ID: 961137576

View in Genome Browser
Species Human (GRCh38)
Location 3:124526276-124526298
Sequence ATAAAAATACATATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1463
Summary {0: 1, 1: 1, 2: 8, 3: 83, 4: 1370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961137576 Original CRISPR ATAAAAATACATATGGAGCC AGG Intronic
901300058 1:8193442-8193464 AAAAAAAAAAATCTGGAGCCTGG + Intergenic
901315587 1:8305496-8305518 ATAAAAATACAAAATTAGCCAGG + Intergenic
901359680 1:8686452-8686474 ATAAAAATAAAGATGTAGCCGGG + Intronic
901393080 1:8960068-8960090 CTAAAAATACAAAAGTAGCCAGG + Intronic
901485436 1:9557092-9557114 ATAAAAATACAAAATTAGCCGGG - Intronic
901578334 1:10219297-10219319 CTAAAAATACAAATTTAGCCGGG + Intronic
901698521 1:11029797-11029819 ATAAAAATACAAAATTAGCCGGG - Intronic
901750838 1:11407038-11407060 ATAAAAATACATTTCTTGCCTGG - Intergenic
901761818 1:11476893-11476915 TTAAAAATGCAAATGGAACCAGG - Intergenic
901937132 1:12634671-12634693 CTAAAAATACATAATTAGCCAGG - Intergenic
902064449 1:13672731-13672753 CTAAAAATACAAAAGGAGCCGGG - Intergenic
902099616 1:13975191-13975213 ATCCAAATACATGTGGAGGCAGG - Intergenic
902223878 1:14984194-14984216 CTAAAAATACAAAATGAGCCAGG + Intronic
902231464 1:15030234-15030256 ATAAAAATAAAGATGCATCCCGG - Intronic
902312262 1:15590206-15590228 ATAAAAATCCAGATTGGGCCAGG + Intronic
902339892 1:15776120-15776142 TAAAAAACACATATGGGGCCGGG + Intronic
902365066 1:15967687-15967709 ATAACAGTAATTATGGAGCCAGG + Intronic
902589560 1:17463875-17463897 ATAAAAATACAAAATTAGCCGGG + Intergenic
902848513 1:19132475-19132497 TTAAAAATACATATTCAGCCAGG - Intronic
902922000 1:19671787-19671809 ATAAATAGACATATGGAGAGGGG - Intronic
902925662 1:19694295-19694317 ATAAGAATTTATTTGGAGCCAGG - Intronic
902985816 1:20153449-20153471 AAAAAAAGACATATTGGGCCAGG + Intergenic
903075923 1:20766128-20766150 ATAAAAATACATAATTAGCCAGG + Intronic
903370259 1:22830716-22830738 CTAAAAATACAAAATGAGCCAGG - Intronic
903419508 1:23208408-23208430 ATAAAAATACAAAAGTAGCTGGG + Intergenic
903957006 1:27032596-27032618 AAAAAAATACAAAAGCAGCCGGG - Intergenic
904053047 1:27651994-27652016 CTAAAAATACAAATTTAGCCAGG - Intergenic
904067752 1:27767557-27767579 CTAAAAATACAAAATGAGCCAGG + Intergenic
904083819 1:27889261-27889283 TTAAAAATCAATATGGGGCCAGG - Intergenic
904091366 1:27947195-27947217 ATAAAAATACAAAATTAGCCGGG - Intronic
904100851 1:28025918-28025940 CTAAAAATACAAAAGTAGCCGGG - Intronic
904123207 1:28216967-28216989 CTAAAAATACAAAATGAGCCGGG - Intronic
904123366 1:28218254-28218276 CTAAAAATACAAAATGAGCCGGG - Intronic
904168841 1:28576758-28576780 CTAAAAATACAAAATGAGCCGGG - Intronic
904508956 1:30985489-30985511 ATAAAAATACAAAATTAGCCGGG + Intronic
904630072 1:31834340-31834362 ATAAAAATACAAACTTAGCCGGG + Intergenic
904726397 1:32551550-32551572 CTAAAAATACAAAATGAGCCGGG + Intronic
905065419 1:35177052-35177074 CTAAAAATACAAAATGAGCCGGG + Intronic
905109477 1:35584827-35584849 ATAAAACTACAAATGAGGCCAGG - Intronic
905144645 1:35878378-35878400 ATAAAAATTAAAAAGGAGCCGGG - Intronic
905382654 1:37574185-37574207 ATAAAAATATTTTTGGGGCCGGG - Intronic
905992344 1:42349276-42349298 CTAAAAATACAAAAGTAGCCGGG - Intergenic
906314458 1:44777230-44777252 CTAAAAATACAGAAGCAGCCGGG - Intronic
906387822 1:45386945-45386967 AAAAAACTACATATGGGGCTGGG - Intronic
906389759 1:45404702-45404724 ATAAAAATACAAAAATAGCCCGG - Intronic
906445895 1:45897807-45897829 TTAAAAAAACAAATAGAGCCAGG + Intronic
906643481 1:47456231-47456253 CTAAAAATACAAAAGTAGCCAGG + Intergenic
906984609 1:50669958-50669980 ATAAAAATACAAAATAAGCCAGG + Intronic
907043287 1:51282513-51282535 CTAAAAATACAAAAGTAGCCGGG + Intergenic
907088874 1:51705754-51705776 ACAAAAATATATATGGAACAAGG - Intronic
907217078 1:52873462-52873484 CTAAAATTATAAATGGAGCCTGG + Intronic
907343734 1:53756815-53756837 ATAAAAATACGTATTGAGGCCGG - Intergenic
908299655 1:62751585-62751607 ATAAAAATATATATAAAGCTAGG - Intergenic
908304597 1:62799210-62799232 ACAAAAATTTAAATGGAGCCTGG - Intronic
908423744 1:63984713-63984735 ATGAAAATACATATTGAGTCAGG - Intronic
909127014 1:71685481-71685503 CTAAAAATACAAAAGTAGCCAGG - Intronic
909569998 1:77098632-77098654 GTAAAAATACCTTTGCAGCCAGG - Intronic
909725771 1:78833066-78833088 CTAAAAATACAAAATGAGCCGGG + Intergenic
909753577 1:79194687-79194709 CTAAAAATACAAATTTAGCCGGG + Intergenic
910317334 1:85901511-85901533 ATAAAACTAAAAATGGAGCCTGG + Intronic
910348404 1:86267914-86267936 TTAAAAAAAGATATGCAGCCAGG + Intergenic
910393050 1:86763985-86764007 ATAAAAATACAAAATTAGCCAGG - Intergenic
911347041 1:96709578-96709600 CTAAAAATACATAATTAGCCAGG - Intergenic
911592448 1:99763705-99763727 CTAAAAATACAAAAGTAGCCGGG + Intronic
911734000 1:101317496-101317518 TTGAAAATACATTTGCAGCCAGG - Intergenic
911994713 1:104750940-104750962 ATAAGAATATATATGCAGCCAGG + Intergenic
912099541 1:106189160-106189182 CTACAAAGACATATGCAGCCGGG + Intergenic
912163448 1:107013693-107013715 ATAAAAATACAAAATTAGCCGGG + Intergenic
912297264 1:108482308-108482330 ATAAAAATAAATAAATAGCCAGG + Intergenic
912297391 1:108483586-108483608 ATAAAAATAAATAAATAGCCAGG + Intergenic
912360140 1:109088568-109088590 CTAAAAATACAAAAGTAGCCGGG - Intergenic
912626255 1:111206783-111206805 CTAAAAATACAAAAGTAGCCGGG - Intronic
912774472 1:112496759-112496781 CTAAAAATACAAAAGTAGCCGGG - Intronic
912826439 1:112908285-112908307 ATAAAAATACAAAATTAGCCGGG - Intergenic
912939026 1:114028860-114028882 CTAAAAATACAAATTTAGCCAGG - Intergenic
913111575 1:115661911-115661933 ATAAAAATATACATCCAGCCAGG - Intronic
913124294 1:115771067-115771089 ATAAAAATACAAAATTAGCCAGG - Intergenic
913533737 1:119751701-119751723 ATGAAAATAAAAATGGAGCAGGG - Intronic
914233842 1:145790299-145790321 ATAAAAATACAAAATTAGCCAGG - Intronic
914770186 1:150677042-150677064 ATAAAATTACGCATGTAGCCTGG - Intronic
915210007 1:154301518-154301540 ATAAAAATACAAAATTAGCCAGG - Intergenic
915224305 1:154401394-154401416 ATAAAAATAAAAATAGGGCCAGG - Intergenic
915390181 1:155535835-155535857 ATAAAAATACAAAATTAGCCAGG + Intronic
915405694 1:155658186-155658208 CTAAAAATACAAAATGAGCCTGG - Intergenic
915422703 1:155797539-155797561 ATAAACAGACATATACAGCCTGG + Intronic
915786579 1:158619783-158619805 CTAAAAATACATACGTAGCAAGG + Intronic
915870012 1:159549225-159549247 TTTAAAATTCATATGGAGGCTGG + Intergenic
916013293 1:160726019-160726041 ATCAAAATACATTTGGAAGCGGG - Intergenic
916207954 1:162333484-162333506 ATATGAATACACATGGAGTCTGG + Intronic
916236734 1:162596334-162596356 ATAAAAATACAAAATTAGCCGGG - Intronic
916793820 1:168147189-168147211 ATAAAAAAACATGTAGAGGCCGG + Intergenic
917082937 1:171274471-171274493 AAAATAATAAATATGTAGCCTGG - Intronic
917177375 1:172251568-172251590 ATACACACACATATGCAGCCTGG - Intronic
917307345 1:173640122-173640144 ATAACATTTCATATGGAGACAGG - Intronic
917616172 1:176746824-176746846 ATAAATATCCATATGGAAACTGG + Intronic
917641952 1:176991250-176991272 CTAAAAATACAAAAGTAGCCTGG + Intronic
917643531 1:177007230-177007252 CTAAAAATACAAAATGAGCCGGG + Intronic
917644846 1:177019712-177019734 ATAGAAATACAGAGGGAGGCTGG + Intronic
917936119 1:179869001-179869023 CTAAAAATACAAAAGTAGCCGGG - Intronic
917945640 1:179967903-179967925 ACAAATACACATATGAAGCCAGG - Intronic
918820816 1:189251935-189251957 ATCAAAATACATATGTATCTGGG - Intergenic
918947759 1:191091910-191091932 ATAAAAATACAAAATTAGCCAGG - Intergenic
919408585 1:197215436-197215458 CTAAAAATACAAAAGTAGCCGGG - Intergenic
919454542 1:197805912-197805934 ATAAAAATACAAAATTAGCCGGG - Intergenic
919841643 1:201613699-201613721 ATAAAAATACAAAATTAGCCAGG + Intergenic
919955977 1:202416363-202416385 CTAAAAATACAAAATGAGCCAGG + Intronic
920024363 1:202982458-202982480 CTAAAAATACATAATTAGCCGGG - Intergenic
920177506 1:204112142-204112164 ATAAAAATGCATTTGTAGGCTGG + Intronic
920410218 1:205753357-205753379 GTCAAAACATATATGGAGCCGGG - Intergenic
920656535 1:207879845-207879867 AAAAAAATATATATGGAGAGAGG - Intergenic
920656573 1:207880290-207880312 CTAAAAATACAAAAGTAGCCGGG - Intergenic
921006692 1:211100644-211100666 ATATAAATACATGAGGGGCCGGG - Intronic
921056108 1:211543649-211543671 TTAAAAAGACATTTGGGGCCAGG - Intergenic
921149681 1:212390045-212390067 AAAAAAAACCAAATGGAGCCCGG + Intronic
921568885 1:216754611-216754633 ATAAATATATAAATAGAGCCCGG - Intronic
921746475 1:218746048-218746070 ATAAAAACACACATAGAGGCCGG + Intergenic
921785834 1:219228838-219228860 ATAAAAATACAAAATTAGCCAGG - Intergenic
921807749 1:219475364-219475386 ATAAAAATACAAAATTAGCCAGG + Intergenic
921889012 1:220335155-220335177 ATCTAAATATATATGTAGCCAGG - Intergenic
922487155 1:225982395-225982417 CTAAAAATACAAAATGAGCCAGG + Intergenic
922581980 1:226705366-226705388 CTAAAAATACAAAATGAGCCGGG + Intronic
922611547 1:226933133-226933155 CTAAAAATACAAATTTAGCCAGG - Intronic
923104763 1:230845519-230845541 ATAAAAATACAAAATTAGCCAGG + Intronic
923125948 1:231034609-231034631 CTAAAAATACAAAAAGAGCCGGG + Intronic
923358538 1:233184494-233184516 ATCAAAATATATTTGGAGCCTGG - Intronic
923487027 1:234443127-234443149 ATAAAAATACAAAATTAGCCAGG + Intronic
923521550 1:234738854-234738876 ATCAAAATATATATGTGGCCAGG - Intergenic
