:142162167-142162189 TCCCCAGATCCCCCAATAAAGGG - Intergenic
999104908 5:149062643-149062665 TCCCGAGATCCCCCCAGGACAGG - Intronic
999124304 5:149235726-149235748 TACCCACACACCCCCAGAACTGG + Intronic
999177073 5:149639153-149639175 TCCCCGCATCCCTCCAGTGGAGG + Intergenic
999534610 5:152503287-152503309 TCCCCACATCCTCACAGATCAGG - Intergenic
1001535898 5:172497639-172497661 TCCCCAAATCCCTGCAGAAGGGG - Intergenic
1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG + Intronic
1002118503 5:176983844-176983866 TCCTCACTTCCTCCCAGACGGGG - Intronic
1002118537 5:176983961-176983983 TCCTCACTTCCTCCCAGACGGGG - Intronic
1002473037 5:179448661-179448683 GCACCACATCCCCCCAGACGGGG - Intergenic
1002481187 5:179501993-179502015 GCACCACATCCCCCCAGACGGGG + Intergenic
1002836762 6:871165-871187 TCCCCACAGGGCCCCACAAGGGG + Intergenic
1003150043 6:3540617-3540639 TCCCCACATCCCGCCATAGTAGG + Intergenic
1006316042 6:33292358-33292380 CCCCCACAGCCGCCCAGATGTGG + Intronic
1006630213 6:35425605-35425627 TCCCCACCTCCCCCCCGATTAGG - Intronic
1007340883 6:41191012-41191034 TCCCCACATCCATCCTGAAGTGG + Exonic
1008887583 6:56447711-56447733 TCTCCCCATCCCCCAAGAAAGGG - Intergenic
1008965711 6:57311337-57311359 TCCTCACTTCCTCCCAGACGGGG + Intergenic
1011013413 6:82727294-82727316 TCTCCCCCTCCCCCCAGCAGTGG - Intergenic
1012009891 6:93770262-93770284 TCCCCCCACCCCACCACAAGGGG + Intergenic
1012036924 6:94154227-94154249 TCCCAACTTCCACCCACAAGTGG - Intergenic
1015388456 6:132652931-132652953 TCCCCAGAGTCCCCCAAAAGAGG + Intergenic
1017064821 6:150519059-150519081 TCCCCAGAGCCCACCGGAAGTGG + Intergenic
1017438956 6:154444577-154444599 TCTACACATCCCCTCTGAAGTGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1017855897 6:158349771-158349793 TCCTCACTTCCTCCCAGACGGGG + Intronic
1017855979 6:158350036-158350058 TCCTCACTTCCTCCCAGACGGGG + Intronic
1017856008 6:158350148-158350170 TCCTCACTTCCTCCCAGACGGGG + Intronic
1018738732 6:166711059-166711081 CCCCAACATCCCCCCAGGGGTGG + Intronic
1019128403 6:169856881-169856903 TCCTCACTTCCTCCCAGACGGGG + Intergenic
1019128425 6:169856958-169856980 TCCTCACTTCCTCCCAGATGGGG + Intergenic
1019378954 7:711718-711740 TCCCCACAGACCCCCGGCAGGGG + Intronic
1019548871 7:1592406-1592428 TCCCCACACCCCCGCAGAGTGGG - Intergenic
1019693618 7:2432257-2432279 TGCCCACAACTCCCAAGAAGAGG - Intronic
1020098392 7:5380959-5380981 TCTCCCCGTGCCCCCAGAAGAGG + Intronic
1024162994 7:46698371-46698393 TCCCCTCGACCCCCCACAAGTGG - Intronic
1024629041 7:51232244-51232266 TCCCCTCATCCCCCCAAAAAAGG + Intronic
1024910679 7:54444096-54444118 TCCTCACTTCCTCCCAGACGGGG - Intergenic
1024984120 7:55181068-55181090 TCCCCAGATGCACCCAGGAGGGG + Intronic
1024992790 7:55249561-55249583 TCTCCACATTCCTCCAGGAGAGG + Intronic
1026878803 7:73895079-73895101 TCCCCACAACCCCCAGGGAGGGG + Intergenic
1029311261 7:99667230-99667252 GCCCCACATACACTCAGAAGAGG - Intronic
1029569146 7:101359107-101359129 ACCCCACCTCCCTCCAGACGGGG + Intergenic
1029715379 7:102322579-102322601 TCCCCACAACACCCCAGACCTGG + Intergenic
1032047590 7:128622368-128622390 GCCCCAAAACCCCCCTGAAGGGG - Intergenic
1032079077 7:128849730-128849752 TCCCCACAGCACCCCCGAAGTGG + Intronic
1032382123 7:131496188-131496210 ACCCCACATTGCCACAGAAGAGG - Exonic
1033077457 7:138262890-138262912 TCCCCACATCATGCCAGAAGAGG - Intergenic
1034638454 7:152585541-152585563 CCCCCACCTCCTCCCGGAAGGGG + Intergenic
1036416111 8:8550184-8550206 TCCCCACATCCTCCCTGAAGTGG - Intergenic
1036896541 8:12640691-12640713 TCCCCTCCTCCCCACAGGAGGGG + Intergenic
1037302706 8:17469592-17469614 ATACCACAGCCCCCCAGAAGTGG + Intergenic
1037639881 8:20732817-20732839 CCCCCACAAACCCCCAGCAGAGG - Intergenic
1037777602 8:21846106-21846128 TCCCCACAACCCCACTGAAATGG - Intergenic
1037823334 8:22146422-22146444 CCGCCACATCCACCCAGATGAGG - Intergenic
1038355188 8:26822782-26822804 TCCTGAGATCTCCCCAGAAGCGG - Intronic