923579495 1:235194657-235194679 CTAAAAATACAAAAGTAGCCGGG + Intronic
924023257 1:239806986-239807008 ATCAAAACTCATGTGGAGCCAGG - Intronic
924219007 1:241854296-241854318 CTAAAAATACAAAAGTAGCCGGG - Intronic
924362900 1:243259656-243259678 CTAAAAATACAAAATGAGCCAGG + Intronic
924576432 1:245284876-245284898 ATAAAAATACAAAATTAGCCGGG + Intronic
924576754 1:245287662-245287684 ATAAAAATACAAAATTAGCCGGG - Intronic
1063532549 10:6848451-6848473 ATAAAAATACAGAAATAGCCAGG - Intergenic
1063873683 10:10447938-10447960 ATAAAAATACAAAATTAGCCGGG - Intergenic
1064062302 10:12148404-12148426 ATAAAAATACAAAAGTATCCGGG - Intronic
1064291225 10:14035689-14035711 ATAAAAATACAGCTGGATCGAGG - Intronic
1064359554 10:14651442-14651464 CTAAAAATACAAAATGAGCCAGG + Intronic
1064532996 10:16329369-16329391 ATATATATATATATGGAGTCAGG + Intergenic
1064597419 10:16960194-16960216 TTCAAAATACATATGAGGCCGGG + Intronic
1065087824 10:22197726-22197748 ATATAAATATATATGAGGCCGGG + Intergenic
1065828731 10:29595647-29595669 ACAAAAATACATATGGCCCAGGG + Intronic
1065880285 10:30031735-30031757 AAAAAAATACAGATGGGGCTGGG - Intronic
1065880341 10:30032047-30032069 TTAAAAATACAGATGGAGCCGGG - Intronic
1066091853 10:32030353-32030375 CTAAAAATACAAAATGAGCCGGG + Intronic
1066096682 10:32078880-32078902 ATCAAAATAAATATGTGGCCAGG + Intergenic
1066125043 10:32333177-32333199 CTAAAAATACAAATTTAGCCGGG + Intronic
1066641468 10:37558246-37558268 AAAAAAATATATATATAGCCAGG + Intergenic
1066673384 10:37862846-37862868 TTAAACATACATATGCAGGCTGG - Intergenic
1066987623 10:42482089-42482111 AGAAAATTACATAGAGAGCCGGG + Intergenic
1067353522 10:45501033-45501055 ATAAAAATACATACTGTTCCTGG + Intronic
1067405706 10:46021796-46021818 ATAAAAATACAAAATTAGCCGGG + Intronic
1067445738 10:46343310-46343332 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1067480676 10:46595474-46595496 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1067483224 10:46619954-46619976 ATAAAAATACAAAATTAGCCAGG + Intergenic
1067591639 10:47517431-47517453 CTAAAAATACAAAAGTAGCCGGG - Intronic
1067611530 10:47721690-47721712 ATAAAAATACAAAATTAGCCAGG - Intergenic
1067614063 10:47746327-47746349 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1067638754 10:48025505-48025527 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1067874727 10:49994799-49994821 CTAAAAATACAAAAGTAGCCGGG + Intronic
1068389542 10:56376790-56376812 ATAAAAATACAAAATTAGCCGGG - Intergenic
1068396013 10:56463141-56463163 ATAAAACTACATATTGAGAATGG + Intergenic
1068638658 10:59376601-59376623 AGAAATGCACATATGGAGCCTGG + Intergenic
1068777797 10:60886833-60886855 ACAAAAATACACATATAGCCAGG - Intronic
1068887719 10:62114708-62114730 GTAAAAATACAGGTGGATCCTGG - Intergenic
1068967861 10:62931746-62931768 ATAAAAATACAAAAGTAGCCAGG + Intergenic
1069143282 10:64855950-64855972 AAAAAAATACTTATGGGGCCAGG - Intergenic
1069378761 10:67820942-67820964 CTAAAAATACAAAGTGAGCCGGG - Intronic
1069401732 10:68055081-68055103 ATAAAAATACAAAAATAGCCAGG - Intronic
1069475108 10:68724975-68724997 CTAAAAATACAAAGGTAGCCTGG + Intronic
1069495173 10:68897217-68897239 ATAAAAAAAGATCTGGGGCCGGG - Intergenic
1070010967 10:72474093-72474115 ATAAAAATACAAAATTAGCCGGG + Intronic
1070135741 10:73691651-73691673 CTAAAAATACAAAAGTAGCCGGG - Intronic
1070209318 10:74299195-74299217 GTAAAAATATATGTGGAGGCCGG + Intronic
1070254336 10:74801030-74801052 CTAAAAATACAAAATGAGCCGGG + Intergenic
1070260209 10:74847501-74847523 AAAAAAATACAAAAGTAGCCGGG + Intronic
1070264609 10:74890196-74890218 CTAAAAATACAAAATGAGCCAGG - Intronic
1070433750 10:76367583-76367605 ATAAAAATACAAAATTAGCCGGG - Intronic
1070936261 10:80298173-80298195 ATAAGAATACATAGCCAGCCCGG - Intergenic
1071016238 10:81000264-81000286 ATAGATATACAGATGTAGCCTGG - Intergenic
1071171934 10:82876860-82876882 ATAAAAATACAAAATTAGCCAGG + Intronic
1071626952 10:87181928-87181950 ATAAAAATACAAAATTAGCCAGG - Intronic
1071629474 10:87206301-87206323 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1071832919 10:89390145-89390167 CTAAAAATACATAATTAGCCGGG - Intronic
1072132059 10:92503877-92503899 ATAAAAATACAAAATTAGCCAGG - Intronic
1072158529 10:92745454-92745476 TTTAAAATACATCTGCAGCCAGG - Intergenic
1072298920 10:94040249-94040271 TTAAAATCACATTTGGAGCCAGG - Intronic
1072705991 10:97681419-97681441 CTAAAAATACAAAAGTAGCCGGG + Intronic
1073005823 10:100323562-100323584 ATAAAGATACAGAGTGAGCCGGG - Intronic
1073297001 10:102446713-102446735 ATAAAAATAAAAATAAAGCCTGG + Intergenic
1073300326 10:102467329-102467351 TTAAAAAGACATATGGGGCTGGG - Intronic
1073373185 10:103009113-103009135 CTAAAAATACAAAAGTAGCCAGG + Intronic
1073411611 10:103346632-103346654 ATAAAAATACAAAATTAGCCAGG + Intronic
1073413464 10:103361941-103361963 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1073440795 10:103551597-103551619 ATAAAATTTCATTTGGGGCCGGG - Intronic
1073619504 10:105032029-105032051 CTAAAAATACAAAATGAGCCAGG + Intronic
1074096159 10:110314845-110314867 CTAAAAATACAAATTTAGCCGGG - Intergenic
1074167716 10:110899634-110899656 TTAAAAATACAAAAGTAGCCAGG + Exonic
1074374999 10:112933411-112933433 TTAAAAATAAATTTGCAGCCAGG + Intergenic
1074432320 10:113404493-113404515 CTAAAAATACAAAATGAGCCGGG - Intergenic
1074571447 10:114627959-114627981 ATAAAAATACAAAATTAGCCGGG + Intronic
1074960634 10:118442165-118442187 ATAATAAGACATATGGAGGTGGG + Intergenic
1075288513 10:121208300-121208322 CTAAAAATACAAATTTAGCCAGG + Intergenic
1075386507 10:122059210-122059232 TTAAAAACACAGATGGAGCCCGG - Intronic
1075694385 10:124422809-124422831 TTAAAAATACACATAGAGACAGG + Intergenic
1075807886 10:125203127-125203149 ATAAAAATACAAAATTAGCCCGG + Intergenic
1075886107 10:125900810-125900832 ATAAAAATACAAAATTAGCCAGG - Intronic
1077037176 11:500965-500987 CTAAAAATACAAAAGTAGCCGGG + Intronic
1077084959 11:745133-745155 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1077622773 11:3742403-3742425 ATAAAAATAAAGATGGGGCCAGG + Intronic
1078161840 11:8846811-8846833 ATCAAAATACAAATGGATCATGG - Intronic
1078212135 11:9278493-9278515 ATAAAAATACAAAATTAGCCAGG + Intergenic
1078219495 11:9339748-9339770 ATAAAAATACAAAATTAGCCGGG + Intergenic
1078830943 11:14975775-14975797 ATAAAAATAAACATGAAGTCTGG + Intronic
1079058063 11:17224630-17224652 ATAAAAATACAAAATTAGCCAGG - Intronic
1079207107 11:18425642-18425664 TTAAAAATACATTTTGTGCCAGG + Intronic
1079223021 11:18580999-18581021 ATAAAAATACAAAATTAGCCGGG + Intronic
1079457879 11:20652421-20652443 ATAAAAATGCATCTGGCCCCTGG + Exonic
1080021562 11:27566125-27566147 ATAAAAATACAAAATTAGCCGGG + Intergenic
1080775138 11:35379065-35379087 CTAAAAATACAAAAGTAGCCAGG + Intronic
1080889581 11:36397954-36397976 CTAAAAATACAAAATGAGCCGGG - Intronic
1081116120 11:39203612-39203634 AAAAGAACACATATGGGGCCGGG + Intergenic
1082040914 11:47684110-47684132 CTAAAAATACAAAAGTAGCCAGG + Intronic
1082046996 11:47737905-47737927 CTAAAAATACAAAAGTAGCCAGG - Intronic
1082143708 11:48641221-48641243 ATAAAAATACAAAATTAGCCAGG - Intergenic
1083284637 11:61650600-61650622 ATAAAAATAAAAAAGAAGCCAGG - Intergenic
1083336587 11:61925335-61925357 TTAAATATCCATATAGAGCCGGG + Intergenic
1083452687 11:62756617-62756639 ATATAAATATATATGAGGCCAGG - Intergenic
1083479740 11:62936229-62936251 TTAAAAGTAACTATGGAGCCAGG - Intergenic
1083851439 11:65369869-65369891 CTAAAAATACAAAATGAGCCGGG + Intergenic
1084015330 11:66376070-66376092 ATAAAAATAAATGTGTTGCCTGG - Intergenic
1084200666 11:67555828-67555850 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1085030529 11:73268463-73268485 AAAAAAATACAAATTTAGCCAGG + Intronic
1085072539 11:73560765-73560787 ATAAAACTAAACATGCAGCCAGG + Intronic
1085108938 11:73870695-73870717 ATAAAAATACATTTCTGGCCAGG + Intergenic
1085420758 11:76356879-76356901 CTAAAAATACAAAAAGAGCCGGG + Intronic
1085444429 11:76590913-76590935 ATAATCAAAAATATGGAGCCTGG + Intergenic
1085629599 11:78103162-78103184 ATAAAAATACAAAATTAGCCGGG + Intronic
1086035494 11:82409631-82409653 ATAAAAATACAAAATTAGCCAGG + Intergenic
1086482087 11:87252475-87252497 ATAAAAATAGACATGGAGCCGGG + Intronic
1087020161 11:93594712-93594734 ATAAAAATACAAAATTAGCCAGG - Intergenic
1087180911 11:95141780-95141802 ATAAAAATACATATAAAGAAAGG - Intergenic
1087230418 11:95655107-95655129 ATAAAAATACAAAATTAGCCAGG + Intergenic
1087262823 11:96029936-96029958 TTTAAAATTCATATGGAGCCAGG + Intronic
1087973598 11:104516370-104516392 ATACAAATAGATATGGAGTATGG - Intergenic
1088202572 11:107355252-107355274 CTAAAAATACAAAAGTAGCCGGG + Intronic
1089421806 11:118337690-118337712 TTAAAAATATAAATGCAGCCAGG - Intergenic
1089490738 11:118882248-118882270 ATAAAAATACAAAATTAGCCGGG + Intergenic
1089546177 11:119227709-119227731 ATAAAAATACAAAATTAGCCAGG - Intronic
1089592106 11:119548329-119548351 CTAAAAATACAAAATGAGCCGGG + Intergenic
1089975847 11:122730754-122730776 CTAAAAATACAAAATGAGCCGGG - Intronic
1090069711 11:123533128-123533150 AAAAAAATACAAATTTAGCCAGG - Intronic
1090320975 11:125843338-125843360 ATAAAACTATATATTGGGCCTGG - Intergenic
1090370152 11:126245018-126245040 TTTAAAATTCATATGGGGCCAGG + Intronic
1090370263 11:126245833-126245855 ATAAAAATACATAATTAGCTGGG + Intronic
1091318686 11:134634343-134634365 CTAAAAATACATAATTAGCCGGG - Intergenic
1091420866 12:339015-339037 ACTAAAATACATAAGTAGCCGGG + Intronic
1091503385 12:1041366-1041388 CTAAAAATACAAAAGTAGCCAGG - Intronic
1091562652 12:1626859-1626881 TTAAAAATACATTTGGCGGCCGG - Intronic
1092343589 12:7697074-7697096 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1092344820 12:7706352-7706374 CTAAAAATACAAAATGAGCCGGG + Intergenic
1092353450 12:7774976-7774998 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1092788897 12:12054785-12054807 CTAAAAATACAAAATGAGCCAGG + Intronic
1092795321 12:12105601-12105623 ATAAAAACACAAATGAGGCCAGG + Intronic
1092866386 12:12765346-12765368 ATATAAAAATATATTGAGCCGGG - Intronic
1093312921 12:17613929-17613951 ATAAAAATAAATATGTAGAAAGG - Intergenic
1093371211 12:18367717-18367739 CTAAAAATACATAATTAGCCAGG - Intronic
1093703303 12:22247025-22247047 ATATAAATACAAATGGAGGAAGG - Intronic
1093966838 12:25336891-25336913 ATAAAAATCCATATCTAGGCTGG + Intergenic
1094029796 12:25998508-25998530 ATAAAAATACAAAATTAGCCAGG - Intronic
1094212856 12:27910585-27910607 ATAAAAATACAAAATTAGCCAGG + Intergenic
1094244825 12:28277156-28277178 ATAAAAATATATTTGAACCCAGG - Intronic
1094278706 12:28709654-28709676 ATAAACACACATATAGAGCTAGG - Intergenic
1094340458 12:29405478-29405500 ATAAAAATACATATAAACCTAGG + Intergenic
1094531846 12:31283304-31283326 ATAAAAATACATGTGTGGGCCGG + Intronic
1094541509 12:31366779-31366801 TTAAAAATACATATTCTGCCGGG + Intergenic
1094637362 12:32239403-32239425 CTAAAAATACAAAATGAGCCGGG + Intronic
1094646028 12:32325132-32325154 AAAAAAACATAAATGGAGCCAGG - Intronic
1094689929 12:32758630-32758652 ATAAAAATACAAAATTAGCCGGG + Intergenic
1095050675 12:37551534-37551556 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1095462896 12:42461040-42461062 CTAAAAATACAAAAGTAGCCAGG - Intronic
1095748763 12:45688346-45688368 ATAAAAATAGAAATAGTGCCAGG + Intergenic
1095957618 12:47815770-47815792 CTAAAAATACAAATTTAGCCAGG - Intronic
1096074334 12:48793081-48793103 ATAAAAATACAAAATTAGCCGGG + Intergenic
1096295393 12:50379623-50379645 TTAAAAATACAAAAGTAGCCGGG + Intronic
1096397916 12:51280528-51280550 AAAAAAATACAAAAGCAGCCGGG - Intergenic
1096709858 12:53447481-53447503 CTAAAAATACAGAATGAGCCAGG + Intergenic
1096737061 12:53663913-53663935 CTAAAAATACAAAAGTAGCCAGG - Intronic
1096756028 12:53800205-53800227 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1096935256 12:55267050-55267072 AAAAAAATACATTTTGAGGCCGG - Intergenic
1097766331 12:63531260-63531282 ATAAAAATACAAAATTAGCCAGG + Intergenic
1097782768 12:63727098-63727120 ATAAAAATACAAAATTAGCCAGG + Intergenic
1097793350 12:63838698-63838720 CTAAAAATACAAAGGTAGCCGGG - Intergenic
1098161837 12:67653124-67653146 TTAAAAATACATACTGAGGCCGG - Intronic
1098347257 12:69518851-69518873 CTAAAAATACAAAAGTAGCCAGG + Intronic
1098581310 12:72102601-72102623 CAAAAAATATATATGGAGCTAGG + Intronic
1098593999 12:72249523-72249545 ATAAAAAGACATATGGAAGCTGG + Intronic
1098677685 12:73311248-73311270 TTTAAAATTCATATGGAACCAGG - Intergenic
1098687469 12:73442185-73442207 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1098781646 12:74694906-74694928 AAAAAAATACATAATGAGGCTGG + Intergenic
1098970547 12:76850421-76850443 CAAAAATTACATATGGAGCCAGG + Intronic
1099827902 12:87802184-87802206 ATAAATATACATAAAGAGCATGG + Intergenic
1100262381 12:92944959-92944981 ATAAAAATACAAAATTAGCCAGG - Intergenic
1100767831 12:97887258-97887280 ATAAAAATACAAAATCAGCCAGG - Intergenic
1101004610 12:100389791-100389813 ATAATAATACAAATCTAGCCAGG - Intronic
1101122147 12:101593535-101593557 AAAAAGATATATATGGGGCCTGG - Intronic
1101122175 12:101593688-101593710 TTAAAAATATATATGGAGGCTGG - Intronic
1101230255 12:102733580-102733602 CTAAAAATACAAAAGAAGCCAGG + Intergenic
1101353478 12:103955339-103955361 GTGCAAATACAAATGGAGCCAGG + Intronic
1101480177 12:105089085-105089107 ATAAAAATACAAAATTAGCCAGG + Intergenic
1102154743 12:110715780-110715802 ATAAAAATACAAAATTAGCCTGG - Intergenic
1102549370 12:113680230-113680252 ATAAAAATATATTTGCAGGCTGG + Intergenic
1102647598 12:114413992-114414014 AAAAAAAAAAAAATGGAGCCGGG - Intergenic
1102927569 12:116837962-116837984 ATATACATACATATGGTGACAGG - Intronic
1103324936 12:120114252-120114274 CTAAAAATACAAAAGTAGCCGGG - Intronic
1103373396 12:120436637-120436659 CTAAAAATACAAAATGAGCCGGG - Intergenic
1103541301 12:121668378-121668400 CTAAAAATACAAAAGTAGCCAGG + Intronic
1103632384 12:122272481-122272503 CTAAATATACAAATGCAGCCTGG + Exonic
1103693719 12:122797037-122797059 CTAAAAATACAAATTTAGCCGGG - Intronic
1103754036 12:123188873-123188895 ATAAAAATAAATAATTAGCCAGG + Intronic
1103771268 12:123327297-123327319 ATAAAACAACAGATGAAGCCAGG - Intronic
1103788961 12:123455577-123455599 AAAAAAATACACAAGAAGCCTGG - Intergenic
1104011641 12:124934917-124934939 ATAAAAATACAAAATTAGCCGGG - Intergenic
1104182135 12:126391937-126391959 ATAAAAATAAATATTAGGCCAGG - Intergenic
1105018805 12:132802892-132802914 ATAAAAATACAAAATTAGCCGGG + Intronic
1105041086 12:132962000-132962022 CTAAAAATACAAATTTAGCCAGG - Intergenic
1105051199 12:133052628-133052650 ACAAAAATAGATATGAGGCCAGG - Intronic
1105371670 13:19807073-19807095 CTAAAAATACAAAATGAGCCAGG + Intergenic
1105455973 13:20541576-20541598 ATAAAAATACAAAATTAGCCAGG + Intergenic
1105746837 13:23385096-23385118 CTAAAAATACAAATACAGCCTGG + Intronic
1105953822 13:25260327-25260349 CTAAAAATACATAATTAGCCGGG - Intronic
1106029127 13:25983934-25983956 ATAAAAAGTTATCTGGAGCCTGG + Intronic
1106096403 13:26648969-26648991 ATTAAAATCCATATGGAGGAAGG - Intronic
1106826341 13:33525316-33525338 TTAAAAACACATTTGGAGGCAGG - Intergenic
1107179790 13:37445756-37445778 CTAAAAATACAAATTTAGCCGGG + Intergenic
1107250869 13:38361147-38361169 ATAAAAAGAATTATGGACCCTGG + Intronic
1107364145 13:39651842-39651864 ATTAAAAAAGATATGGAGCCGGG - Intergenic
1107364669 13:39657190-39657212 ATAAAAATACAAAATTAGCCAGG - Intronic
1107370076 13:39736528-39736550 ATAAAAATACAAAATTAGCCAGG + Intronic
1107699736 13:43035879-43035901 ATAAAAATAAAAATTTAGCCAGG - Intronic
1108038075 13:46312652-46312674 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1108191514 13:47945086-47945108 CTAAAAATACATAATTAGCCAGG + Intronic
1108322905 13:49304339-49304361 GTTAAAATACAAATGGAGGCAGG + Intergenic
1108536686 13:51388552-51388574 CTAAAAATACAAAATGAGCCAGG - Intronic
1108598787 13:51972843-51972865 ATAAAAATAAAAAATGAGCCCGG + Intronic
1108696950 13:52910702-52910724 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1109083083 13:57932509-57932531 ATATATATATATATGGGGCCAGG + Intergenic
1109269411 13:60237610-60237632 CTAAAAATACAAATTTAGCCGGG + Intergenic
1109950255 13:69492546-69492568 TTAAAAATACATACGGAGCTCGG + Intergenic
1110247552 13:73343311-73343333 TTAAAAATACATAATTAGCCAGG - Intergenic
1110454263 13:75672400-75672422 CTAAAAATACAAATTTAGCCAGG - Intronic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1110592905 13:77285623-77285645 ATAAAAATACAAAATTAGCCAGG + Intronic
1110710301 13:78643625-78643647 ATAAAAATACAAAATTAGCCGGG + Intronic
1110769690 13:79326997-79327019 ATAAAAATCCATTTCTAGCCTGG + Intronic
1111596283 13:90415479-90415501 TTAAAAATATATATGATGCCTGG - Intergenic
1112038513 13:95520532-95520554 ATAAAAATACAAAAGTAGCAGGG - Intronic
1112167092 13:96931360-96931382 ATAAAAATACAAAATTAGCCGGG + Intergenic
1112714465 13:102167900-102167922 ATAAAAACAAATAAAGAGCCAGG + Intronic
1113275021 13:108718869-108718891 ATAAAAATACATCCGCAGGCAGG - Intronic
1113419563 13:110160145-110160167 AAAAAAATTCATAGGGGGCCGGG + Intronic
1114007392 14:18329987-18330009 CTAAAAACACATTTGCAGCCAGG - Intergenic
1114155046 14:20092619-20092641 AAAAAAATACATCTGGACCCTGG + Intergenic
1114164681 14:20208899-20208921 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1114241070 14:20868820-20868842 CTAAAAATATATATATAGCCAGG - Intergenic
1114855556 14:26436451-26436473 CTAAAAATACAAAATGAGCCAGG + Intergenic
1115108758 14:29794706-29794728 ATACATATACATAGGGAGCACGG - Intronic
1115212930 14:30985892-30985914 ATAAAAATAGATGTTGAGCTAGG - Intronic
1115236857 14:31216343-31216365 ATAAAAATACAAAATTAGCCAGG - Intergenic
1115579778 14:34746475-34746497 ATAAAAATACAAAATTAGCCGGG - Intergenic
1115600238 14:34949048-34949070 ATAAAAATACAAAATTAGCCAGG - Intergenic
1115613021 14:35066952-35066974 ATAAAAATACATAATTAGCCAGG - Intronic
1115742305 14:36401042-36401064 AGAAATATACATGTGTAGCCAGG - Intergenic
1115855795 14:37628129-37628151 ATAAAAATACAAAGTTAGCCAGG - Intronic
1115996411 14:39200103-39200125 TTAAAAATAAATATATAGCCAGG - Intergenic
1115997467 14:39209610-39209632 CTAAAAATACAAAATGAGCCAGG - Intergenic
1116299311 14:43157106-43157128 CTAAAAATACATAATTAGCCAGG - Intergenic
1116729131 14:48599444-48599466 ATAAAAACACAAATGTGGCCAGG - Intergenic
1116815628 14:49581024-49581046 CTAAAAATACAAAATGAGCCGGG + Intronic
1116845268 14:49859611-49859633 ATAAAAATACAAAATTAGCCAGG - Intergenic
1117559938 14:56927007-56927029 CTAAAAATACAAAATGAGCCAGG - Intergenic
1117698916 14:58394512-58394534 ATAAAAATACATAGGTGGCTGGG - Intergenic