1038788604 8:30646351-30646373 TCCCCCCATCCCCCCAAAAAAGG + Intronic
1039536903 8:38324762-38324784 CCCCCCCATCCTCCGAGAAGGGG + Intronic
1040073191 8:43204823-43204845 ACCCCACGGCCCCCCAGACGGGG + Intergenic
1040916804 8:52572962-52572984 TCCTCACTTCCTCCCAGACGGGG + Intergenic
1041101004 8:54396394-54396416 TCACCACATCCTCCCTGCAGGGG - Intergenic
1041125635 8:54635798-54635820 TCCCCTCTTCCCTCCTGAAGGGG - Intergenic
1041358251 8:57022495-57022517 CCCCCACCTCCCTCCAGATGGGG - Intergenic
1044582260 8:93834609-93834631 TCCTCACTTCCTCCCAGATGGGG + Intergenic
1044582291 8:93834723-93834745 TCCTCACTTCCTCCCAGACGGGG + Intergenic
1047501591 8:125445899-125445921 TAACCACTTCTCCCCAGAAGGGG - Intergenic
1047914241 8:129565112-129565134 TCCCCACATGCCCCCCAGAGTGG - Intergenic
1049048684 8:140173651-140173673 TCCCCACATACCTCCAGTAGGGG + Intronic
1049159595 8:141088894-141088916 ACCCCACATGTACCCAGAAGAGG - Intergenic
1049374427 8:142282208-142282230 TCCCTACACCCCCCCAGCACGGG + Intronic
1049570768 8:143369317-143369339 GCCCCACATCCGCCCAGAAGGGG - Intronic
1050417565 9:5433070-5433092 TCCTCACTTCCTCCCAGACGGGG - Intronic
1050417777 9:5433949-5433971 TCCTCACTTCCTCCCAGACGGGG - Intronic
1050417788 9:5433989-5434011 TCCTCACTTCCTCCCAGACGGGG - Intronic
1054567614 9:66775373-66775395 GCCCCTCATCCACCCAGCAGAGG + Intergenic
1055115174 9:72598175-72598197 CCCCCACATACCCTCAGAAATGG + Intronic
1056072513 9:83003221-83003243 CCCCCACACACACCCAGAAGGGG + Intronic
1056229362 9:84527413-84527435 TCCTCACTTCCTCCCAGACGGGG + Intergenic
1056765940 9:89444431-89444453 TGCCCACATCCCGTCAGTAGCGG - Intronic
1056766292 9:89446654-89446676 TTCCCACTTCCCCTCAGCAGGGG + Intronic
1057150527 9:92792329-92792351 TCCCCAGATCACCCCAAGAGTGG - Intergenic
1057820257 9:98324676-98324698 TCCCCACACACCGCCAGCAGTGG - Intronic
1057836736 9:98451525-98451547 TCCCCACTGCCCCCCAGCAGTGG + Intronic
1057838255 9:98464284-98464306 TCCTCACTTCCTCCCAGACGGGG - Intronic
1058132606 9:101269786-101269808 TCCCTCCATCACCCCAGCAGCGG - Intronic
1058800781 9:108542817-108542839 TCCCCACTGCCACCTAGAAGAGG - Intergenic
1060008916 9:120026323-120026345 TGCACACAACCCCCAAGAAGGGG + Intergenic
1060930615 9:127487392-127487414 TCCCCAGCACCCCCCGGAAGTGG - Intronic
1061175553 9:128994100-128994122 TCCCAAAAGCCCCACAGAAGAGG - Intronic
1062116765 9:134813819-134813841 TCCCCACACACTCCCAGAATTGG - Intronic
1062349386 9:136131634-136131656 AGCCCAAATGCCCCCAGAAGAGG - Intergenic
1062366638 9:136212707-136212729 TCCCCACATCACCGCAGGCGCGG + Intronic
1062546408 9:137065481-137065503 TCCCCAGATCCCCACACATGGGG - Intronic
1185642032 X:1593693-1593715 TCTCCACCTCCCCCTCGAAGCGG - Exonic
1185999898 X:4997497-4997519 TCCCCAGATCTCACCAGGAGGGG - Intergenic
1186211449 X:7254280-7254302 TCTGAACATCCTCCCAGAAGTGG + Intronic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1189316597 X:40061322-40061344 TCCCCCCATCCCCCCAAACTCGG - Intronic
1190193511 X:48296772-48296794 CCCCCACATCCCTGCAGATGTGG - Intergenic
1190660025 X:52645395-52645417 CCCCCACATCCCTGCAGATGTGG - Intronic
1190842430 X:54157748-54157770 TAACCACATCCTCCCAGATGAGG - Exonic
1192232391 X:69274512-69274534 TCCCCACATCCCTCCACCAGGGG + Intergenic
1192504876 X:71675719-71675741 TCCTCACTTCCTCCCAGATGGGG - Intergenic
1192504933 X:71675947-71675969 TCCTCACTTCCTCCCAGACGGGG - Intergenic
1192663616 X:73067981-73068003 TCCTCACTTCCTCCCAGACGGGG - Intergenic
1192885917 X:75335536-75335558 TCCTCACTTCCTCCCAGACGAGG + Intergenic
1192885927 X:75335576-75335598 TCCTCACTTCCTCCCAGACGGGG + Intergenic
1192885948 X:75335653-75335675 TCCTCACTTCCTCCCAGACGGGG + Intergenic
1198871490 X:141180579-141180601 TCCCTACAACCCCACAGCAGAGG + Intergenic
1199143459 X:144336859-144336881 TCCCCATATCTCCTCAGAAGGGG + Intergenic
1200101932 X:153692638-153692660 CCCCCACCTCTCTCCAGAAGAGG + Intronic
1201676288 Y:16588486-16588508 TCCCCAGATCTCACCAGGAGGGG + Intergenic