1117917253 14:60690559-60690581 ATCAAAATAAAAATGCAGCCAGG - Intergenic
1118237551 14:64022930-64022952 ATCAAAATAAATAGGGAGGCTGG + Intronic
1118269614 14:64330266-64330288 CTAAAAATACAAAAGTAGCCAGG + Intronic
1118308953 14:64678549-64678571 CTAAAAATACAAAAGTAGCCCGG + Intergenic
1118602244 14:67479110-67479132 TTAAAAATGCTTATGGAGGCTGG + Intronic
1118848467 14:69566204-69566226 CTAAAAATACAAATTTAGCCAGG + Intergenic
1119270977 14:73304471-73304493 ATAAAAATAAAAAAGTAGCCAGG - Intronic
1119340494 14:73873144-73873166 CTAAAAATACAAAAGTAGCCAGG + Intronic
1119754791 14:77108528-77108550 ATAAAAATACAAAATCAGCCAGG + Intronic
1119802825 14:77460720-77460742 ATAAAAATACAAAATTAGCCGGG - Intronic
1119813041 14:77540033-77540055 CTAAAAATACAAAATGAGCCAGG + Intronic
1119920865 14:78444756-78444778 CTAAAAATACAAAATGAGCCGGG + Intronic
1120014443 14:79454375-79454397 CTAAAAATACAAAAGTAGCCAGG - Intronic
1120192000 14:81448007-81448029 CTAAAAATACAAAATGAGCCGGG + Intergenic
1120209045 14:81616226-81616248 ACAAAAATACAAAATGAGCCTGG + Intergenic
1120278427 14:82408371-82408393 ATAAAAATAAATATGGAGCTAGG - Intergenic
1120282163 14:82453647-82453669 ATAGAAATACTTAAGGAGCAAGG + Intergenic
1120703977 14:87728551-87728573 ATAAAAATACAAAATTAGCCAGG + Intergenic
1120798778 14:88666385-88666407 CTAAAAATACAAAAGTAGCCAGG - Intronic
1120882053 14:89421308-89421330 ATAAAAATACAAAATTAGCCAGG - Intronic
1120895777 14:89530579-89530601 ATATATATACATATGGAGAGAGG - Intronic
1120904232 14:89606552-89606574 ATAAAAATAAAACTGTAGCCGGG + Intronic
1121022082 14:90586429-90586451 CTAAAAATACAAAAGTAGCCAGG - Intronic
1121183087 14:91944032-91944054 TTAAAAATACAAAAGCAGCCGGG + Intronic
1121344391 14:93124625-93124647 ATAAAAATAAAAATGTAGGCTGG - Intergenic
1121742736 14:96265504-96265526 CTTAAAATACAAATGGGGCCAGG - Intronic
1122096720 14:99377782-99377804 CTAAAAATACAAAATGAGCCAGG + Intergenic
1122314718 14:100818936-100818958 ATAAAAATACAAAATTAGCCAGG - Intergenic
1122569629 14:102686996-102687018 AAAAGAATAAATATAGAGCCAGG - Intronic
1122703130 14:103603670-103603692 CTAAAAATACATAATTAGCCGGG + Intronic
1122704577 14:103612228-103612250 AAAAAAATAAAAATAGAGCCAGG - Intronic
1202829214 14_GL000009v2_random:8129-8151 ATAAAGATACAAATGCAGGCTGG - Intergenic
1202900926 14_GL000194v1_random:37981-38003 ATAAAGATACAAATGCAGGCTGG - Intergenic
1202871968 14_GL000225v1_random:173137-173159 ATAAAAATACAAAATTAGCCAGG + Intergenic
1123391314 15:19876653-19876675 CTAAAAACACATTTGCAGCCAGG - Intergenic
1123437710 15:20267667-20267689 ATAAAAATAGAGATGGGGCTGGG + Intergenic
1123437961 15:20269525-20269547 TTAAAAATACATAATTAGCCAGG + Intergenic
1123464376 15:20504301-20504323 CTAAAAATACAAAATGAGCCAGG - Intergenic
1123480194 15:20624095-20624117 CTAAAAATACAAAGTGAGCCGGG + Intergenic
1123554174 15:21409810-21409832 ATCAAAAAATATATGCAGCCAGG + Intronic
1123637810 15:22376268-22376290 CTAAAAATACAAAGTGAGCCGGG - Intergenic
1123813074 15:23948778-23948800 ATAAAAATACAAAATTAGCCAGG + Intergenic
1124024093 15:25948748-25948770 ATAAAAATACAAAATTAGCCGGG + Intergenic
1124285461 15:28397398-28397420 AAAAAAATACAAAAAGAGCCGGG + Intergenic
1124297234 15:28514238-28514260 AAAAAAATACAAAAAGAGCCGGG - Intergenic
1124710234 15:32003663-32003685 AAGAAAACACATATGGAGCGGGG + Intergenic
1124799373 15:32815236-32815258 ATAAAAATAAACATGCAGGCCGG - Intronic
1124877870 15:33612519-33612541 CTAAAAATACAAAAGTAGCCGGG - Intronic
1124923942 15:34052997-34053019 TTAAAAATTCATATGGAACCAGG + Intronic
1124943692 15:34243052-34243074 CTAAAAATACAAAAGTAGCCGGG - Intronic
1125022816 15:35001837-35001859 TTAAAAATACAAAAGTAGCCAGG + Intergenic
1125310680 15:38375170-38375192 AGAAAAATAAACATGGTGCCTGG - Intergenic
1125458522 15:39886070-39886092 ATAAAAATACAAAATTAGCCAGG + Intronic
1125734819 15:41917413-41917435 ATATAAATAAATAAGGAGGCCGG - Intronic
1125783862 15:42297456-42297478 ATAAAAATAAAAATGAACCCAGG - Intronic
1126773725 15:52081925-52081947 ATAAAAATACAAAATTAGCCAGG + Intergenic
1126835056 15:52653846-52653868 ATAAAAATATAAATGGGGCATGG - Intronic
1126941623 15:53773398-53773420 ATAAAAATATATAAATAGCCAGG + Intergenic
1127078539 15:55352107-55352129 ATAAAAATACAAAATTAGCCGGG - Intronic
1127479577 15:59366138-59366160 CTAAAAATACAAAAGTAGCCAGG - Intronic
1128024452 15:64423171-64423193 TTAAAAATGCAAATGGAGCCGGG + Intronic
1128028334 15:64458793-64458815 GTAAAAATACAAAAGTAGCCGGG - Intergenic
1128191912 15:65709408-65709430 ATTAAGATACATTTTGAGCCGGG + Intronic
1128202135 15:65817735-65817757 CTAAAAATACAAAAGTAGCCAGG + Intronic
1128366700 15:67008829-67008851 CTAAAAATACATAATTAGCCAGG - Intergenic
1128375699 15:67073833-67073855 ATAAAAATACAAAATTAGCCGGG - Intronic
1128829978 15:70759492-70759514 CTAAAAATACAAAATGAGCCGGG + Intronic
1128847438 15:70912970-70912992 AAAAAAATAGATATAGAGCTGGG - Intronic
1129015686 15:72466645-72466667 TTAAAAATGCATATGCAGCCGGG + Intergenic
1129119715 15:73388715-73388737 ATAAAAATACCCATGGTGCCTGG + Intergenic
1129420378 15:75420546-75420568 CTAAAAATACAAAATGAGCCAGG - Intronic
1129586453 15:76871884-76871906 ATAAAAATGCAAATTGTGCCAGG - Intronic
1129816056 15:78555518-78555540 CTAAAAATACATAATTAGCCAGG - Intergenic
1129891354 15:79073962-79073984 ATAAAACTACATGTGGGGCCAGG + Intronic
1129989950 15:79953156-79953178 ATCAAAATACATACAGGGCCAGG - Intergenic
1129996777 15:80013652-80013674 ATAAAAATACAAAATTAGCCAGG - Intergenic
1130170332 15:81505855-81505877 GTAAAAATACAAAATGAGCCGGG - Intergenic
1130186766 15:81690696-81690718 CTAAAAATACAAAATGAGCCAGG + Intergenic
1130804832 15:87309074-87309096 ACAAAAATACAAATTTAGCCGGG + Intergenic
1130992653 15:88885616-88885638 CTAAAAATACAAAAGTAGCCGGG - Intronic
1131039828 15:89253986-89254008 ATAAAAATATACATGGGGCCAGG - Intronic
1131103649 15:89714615-89714637 ATTAAAAAAAATATGGGGCCGGG - Intronic
1131113960 15:89782825-89782847 ATAAAAATACAAAATTAGCCGGG + Intergenic
1131330533 15:91495222-91495244 ATGAAGAAACATATGGAGTCAGG + Intergenic
1131518746 15:93097634-93097656 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1131541201 15:93276837-93276859 ATAAAAATACAAAATGAGCTGGG + Intergenic
1131604370 15:93885547-93885569 CTAAAAATACAGATGGTCCCTGG - Intergenic
1131630367 15:94169984-94170006 AAAAAAATACATATAGGGCTGGG - Intergenic
1131799792 15:96057080-96057102 CTAAAAATACAAAATGAGCCAGG - Intergenic
1131980472 15:97989801-97989823 ATAAAAATATATATACAGCATGG + Intergenic
1131992694 15:98106051-98106073 ATAAAAATAAAAATAGGGCCAGG - Intergenic
1132098237 15:99004422-99004444 ATAAAAATAAAAATAGGGCCAGG + Intronic
1132111338 15:99104524-99104546 ATATATATATATATGGAGCCTGG - Intronic
1132123067 15:99194772-99194794 CTAAAAATACAAAATGAGCCGGG + Intronic
1132142372 15:99406409-99406431 ATAAAAATAATTCTCGAGCCAGG + Intergenic
1202962521 15_KI270727v1_random:137006-137028 ATCAAAAAATATATGCAGCCAGG + Intergenic
1132487118 16:199608-199630 TTAAAAATACAAAAGTAGCCGGG + Intronic
1132763405 16:1522372-1522394 ATAAAAATACAAAATTAGCCGGG + Intronic
1133224459 16:4334098-4334120 CTAAAAATACAAAAGTAGCCAGG - Intronic
1133471048 16:6076135-6076157 ATAAAAATACAAAATTAGCCAGG + Intronic
1133471975 16:6084220-6084242 ATAAAAATAAATAAGGAGGAAGG - Intronic
1133783971 16:8961329-8961351 ACAAAAATACAAAAGTAGCCAGG + Intronic
1133795903 16:9045990-9046012 CTAAAAATACAAAGGTAGCCGGG - Intergenic
1133919736 16:10141325-10141347 ATAAAAATACAAAAATAGCCAGG + Intronic
1133944096 16:10334183-10334205 CTAAAAATACAAAATGAGCCGGG - Intronic
1134151148 16:11805952-11805974 CTAAAAATACAAATTTAGCCAGG + Intergenic
1134273517 16:12755577-12755599 ATAAAGATACATATTGAGGCAGG - Intronic
1134423833 16:14119420-14119442 TTTAAAATACATAAGGAGGCAGG + Intronic
1135141562 16:19926511-19926533 TTAAGAATACAGATGGGGCCGGG - Intergenic
1135401299 16:22168097-22168119 ACAAGAATAAATATAGAGCCAGG + Intronic
1135493397 16:22930409-22930431 ATTAAAATACAAAAGCAGCCGGG + Intergenic
1135493431 16:22930675-22930697 ATTAAAATACAAAAGCAGCCAGG + Intergenic
1135576052 16:23586626-23586648 ATAAAAACACAAGTGGGGCCGGG - Intronic
1135664738 16:24326330-24326352 CTAAAAATACAAAATGAGCCGGG - Intronic
1135708950 16:24698869-24698891 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1135845683 16:25916521-25916543 CTAAAAATACAAAAGTAGCCGGG - Intronic
1136180158 16:28546244-28546266 ATAAAAGTAAACATGGGGCCGGG + Intergenic
1136231914 16:28890998-28891020 TTAAAAATACATAGGAAGCTGGG + Intronic
1136246676 16:28980162-28980184 CTAAAAATACATAATTAGCCAGG + Intronic
1136846613 16:33581327-33581349 TTAAAAATACATAATTAGCCAGG - Intergenic
1136846865 16:33583188-33583210 ATAAAAATAGAGATGGGGCTGGG - Intergenic
1137424061 16:48362434-48362456 AAATAAATACATAAGGAGGCAGG + Intronic
1137759637 16:50929948-50929970 AAAAAAATGCACATGGGGCCAGG + Intergenic
1138107954 16:54300599-54300621 CTAAAAATACAAAATGAGCCGGG - Intergenic
1138155704 16:54701122-54701144 ATAAAAATAAAAATTTAGCCAGG - Intergenic
1138576575 16:57911280-57911302 ATAAAAATAGAAAAAGAGCCAGG - Intronic
1138630415 16:58289870-58289892 TTAAAAATACATGTGTAGCCGGG - Intronic
1138676260 16:58653718-58653740 CTAAAAATACAAAATGAGCCAGG - Intergenic
1138689039 16:58750701-58750723 ATAAAAATACATAAGCAGCCAGG - Intergenic
1138733887 16:59228923-59228945 ATAAAAATACAAAATTAGCCAGG - Intergenic
1138735210 16:59242776-59242798 ATAAAAAAAGATATAGATCCAGG + Intergenic
1138771753 16:59673775-59673797 TTAAAAATACATATGCATACAGG - Intergenic
1139407999 16:66734834-66734856 ATAAAAATACAAAATTAGCCAGG + Intronic
1139457923 16:67097248-67097270 AAAAAAATAGATCTGGGGCCGGG + Intronic
1139728607 16:68923106-68923128 AAAAAAATACAAAATGAGCCGGG - Intronic
1139873331 16:70125213-70125235 CTAAAAATACAAATTTAGCCAGG + Intronic
1139948216 16:70656238-70656260 ATCAAAATTCATCTGGAGGCCGG + Intronic
1140045548 16:71438268-71438290 ATAAAAATACAAAATTAGCCAGG + Intergenic
1140103227 16:71936646-71936668 CTAAAAATACAAATTTAGCCGGG - Intronic
1140163925 16:72529346-72529368 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1140235552 16:73155524-73155546 ATAATAATATATATGAAGCCTGG + Intergenic
1140354568 16:74294216-74294238 ATAAAAATGAATATAGAGCTGGG - Intergenic
1140362452 16:74356091-74356113 CTAAAAATACAAATTTAGCCAGG - Intergenic
1140628241 16:76820790-76820812 CTAAAAATACAAAATGAGCCGGG + Intergenic
1140654445 16:77125142-77125164 CTAAAAATACAAAATGAGCCAGG + Intergenic
1141050064 16:80753445-80753467 ATAAAAATACAAAATTAGCCAGG + Intronic
1141078013 16:81026019-81026041 AAAAAAATACATATATAGGCTGG + Intronic
1141106053 16:81234692-81234714 TTGAAAATACAAATGGAGTCCGG - Intergenic
1141191471 16:81827927-81827949 CTAAAAATACAAAAGTAGCCAGG + Intronic
1141355919 16:83346926-83346948 ATAAAAATACATAAAGACTCAGG + Intronic
1141368303 16:83464349-83464371 CTAAAAATACAAAATGAGCCGGG + Intronic
1141492648 16:84384886-84384908 ATAAAAATACAAAATTAGCCGGG + Intronic
1141541758 16:84728623-84728645 ATAAAACTACAAAAGGAGGCCGG - Intronic
1141583669 16:85018606-85018628 CTAAAAATACAAAATGAGCCGGG - Intergenic
1141962570 16:87419287-87419309 ATAAAAATACAAAATTAGCCGGG - Intronic
1142338098 16:89503291-89503313 ATAAAAATACAAAATTAGCCAGG - Intronic
1142421103 16:89970816-89970838 TTAAAAATACAAATTTAGCCGGG - Exonic
1203108321 16_KI270728v1_random:1429981-1430003 TTAAAAATACATAATTAGCCAGG - Intergenic
1203108573 16_KI270728v1_random:1431843-1431865 ATAAAAATAGAGATGGGGCTGGG - Intergenic
1142646508 17:1317128-1317150 ATGAAAACACATAGGAAGCCGGG + Intergenic
1142719600 17:1767301-1767323 CTAAAAATACAAAATGAGCCGGG - Intronic
1142788707 17:2245975-2245997 ATAAAAATCCAGATTCAGCCAGG - Intronic
1142991671 17:3735326-3735348 ATAAAAATACAAAATTAGCCAGG - Intronic
1142992466 17:3740535-3740557 ATAAAAATACAAAGTTAGCCAGG - Intronic
1143000368 17:3790856-3790878 TTAAAAAGACATTTGGAGGCCGG + Intronic
1143132712 17:4690423-4690445 ATAAAAATATATATATAGGCTGG + Intronic
1143144284 17:4763874-4763896 ATAAAAATACAAAATTAGCCGGG - Intergenic
1143148800 17:4794368-4794390 ATAAAAAGACAAATAGAGCCAGG + Intergenic
1143148848 17:4794631-4794653 ATAAAAAGACAAATAGAGGCCGG + Intergenic
1143236185 17:5403043-5403065 TTAAAAATCCATTTGGGGCCAGG + Intronic
1143307526 17:5959324-5959346 ATAAAAATACAAAATTAGCCAGG - Intronic
1143318359 17:6050322-6050344 ATAAATATACATATGCAGCCGGG - Intronic
1143531969 17:7510467-7510489 CTAAAAATACAAAATGAGCCGGG + Intronic
1143557325 17:7670063-7670085 CTAAAAATACAAAAGTAGCCGGG - Intronic
1143653423 17:8278617-8278639 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1143703282 17:8677558-8677580 ATAAAAATACAAAATTAGCCAGG - Intergenic
1143825034 17:9598598-9598620 CTAAAAATACACAAGTAGCCAGG + Intronic
1143835011 17:9684600-9684622 CTAAAAATACAAAAGTAGCCGGG + Intronic
1143927386 17:10383779-10383801 ATAAGAATATATGTGTAGCCGGG - Intergenic
1143994396 17:10994012-10994034 ATAAAAATGAATAAGGGGCCGGG - Intergenic
1144477934 17:15604830-15604852 TTAAAAACACATATGTGGCCAGG - Intronic
1144565530 17:16355934-16355956 ATAAAAATACAAAATTAGCCAGG + Intergenic
1144716338 17:17438416-17438438 ATAAAAATACAAAATTAGCCAGG + Intergenic
1144770414 17:17756356-17756378 ATAAAAATACAAAATTAGCCAGG - Intronic
1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG + Intronic
1144843641 17:18204288-18204310 CTAAAAATACAAAAGTAGCCAGG + Intronic
1144852918 17:18252987-18253009 CTAAAAATACAAAAAGAGCCGGG + Intronic
1145216021 17:21053373-21053395 CTAAAAATACATAATTAGCCGGG - Intergenic
1145297845 17:21607936-21607958 ATAAAAGCACAAAGGGAGCCAGG - Intergenic
1145349422 17:22067595-22067617 CTAAAAATACAAAATGAGCCGGG + Intergenic
1145352414 17:22095462-22095484 ATAAAAGCACAAAGGGAGCCAGG + Intergenic
1145404564 17:22574891-22574913 ATAAAAGCACAAAGGGAGCCAGG + Intergenic
1145779947 17:27556374-27556396 ATTAAAATATATATATAGCCAGG - Intronic
1145930438 17:28681558-28681580 CTAAAAATACAAAAGTAGCCAGG + Intronic
1145942804 17:28751914-28751936 ACAAAAAAATATAAGGAGCCGGG + Intergenic
1145956311 17:28857266-28857288 CTAAAAATACAAAAGTAGCCGGG - Intronic
1146042778 17:29472733-29472755 AAAAAAATACAAAATGAGCCGGG - Intronic
1146069646 17:29668433-29668455 TTAAAAATAAATATTGGGCCAGG + Intronic
1146078074 17:29751252-29751274 CTAAAAATACAAAAGTAGCCAGG + Intronic
1146150416 17:30464093-30464115 ATAAAGAAAGATCTGGAGCCAGG + Intronic
1146333042 17:31944287-31944309 CTAAAAATACAAAATGAGCCAGG - Intronic
1146356637 17:32139918-32139940 TTAAAAATCCATATCCAGCCAGG - Intergenic
1146367362 17:32239181-32239203 ATAAAAATACAAAATTAGCCAGG + Intronic
1146717068 17:35095319-35095341 CTAAAAATACAAAAAGAGCCGGG + Intronic
1146920853 17:36710000-36710022 ATAAAAATACAAAATTAGCCAGG - Intergenic
1147295566 17:39479494-39479516 ATAAAACTTCTAATGGAGCCAGG + Intronic
1147302997 17:39544789-39544811 CTAAAAATACAAAATGAGCCGGG - Intronic
1147366338 17:39961821-39961843 ATAAAAATACAAAACTAGCCAGG + Intergenic
1147408773 17:40233900-40233922 CTAAAAATACAAATTTAGCCAGG + Intronic
1147483826 17:40793454-40793476 ATACATATATATATGGATCCAGG + Intronic
1147537502 17:41330208-41330230 AAAAAAAAAAATAAGGAGCCAGG + Intergenic
1147890876 17:43715970-43715992 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1147894650 17:43742632-43742654 ATAAAAATACAAAATTAGCCGGG - Intergenic
1147989873 17:44326076-44326098 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1148188180 17:45659820-45659842 ATAAAAATACAAAATTAGCCGGG - Intergenic
1148381155 17:47199078-47199100 AAAAAAATACAAATTTAGCCGGG + Intergenic
1148383457 17:47217870-47217892 CTAAAAATACATAATTAGCCTGG + Intronic
1148504569 17:48117214-48117236 ATAAAAATACATAATTAGCCAGG - Intronic
1148540877 17:48479530-48479552 ATAAAAATACAAAATTAGCCAGG + Intergenic
1148572525 17:48681629-48681651 TTAAAAATACATGTTCAGCCAGG + Intergenic
1148890660 17:50805043-50805065 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1148927407 17:51099270-51099292 ATAAAAATACAAAATCAGCCAGG + Intronic
1148974901 17:51519036-51519058 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1149463753 17:56856935-56856957 CTAAAAATACAAATTTAGCCGGG + Intronic
1149745419 17:59092987-59093009 CTAAAAATACAAATTGAGCCAGG + Intronic
1149761049 17:59230541-59230563 ATAAAAATACAAAATTAGCCGGG - Intronic
1149768836 17:59303833-59303855 ATAAACATACATATGCAGATCGG - Intergenic
1149816577 17:59730558-59730580 ATAAAAAGACAACTGGGGCCGGG - Intronic
1150109695 17:62487782-62487804 ATAAAAATACAAAATTAGCCGGG - Intronic
1150332541 17:64305853-64305875 CTAAAAATACAAATTTAGCCAGG + Intergenic
1150341786 17:64374326-64374348 CTAAAAATACAAATTTAGCCAGG + Intronic
1150347526 17:64415590-64415612 CTAAAAATACAAAATGAGCCGGG - Intergenic
1150393526 17:64804046-64804068 CTAAAAATACAAAATGAGCCAGG + Intergenic
1150712655 17:67545013-67545035 AAAAAAATACTTATTGAGGCCGG + Intronic
1150761938 17:67970070-67970092 CTAAAAATACAAAAGTAGCCAGG + Intronic
1150804177 17:68306161-68306183 CTAAAAATACAAAATGAGCCGGG - Intronic
1150805348 17:68314363-68314385 CTAAAAATACAAAAGTAGCCAGG + Intronic
1151026864 17:70686985-70687007 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1151064543 17:71135015-71135037 CTAAAAATACAAAATGAGCCAGG + Intergenic
1151240246 17:72751870-72751892 ATAAAAAGAGCTCTGGAGCCGGG - Intronic
1151725854 17:75883820-75883842 TTAAAAATACATAAAAAGCCAGG - Intronic
1151739299 17:75968759-75968781 CTAAAAATACAAAAGTAGCCGGG + Intronic
1152043495 17:77920418-77920440 CTAAAAATACAGATGTGGCCAGG + Intergenic
1152149953 17:78592780-78592802 TTAAAAATACAGATGGGGGCAGG + Intergenic
1152678259 17:81652734-81652756 CTAAAAATACAAATTTAGCCAGG - Intronic
1152847413 17:82610497-82610519 AAAAAAATACAAAATGAGCCGGG - Intronic
1153042114 18:822922-822944 CTAAAAATACAAAATGAGCCGGG + Intergenic
1153656138 18:7284011-7284033 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1153932843 18:9894176-9894198 ATAAAAATAAAAATAAAGCCGGG + Intergenic
1154530080 18:15333954-15333976 CTAAAAACACATTTGCAGCCAGG + Intergenic
1155186873 18:23394820-23394842 CTAAAAATACAAAAGTAGCCAGG + Intronic
1155656947 18:28203737-28203759 CTAAAAATACAAAATGAGCCGGG - Intergenic
1155975201 18:32121332-32121354 CTAAAAATACAAAATGAGCCGGG + Intronic
1156129458 18:33952761-33952783 CTAAAAATACAAAAGTAGCCAGG + Intronic
1156476057 18:37406125-37406147 AAAAAAATAAAAATGGAGCAGGG - Intronic
1157099506 18:44716490-44716512 ATAAGAAAACATAAAGAGCCTGG - Intronic
1157213193 18:45761221-45761243 CTAAAAATACATAATTAGCCGGG + Intergenic
1157655312 18:49381376-49381398 ACAAAAATATATATGCAGCAGGG - Intronic
1157841200 18:50960430-50960452 AAAAAAATACAAATGGGGCCAGG + Intergenic
1157944636 18:51965307-51965329 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1158088618 18:53683641-53683663 CTAAAAATACAAATTTAGCCTGG - Intergenic
1158190596 18:54824125-54824147 ATAAAACTACATGTGGAGGATGG - Intronic
1158531317 18:58264930-58264952 ATATAAATACTTAGGGAGCTTGG + Intronic
1158656036 18:59335270-59335292 CTAAAAATACAAAAGTAGCCAGG + Intronic
1159169531 18:64747348-64747370 ATGAAAATATATGAGGAGCCTGG + Intergenic
1159522651 18:69546114-69546136 ATAAAAATACAAAATTAGCCAGG + Intronic
1159719891 18:71875451-71875473 ATAAAAACACATATGGAGGACGG + Intergenic
1159809536 18:73000000-73000022 ATAAAAATCCATATATAACCAGG + Intergenic
1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG + Intergenic
1160215729 18:76928205-76928227 TTATAAATACATATTGAGCACGG - Intronic
1160664412 19:317567-317589 ATAAAAATACAAAATTAGCCAGG + Intronic
1160903950 19:1443570-1443592 TAAAAAAAACAAATGGAGCCGGG + Intergenic
1160923657 19:1532681-1532703 ATAAAAATACAAAATTAGCCAGG - Intronic
1160934802 19:1589168-1589190 CTAAAAATACAAAAGTAGCCGGG + Intronic
1161095910 19:2390536-2390558 ATAAAAATACTTTTGGGGCCGGG - Intronic
1161402360 19:4072895-4072917 CTAAAAATACAAAATGAGCCCGG - Intergenic
1161409985 19:4111790-4111812 CTAAAAATACAAATTTAGCCGGG + Intronic
1161413169 19:4128518-4128540 ATAAAAATACAAAACTAGCCAGG + Intergenic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161834410 19:6635945-6635967 CTAAAAATACAAAATGAGCCGGG - Intergenic
1161834871 19:6639009-6639031 CTAAAAATACAAAATGAGCCCGG + Intergenic
1161971616 19:7584495-7584517 ATAAAAATACAAAGTTAGCCGGG - Intergenic
1161986542 19:7658060-7658082 ATAAAAATACAAAGTTAGCCGGG + Intergenic
1162077252 19:8196037-8196059 ATAAAAATAAAAATTAAGCCAGG - Intronic
1162545901 19:11329444-11329466 CTAAAAATACAAAAGTAGCCAGG + Intronic
1162591553 19:11595656-11595678 ATAAAAATACAAAATTAGCCGGG - Intronic
1162640390 19:12004279-12004301 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1163011291 19:14428119-14428141 ATAAAAATAAAAAAGGAGCGGGG - Intergenic
1163030930 19:14543731-14543753 TTAAAAATATATATATAGCCGGG - Intronic
1163411987 19:17160858-17160880 CTAAAAATACAAAAGTAGCCGGG - Intronic
1163431738 19:17272230-17272252 TTAAAAATACATTTAGAGGCTGG - Intronic
1163480249 19:17551254-17551276 CTAAAAATACAAAAGTAGCCGGG - Intronic
1163572814 19:18092507-18092529 ATAAAAATACAAAATTAGCCAGG + Intronic
1163593343 19:18206350-18206372 ATAAAAATAAAAATGTGGCCAGG + Intergenic
1163864271 19:19759185-19759207 ATAAAAAGACACATTGAGGCCGG - Intergenic
1163873726 19:19848039-19848061 ATAAAAATACAAAATTAGCCGGG + Intergenic
1163940625 19:20490112-20490134 ATAAAAATACACAATTAGCCGGG + Intergenic
1163962110 19:20706465-20706487 CTAAAAATACAAATTTAGCCAGG - Intronic
1164001537 19:21104908-21104930 ATAAAAATAAAAATGAGGCCGGG - Intronic
1164008392 19:21173820-21173842 ATAAAAATAAAAATGAGGCCAGG - Intronic
1164125130 19:22307580-22307602 CTAAAAATACAAAAGTAGCCGGG + Intronic
1164648997 19:29878779-29878801 ATAAATATATATATGTAGACTGG - Intergenic
1164734590 19:30531620-30531642 AAAAAAATATATATGGACACTGG - Intronic
1164813768 19:31178516-31178538 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1164953331 19:32358143-32358165 AGAAAAAAGCAAATGGAGCCAGG - Intronic
1165033937 19:33019416-33019438 CTAAAAATACATAATTAGCCAGG + Intronic
1165106383 19:33471998-33472020 CTAAAAATACAAAAGTAGCCGGG + Intronic
1165410913 19:35660722-35660744 CTAAAAATACAAAATGAGCCAGG + Intergenic
1165545530 19:36532258-36532280 CTAAAAATACAAATTTAGCCGGG - Intergenic
1165557290 19:36645065-36645087 ATAAAAATAGAAATGTAGCTGGG + Intronic
1165684327 19:37805840-37805862 CTAAAAATACAAATTTAGCCAGG - Intronic
1165961328 19:39537055-39537077 TTAAAAATACAAAATGAGCCAGG + Intergenic
1166169267 19:41016101-41016123 ATAAAAATGAACATGGCGCCGGG + Intronic
1166424448 19:42663226-42663248 ATATATATATATATGGTGCCTGG - Intronic
1166613217 19:44219046-44219068 ATAAAAATACAAAATTAGCCAGG - Intronic
1166846029 19:45729131-45729153 ATAAAAATAAATATAGGGCCAGG + Intronic
1167159680 19:47759017-47759039 ATAAAAATACTAAAGTAGCCAGG - Intergenic
1167162121 19:47774909-47774931 AAAAAAATAGAGATGGAGCCAGG - Intergenic
1167213180 19:48146517-48146539 TTAAAAATACAAAAGTAGCCGGG + Intronic
1167375991 19:49112310-49112332 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1167449456 19:49558404-49558426 ATAAAAAAAAAAATTGAGCCGGG - Intronic
1167830500 19:52017406-52017428 ATAAAAATGCTTATGAGGCCGGG + Intronic
1167842520 19:52133672-52133694 CTAAAAATACAAAATGAGCCAGG - Intronic
1167919460 19:52770992-52771014 CTAAAAATACAAAATGAGCCAGG - Intronic
1168002430 19:53459866-53459888 CTAAAAATACAAAATGAGCCAGG + Intergenic
1168046917 19:53800741-53800763 CTAAAAATACAAAAGTAGCCAGG - Intronic
1168428776 19:56260373-56260395 CTAAAAATACATAACTAGCCGGG - Intronic
1168514688 19:57001623-57001645 AAAAAAATACAAAATGAGCCGGG - Intergenic
1168542375 19:57223801-57223823 ATAAAAACACATGCTGAGCCAGG - Intergenic
1168590003 19:57625359-57625381 CTAAAAATACAAAATGAGCCAGG - Intergenic
1168662569 19:58179356-58179378 TTAAAAAAGCATATGGGGCCAGG + Intergenic
1202643481 1_KI270706v1_random:119660-119682 ATAAAGATACAAATGCAGGCTGG + Intergenic
925728298 2:6895897-6895919 AGGAAAATACATATGGAGTAAGG + Exonic
926267372 2:11336945-11336967 AAAAAAAGAGATATGGGGCCAGG + Intronic
926419555 2:12682984-12683006 AAAAAAAAAAATAGGGAGCCAGG - Intergenic
927819442 2:26250163-26250185 ATAAAAATACAAAATTAGCCAGG - Intronic
927978066 2:27355357-27355379 CTAAAAATACAAAAGTAGCCGGG + Intronic
928017325 2:27670022-27670044 CTAAAAATACAAAATGAGCCAGG - Intronic
928054237 2:28035313-28035335 ATAAAAATATCTGGGGAGCCTGG + Intronic
928656987 2:33462537-33462559 CTAAAAATACAAATCTAGCCGGG - Intronic
928930368 2:36617887-36617909 CTAAAAATACAAACGTAGCCAGG - Intronic
928945985 2:36772373-36772395 ATAAAAATACAAAATTAGCCGGG + Intronic
928985580 2:37178203-37178225 ATAAAAATACAAAATTAGCCAGG - Intronic
929758302 2:44786036-44786058 CTAAAAATACATAATTAGCCGGG + Intergenic
929952648 2:46427827-46427849 AAAAAAATATATATTCAGCCAGG - Intergenic
930072881 2:47382523-47382545 CTAAAAATACAAAATGAGCCAGG + Intronic
931141857 2:59468209-59468231 CTAAAAATACAAAAGTAGCCAGG + Intergenic
931560901 2:63559933-63559955 TTTAAAATTCATATGGGGCCAGG + Intronic
932222091 2:70007358-70007380 AAAAAAATACAAAATGAGCCGGG + Intergenic
933441743 2:82323394-82323416 ATAAAAATAAAAATAAAGCCAGG + Intergenic
933596435 2:84288045-84288067 CTAAAAATACAAAATGAGCCAGG + Intergenic
933705519 2:85286654-85286676 TTAAAAATACAAAGGTAGCCGGG - Intronic
934043798 2:88154042-88154064 ATAAAAAGACACATGGGGCCGGG + Intergenic
934157542 2:89217407-89217429 ATAAAAAGAGAAATGGAGACAGG + Intergenic
934209723 2:89965018-89965040 ATAAAAAGAGAAATGGAGACAGG - Intergenic
934496599 2:94806868-94806890 CTAAAAATACAAAATGAGCCAGG - Intergenic
934658196 2:96128069-96128091 ATAAAAATACAAAATTAGCCAGG + Intronic
934932944 2:98443246-98443268 CTAAAAATACAAATTTAGCCAGG + Intergenic
935312099 2:101794797-101794819 ATAAAAATAAAAATGGAGGCAGG - Intronic
935371661 2:102354361-102354383 CTAAAAATACAAAAGTAGCCAGG + Intronic
936738000 2:115469735-115469757 CTAAAAATACAAAAGTAGCCAGG + Intronic
936958846 2:118051740-118051762 ACAAAAATAAATTTGGACCCAGG - Intergenic
937371961 2:121304661-121304683 ATAAAAATACAAAATTAGCCAGG - Intergenic
937402129 2:121593456-121593478 CTAAAAATACAAAAGTAGCCGGG + Intronic
938049268 2:128152326-128152348 CTAAAAATACAAAAGTAGCCGGG - Intronic
938529176 2:132165396-132165418 CTAAAAACACATTTGCAGCCAGG + Intronic
938897753 2:135768996-135769018 ATAAACAAACAAATGGAGGCTGG - Intronic
939422552 2:141992545-141992567 AGAAAAATACATATAAAGACTGG + Intronic
939715778 2:145582126-145582148 ATAAGAAAACATCTGGAGGCAGG + Intergenic
939857432 2:147376732-147376754 ATAAAAATGCATATGGATGAGGG + Intergenic
940017304 2:149120676-149120698 GTAAAAATATATATGCAGCCAGG - Intronic
940121636 2:150274468-150274490 AAAAAAATACAAATTTAGCCAGG + Intergenic
940230116 2:151442234-151442256 ATAAAAATACAAAATTAGCCGGG - Intronic
940268514 2:151865944-151865966 ATAAAAATACAAAATTAGCCAGG - Intronic
940444711 2:153764373-153764395 ATAAAAATACAAAATTAGCCAGG + Intergenic
940648389 2:156415692-156415714 ATAAAAATACAAAATTAGCCGGG + Intergenic
940972360 2:159907424-159907446 ATAAAAATACAAAATTAGCCTGG - Intergenic
940975528 2:159939210-159939232 TTAAAAATACAGATGAGGCCAGG + Exonic
941782611 2:169461053-169461075 ATAAAAATAAAAATGGTGACTGG + Intergenic
941794959 2:169588797-169588819 CTAAAAATACAAATTTAGCCGGG + Intronic
941818258 2:169820116-169820138 CTAAAAATACAAAATGAGCCAGG - Intronic
941868399 2:170357989-170358011 CTAAAAATACAAAAGTAGCCAGG + Intronic
941910055 2:170755949-170755971 AAAAAAATACAAAATGAGCCAGG + Intergenic
942031262 2:171962553-171962575 ATAAAAATACAAAAGTAGCTGGG - Intronic
942160857 2:173185078-173185100 CTAAAAATACAAATTTAGCCAGG + Intronic
942258251 2:174129161-174129183 ATAATAATATTTATGGAGCTGGG + Intronic
942648852 2:178145891-178145913 CTAAAAATACAAAATGAGCCAGG - Intergenic
942770730 2:179515072-179515094 ATTAAAAAACATATTGAGGCTGG - Intronic
943562334 2:189478475-189478497 CTAAAAATACATAATTAGCCAGG - Intergenic
944653561 2:201856222-201856244 AATAAAATACATAGGGAGCTGGG + Intronic
944691584 2:202163395-202163417 ATAAGAATACATATGTGGCCAGG - Intronic
944774603 2:202949843-202949865 ATAAAAAGTCATATTGGGCCAGG - Intronic
945078729 2:206067084-206067106 CTAAAAATACAAAAGTAGCCGGG + Intronic
945389837 2:209251328-209251350 CCAAAAATTCATATGGAACCAGG + Intergenic
945660612 2:212681070-212681092 ATAAAAAACCATCTGGGGCCAGG - Intergenic
945819321 2:214644267-214644289 ATAAAAATACATGTTTAGGCTGG - Intergenic
946266499 2:218547174-218547196 TAAAAAATACAAATGGAGCCAGG + Intronic
946658680 2:221976634-221976656 ATAAAAAAAAATATCCAGCCGGG + Intergenic
946900096 2:224364128-224364150 ATAAAAAGACAAAATGAGCCTGG - Intergenic
947130791 2:226922501-226922523 ATGAAAATACATATAGAGGCTGG - Intronic
947426688 2:229989866-229989888 ATAAAAATACATCATGAGCCGGG - Intronic
947427329 2:229995751-229995773 ATAAAAATACAAAATTAGCCAGG - Intronic
947489458 2:230581248-230581270 TAAAAAATACATATAGAGGCCGG + Intergenic
947496488 2:230641393-230641415 ATAAAAATAAAAATTGGGCCGGG + Intergenic
947659260 2:231854572-231854594 GTAAAAATACATATAGGGCCAGG - Intergenic
947772764 2:232683872-232683894 ATAAAAATTCATGTGCAGGCCGG - Intergenic
947787955 2:232841609-232841631 ATGAAAATACAAATGAAGGCAGG - Intronic
948050179 2:234974202-234974224 ATAAAAATACAAAATTAGCCGGG + Intronic
948112348 2:235466197-235466219 AAAAAAATACAAAATGAGCCAGG - Intergenic
948175898 2:235942514-235942536 CTAAAAATACAAAAGTAGCCAGG + Intronic
948448220 2:238050443-238050465 CTAAAAATACATAATTAGCCAGG - Intronic
948635664 2:239334724-239334746 TTTAAAATTCATATGGAGGCCGG + Intronic
1169229687 20:3879509-3879531 ATAAAAATACAAAATTAGCCAGG + Intergenic
1169295255 20:4391332-4391354 ATAAAAACGCGTATGGGGCCAGG + Intergenic
1169881552 20:10352256-10352278 ATAAAAATTAATACGGGGCCAGG + Intergenic
1170120157 20:12902667-12902689 AAAAAAAAACTTATGGAGTCAGG + Intergenic
1170625815 20:18029323-18029345 CTTAAAATACATATGTAGGCCGG - Intronic
1170688001 20:18586721-18586743 ATAAAAATACAAAATTAGCCGGG + Intronic
1170768638 20:19313195-19313217 ATAAAAATACAAAATTAGCCAGG - Intronic
1170939206 20:20834676-20834698 ATAAAAATAAAAATAAAGCCAGG + Intergenic
1171545185 20:25995002-25995024 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1171893451 20:30738599-30738621 ATAAAGATACAAATGCAGGCTGG + Intergenic
1172137700 20:32698298-32698320 CTAAAAATACAAATCTAGCCGGG + Intergenic
1172233752 20:33355293-33355315 ATAAAAATACAAAATTAGCCAGG + Intergenic
1172257361 20:33530783-33530805 ATGAAAATAAAGATGGCGCCAGG + Intronic
1172342399 20:34168634-34168656 TTAAAAATACAAAAGTAGCCGGG + Intergenic
1172372949 20:34409867-34409889 AGAAGAAAACACATGGAGCCAGG + Intronic
1172387832 20:34546528-34546550 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1172583851 20:36068706-36068728 AAAAAAATACAAAATGAGCCGGG - Intergenic
1172698193 20:36836503-36836525 CTAAAAATACAAAATGAGCCGGG - Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173073259 20:39790835-39790857 TTAAAATTACATATTCAGCCAGG + Intergenic
1173117511 20:40259735-40259757 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1173249082 20:41355173-41355195 CTAAAAATACAAAAGTAGCCAGG - Intronic
1173363180 20:42362808-42362830 TTAAAATTAAATATTGAGCCAGG + Intronic
1173373497 20:42461164-42461186 CTAAAAATACAAATTTAGCCGGG + Intronic
1173376282 20:42486500-42486522 ATAAATATAAATCTGGGGCCAGG - Intronic
1173447339 20:43130961-43130983 ATCTAAATACAAATGAAGCCAGG + Intronic
1173556043 20:43966591-43966613 CTAAAAATACAAATTTAGCCAGG + Intronic
1173677024 20:44844758-44844780 ATAAAAATACAAAATTAGCCAGG + Intergenic
1173839522 20:46148284-46148306 ATAAAAATACAAAATTAGCCAGG - Intergenic
1173866622 20:46316668-46316690 ATAAAAATACAAAATTAGCCAGG + Intergenic
1174002613 20:47385843-47385865 ATAAAAATAAATATGGTGCTGGG + Intergenic
1174019480 20:47518584-47518606 CTAAAAATACAAAAGTAGCCAGG - Intronic
1174228630 20:49025675-49025697 ATAAAAAGACAAATTGAGGCCGG + Intronic
1174237406 20:49105131-49105153 CTAAAAATACAAAATGAGCCTGG + Intergenic
1174369588 20:50077617-50077639 ATAAAAATACAAAATTAGCCAGG + Intergenic
1174600880 20:51723873-51723895 TTAAAAATAAAAATAGAGCCAGG + Intronic
1174849203 20:53975651-53975673 ATTAAAACACAGATGCAGCCAGG + Intronic
1175013972 20:55768445-55768467 CTAAAAATACATAATTAGCCTGG + Intergenic
1175074692 20:56362756-56362778 ATAAAAATAAAAAGGCAGCCAGG - Intronic
1175112077 20:56655489-56655511 AAAAAGATACATATGTAGCTGGG + Intergenic
1176608398 21:8852969-8852991 ATAAAGATACAAATGCAGGCTGG - Intergenic
1176620300 21:9052759-9052781 ATAAAGATACAAATGCAGGCTGG - Intergenic
1176767331 21:13034520-13034542 CTAAAAACACATTTGCAGCCAGG - Intergenic
1176966237 21:15215505-15215527 TCAAAAATAATTATGGAGCCTGG + Intergenic
1177005222 21:15664247-15664269 CTAAAATTACATATGAGGCCAGG + Intergenic
1177289868 21:19097021-19097043 TTAAAAATACATCTGAAGGCTGG + Intergenic
1177456961 21:21352415-21352437 ATCTAAATAAATTTGGAGCCAGG - Intronic
1178074903 21:29005946-29005968 TTAAAGATACATATGCAGCTAGG - Exonic
1178361644 21:31953393-31953415 CTAAAAATACATAATGAGCTGGG - Intronic
1178515490 21:33243376-33243398 TTAAAAATATATCTGGGGCCGGG - Intronic
1178543649 21:33476096-33476118 ATAAAAGAATATATAGAGCCAGG + Intronic
1178720295 21:35002722-35002744 ATAAAAATAAATAAGTAGGCCGG - Intronic
1178969817 21:37163509-37163531 ATAAAAATACAAAATTAGCCAGG - Intronic
1179013872 21:37577797-37577819 AAAAAAATATATATATAGCCAGG - Intergenic
1179208284 21:39303978-39304000 TTAAAAATACAAAATGAGCCAGG + Intronic
1179220638 21:39403914-39403936 ATAAAAATAAAAATAGAGCCGGG - Intronic
1179468585 21:41595371-41595393 CTAAAAATACAAAATGAGCCAGG + Intergenic
1179518674 21:41927762-41927784 ATAAAAATACATCTTTGGCCGGG - Intronic
1180122642 21:45764281-45764303 CTAAAAATACATAATTAGCCGGG - Intronic
1180286124 22:10746353-10746375 ATAAAAATACAAAATTAGCCAGG - Intergenic
1180358481 22:11862773-11862795 ATAAAGATACAAATGCAGGCTGG - Intergenic
1180379781 22:12129557-12129579 ATAAAGATACAAATGCAGGCTGG + Intergenic
1180431899 22:15260795-15260817 CTAAAAACACATTTGCAGCCAGG - Intergenic
1180730430 22:17977859-17977881 ATAAAAATACAAAATTAGCCAGG + Intronic
1181095853 22:20504802-20504824 CTAAAAATACAAAAGTAGCCAGG - Intronic
1181154190 22:20907947-20907969 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1181330241 22:22085485-22085507 GAAAATATAAATATGGAGCCAGG - Intergenic
1181399153 22:22640722-22640744 ATAGAAAAACATATGATGCCGGG - Intergenic
1181452666 22:23034336-23034358 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1181533063 22:23528111-23528133 TTAAAAATACAAATCAAGCCGGG - Intergenic
1181650270 22:24255337-24255359 ATAGAAAAACATATGATGCCGGG + Intergenic
1181743859 22:24942287-24942309 ATTAAAATACATTTGAGGCCGGG - Intronic
1182251775 22:29006372-29006394 CTAAAAATACAAAAGTAGCCAGG - Intronic
1182338719 22:29602786-29602808 ATAAAAATACAAAATTAGCCGGG + Intergenic
1182971227 22:34580125-34580147 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1182973203 22:34596897-34596919 ATGAGAATACACATGGAGACAGG - Intergenic
1183126365 22:35785156-35785178 TTAAAAATGCATATTCAGCCGGG - Intronic
1183169238 22:36173216-36173238 ATAAAAATACAAAATCAGCCGGG - Intergenic
1183212004 22:36456980-36457002 ATAATAATACACATTGGGCCGGG - Intergenic
1183404209 22:37622396-37622418 GTAAATATACATATGTTGCCTGG + Intronic
1183656534 22:39188751-39188773 ATAAAAATACAAAATTAGCCGGG - Intergenic
1184053683 22:42029155-42029177 TTAAAAATACATTAGTAGCCAGG + Intronic
1184218454 22:43083068-43083090 TTAAAAATACATATATAGGCTGG + Intronic
1184224568 22:43121890-43121912 ATAAAAATACAAAATTAGCCAGG - Intronic
1184703244 22:46191902-46191924 CTAAAAATACAAAAGTAGCCGGG + Intronic
1185118463 22:48951519-48951541 AAAAAAAAACAAATGTAGCCAGG + Intergenic
949186681 3:1200327-1200349 TTAAAAATACATGCTGAGCCAGG - Intronic
949212975 3:1527841-1527863 ATAAAAGTGCATATGCAGACTGG + Intergenic
949569801 3:5282677-5282699 ATAAAAGTAAATATATAGCCAGG - Intergenic
949588931 3:5473106-5473128 ATAAAAATACAGATTGAGATTGG + Intergenic
949899464 3:8798035-8798057 ATAAAAATATGGATGTAGCCGGG - Intronic
950161771 3:10765697-10765719 ATAAAACTACATATAAAGCATGG - Intergenic
950220220 3:11189787-11189809 ATAAAAATAAATAAATAGCCAGG + Intronic
950313401 3:11978801-11978823 ATAAAAATAAAGAAGGGGCCGGG + Intergenic
950537411 3:13587184-13587206 ATAAAAACACATATAGAGTAAGG + Intronic
950604088 3:14062874-14062896 CTAAAAATACAAATTTAGCCAGG + Intronic
951730700 3:25807669-25807691 TTTAAAATATATCTGGAGCCAGG + Intergenic
951934951 3:28012294-28012316 ATGAAATTACAGATGGAGCCAGG + Intergenic
951965152 3:28373768-28373790 AAAGACATACAAATGGAGCCAGG - Intronic
952163797 3:30723799-30723821 ATAAAAATATATAAGGATCCTGG + Intergenic
952379183 3:32791165-32791187 ATAAAAATACAAAATTAGCCGGG + Intergenic
953136776 3:40188614-40188636 CTAAAAATGCATAAGTAGCCAGG + Intronic
953609166 3:44433273-44433295 CTAAAAATACAAAAGTAGCCAGG - Intergenic
953976082 3:47382480-47382502 ATAAAAATACAAAATTAGCCGGG - Intronic
954046088 3:47931788-47931810 TTAAAAATACAGATGGAGCCAGG - Intronic
954198458 3:49010015-49010037 AAAAAAATAGAGATGGGGCCTGG - Intronic
954200222 3:49019638-49019660 TTAAAAATACAAAAGTAGCCGGG - Intronic
954476661 3:50752613-50752635 ATAAAAATACAAAATTAGCCTGG + Intronic
954651970 3:52170611-52170633 CTAAAAATACATAATTAGCCGGG - Intergenic
954734870 3:52698518-52698540 CTAAAAATACAAAATGAGCCAGG + Intronic
954968404 3:54630814-54630836 GTAAAAATACCTCTGGAGTCTGG + Intronic
955062404 3:55504623-55504645 CTAAAAATACAAAATGAGCCGGG - Intergenic
955225836 3:57059833-57059855 CTAAAAATACAAAAGTAGCCAGG + Intronic
955281776 3:57600702-57600724 ATAAAAATAAATTTGGGGTCTGG - Intergenic
955298384 3:57755147-57755169 CTAAAAATACATAATTAGCCGGG - Intergenic
955310850 3:57885231-57885253 CTAAAAATACAAATTTAGCCGGG - Intronic
955313940 3:57919631-57919653 ATAAAAATACAAAATTAGCCAGG + Intronic
955477070 3:59348343-59348365 ATAAAAATACAAAATTAGCCAGG - Intergenic
955557129 3:60150156-60150178 CTAAAAATACAAAATGAGCCGGG - Intronic
955837251 3:63069788-63069810 AAAAAAAAAGATTTGGAGCCTGG + Intergenic
956303851 3:67803014-67803036 ACAAAAATATATATATAGCCAGG - Intergenic
956364559 3:68486056-68486078 ATAAAAATAAAAATTTAGCCAGG - Intronic
956656896 3:71561215-71561237 CTAAAAATACAAAATGAGCCGGG - Intronic
958569350 3:95860175-95860197 AAAAAAATACATATGAGGCTGGG - Intergenic
959249912 3:103928526-103928548 ATAAGAATACATGTGGAGAAGGG - Intergenic
959787279 3:110315546-110315568 ATAAAAATCCATCTGGACTCTGG + Intergenic
959840304 3:110967380-110967402 ATAACATTTCATATGGAGACAGG + Intergenic
960066126 3:113374929-113374951 ATAAATAGACATTTGGGGCCAGG - Intronic
960076041 3:113485949-113485971 ATAAAAATACAAAATTAGCCAGG + Intronic
960102696 3:113761573-113761595 CTAAAAATACATAATTAGCCGGG + Intronic
960669502 3:120142995-120143017 CTAAAAATACAAAATGAGCCAGG - Intergenic
960829258 3:121828678-121828700 ATAAAAATACAAATAGCTCCTGG - Intronic
961137576 3:124526276-124526298 ATAAAAATACATATGGAGCCAGG + Intronic
961179552 3:124865980-124866002 AACAAAATATATATGGAGTCAGG - Intronic
961690255 3:128664364-128664386 CTAAAAATACAAAATGAGCCAGG + Intronic
961947803 3:130712505-130712527 CTAAAAATACAAAAGTAGCCAGG + Intronic
962115266 3:132499009-132499031 AAAAAAATAAAAATGGGGCCAGG - Intronic
962335892 3:134529800-134529822 AAAAAAATAAATGTAGAGCCAGG - Intronic
962538629 3:136355189-136355211 ATAAAAATACAAAATTAGCCAGG + Intronic
962816220 3:139003545-139003567 ATAAAAATAAATCTGAGGCCAGG + Intergenic
963232408 3:142921726-142921748 CTAAAAATACAAAAGGAGCTGGG - Intergenic
963444325 3:145384064-145384086 CTAAAAATACATAATTAGCCTGG + Intergenic
964015951 3:151947114-151947136 CTAAAAATACAAAATGAGCCTGG - Intergenic
964174385 3:153808059-153808081 CTAAAAATTTATATGCAGCCAGG + Intergenic
964351416 3:155806834-155806856 ATAAAAATATATATTGAGGCCGG + Intergenic
964353982 3:155832216-155832238 AAAAAAATACAAAATGAGCCGGG + Intronic
964748103 3:160030548-160030570 ATAAAAATACAAAATTAGCCGGG + Intronic
964775858 3:160276163-160276185 ATAAAAATAAATAGGCTGCCAGG - Intronic
964815349 3:160711671-160711693 ATAAAAATACACAATTAGCCAGG + Intergenic
964936855 3:162100064-162100086 ATAAAAATTCATAAGGAGCCTGG - Intergenic
965132432 3:164718397-164718419 ATAAAAATACAAAATTAGCCGGG - Intergenic
965260086 3:166471180-166471202 ACAAAAATACAAATGCAGCCAGG - Intergenic
965347451 3:167569535-167569557 TTAAAAATCCATGTGGAGCTGGG + Intronic
965651892 3:170942966-170942988 CTAAAAATACAAAAGTAGCCAGG - Intergenic
966090516 3:176129842-176129864 ATAAAAATACATGTTCAGTCCGG + Intergenic
966154463 3:176900830-176900852 CTAAAAATACAAAAGTAGCCAGG + Intergenic
966205406 3:177400848-177400870 ATAAATATTCATATGTGGCCAGG - Intergenic
966223481 3:177573294-177573316 CTAAAAATACAAAATGAGCCAGG - Intergenic
966408572 3:179625288-179625310 ATAAAAATAAAAATGAACCCAGG + Intronic
966462258 3:180189821-180189843 ATAAAAATACAAAATTAGCCTGG - Intergenic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
966687883 3:182715792-182715814 ATAAAAATACAAAATTAGCCAGG + Intergenic
966737819 3:183203050-183203072 AGAAAAATACAAATTTAGCCAGG + Intronic
966754202 3:183353429-183353451 ATAAAAATATATCTGAAGCTGGG + Intronic
966859553 3:184222272-184222294 CTAAAAATACAAAAGTAGCCAGG + Intronic
966859704 3:184223495-184223517 ATAAAAATACAAAATTAGCCAGG + Intronic
966994109 3:185263410-185263432 ATAAAAATACAAAATGAGCCGGG - Intronic
966994232 3:185264547-185264569 CTAAAAATACAAAAGTAGCCGGG + Intronic
967161674 3:186744560-186744582 ATAAAAATACAAAATTAGCCGGG + Intergenic
967268965 3:187717432-187717454 ATGTAAATACATATGGAGTTGGG - Intronic
967905812 3:194498883-194498905 CTAAAAATACAAAAGTAGCCAGG + Intergenic
967913130 3:194558305-194558327 ATAAAAATCTATATGTGGCCGGG - Intergenic
967949162 3:194827317-194827339 TTAAAAAGACAGATGCAGCCGGG - Intergenic
968160996 3:196426685-196426707 CTAAAAATACAAAATGAGCCGGG + Intronic
968291437 3:197542681-197542703 ATAAAAATACAAAATTAGCCGGG - Intronic
968779031 4:2565094-2565116 ATAAAAATACCCACGTAGCCAGG - Intronic
968807498 4:2784932-2784954 CTAAAAATACAAAAGTAGCCTGG - Intergenic
969049076 4:4359912-4359934 ATAAAAATAAAAATAGGGCCGGG - Intronic
970393310 4:15639001-15639023 CTAAAAATACAGAAGTAGCCGGG + Intronic
970396128 4:15667878-15667900 ATAAAAATACAAAATTAGCCAGG + Intronic
970544945 4:17118698-17118720 AAAAAAAAAAATATGTAGCCAGG + Intergenic
970796761 4:19921883-19921905 ATAAAAATATAAATAGAGGCTGG + Intergenic
971265213 4:25090957-25090979 ATAAAATTAGATGAGGAGCCAGG + Intergenic
971624160 4:28897430-28897452 TTTAAAATTCATATGGGGCCAGG + Intergenic
971649471 4:29254229-29254251 CTAAAAAGAAAAATGGAGCCTGG + Intergenic
971709148 4:30089042-30089064 ATAAAAAAACATATGGGGCCGGG - Intergenic
971999023 4:34005613-34005635 ATAAAAGCACAAAGGGAGCCAGG - Intergenic
972260794 4:37406733-37406755 CTAAAAATACAAAAGTAGCCAGG + Intronic
972336854 4:38114578-38114600 ATTAAGAAACATCTGGAGCCAGG - Intronic
972365886 4:38373982-38374004 TAAAAAATACAAAGGGAGCCAGG - Intergenic
972413559 4:38816675-38816697 ATAAAAATGAATGTGGGGCCTGG - Intronic
972454649 4:39241633-39241655 ATAAAAATACAAAATTAGCCAGG + Intronic
972486647 4:39548064-39548086 CTAAAAATACAAAAGTAGCCTGG - Exonic
972555817 4:40179923-40179945 CTAAAAATACAAAAGTAGCCGGG - Intergenic
973229229 4:47823106-47823128 ATAAAAAAAGAAATGGGGCCGGG - Intronic
973616623 4:52685405-52685427 ATAAAGAAACATCTGAAGCCGGG + Intergenic
973996300 4:56462837-56462859 ATAAAAATACAAAACTAGCCGGG + Intergenic
974146937 4:57960494-57960516 CTAAAAATACAAATTTAGCCAGG - Intergenic
974645966 4:64693395-64693417 ATAAAAATACCTTTGAGGCCAGG + Intergenic
975012017 4:69367335-69367357 ATAAGACTACATTTGGAGACAGG - Intronic
975555653 4:75662381-75662403 CTAAAAATACATAATTAGCCAGG - Intronic
975573758 4:75843005-75843027 TTAAAAGTACATGTGGGGCCGGG - Intergenic
975941127 4:79647712-79647734 ATATAAATATATATAGTGCCTGG - Intergenic
976262761 4:83161460-83161482 TTAAAAATACAAAATGAGCCAGG - Intergenic
976735049 4:88300740-88300762 CTAAAAATACAAAAGTAGCCGGG - Intergenic
977534492 4:98241186-98241208 CTAAAAATACAAATTTAGCCGGG + Intergenic
978792407 4:112676421-112676443 CTAAAAATACAAAAGTAGCCAGG + Intergenic
980072465 4:128258551-128258573 TTAAAAATACAAAATGAGCCAGG + Intergenic
980319367 4:131249142-131249164 ATACAAATACATATGTGGACAGG - Intergenic
980403130 4:132319657-132319679 ATAGAAATATATATGCGGCCGGG - Intergenic
980759342 4:137208784-137208806 ATAAAAATACTTATTGGGGCTGG + Intergenic
980913216 4:139011870-139011892 AAAAAAATACAAATTTAGCCAGG + Intergenic
980913233 4:139011989-139012011 AAAAAAATACAAATTTAGCCAGG + Intergenic
981351303 4:143733032-143733054 TTAAAAATACTTATGAAGCCTGG - Intergenic
981399349 4:144295041-144295063 GTAAAAATACATTTCTAGCCAGG + Intergenic
981981189 4:150792917-150792939 ATAAAAATACAAAATTAGCCAGG + Intronic
982199756 4:152948876-152948898 TTAAAAATTGTTATGGAGCCAGG + Intronic
982695624 4:158596419-158596441 CTAAAAATACATAATTAGCCAGG - Intronic
983041730 4:162936141-162936163 CTAAAAATACAAAAGTAGCCGGG + Intergenic
983050327 4:163038572-163038594 ATAAAAATACAAAATTAGCCAGG - Intergenic
983155237 4:164338809-164338831 ATAAAAATACAAAATTAGCCAGG + Intronic
983223787 4:165067507-165067529 CTAAAAATACAAAATGAGCCAGG + Intergenic
983427846 4:167609608-167609630 CTAAAAATACAAAAGTAGCCGGG + Intergenic
983447652 4:167875337-167875359 ATAAAAATACATATGGAGCAGGG - Intergenic
983572664 4:169226869-169226891 TTAAAAATACATAAGAGGCCAGG + Intronic
983869453 4:172808116-172808138 ACAAGAATACAGATGGGGCCGGG - Intronic
984464792 4:180084355-180084377 CTAAAAATACAAAAGTAGCCAGG - Intergenic
984630001 4:182051180-182051202 CTAAAAATACAAAAGTAGCCAGG + Intergenic
984679705 4:182593446-182593468 ATCAAAAGACAAATGGAGTCAGG - Intronic
984729791 4:183057133-183057155 ATAAAAATACATATATAGGCTGG - Intergenic
984780102 4:183517730-183517752 ATAAAAATACAAAATTAGCCGGG - Intergenic
984837602 4:184036263-184036285 CTAAAAATACAAAAGTAGCCAGG - Intergenic
985062014 4:186089294-186089316 ATAAAAATACAAAATTAGCCGGG + Intergenic
985086012 4:186313027-186313049 CTAAAAATACATAATTAGCCGGG + Intergenic
1202770852 4_GL000008v2_random:205574-205596 ATAAAGATACAAATGCAGGCTGG + Intergenic
985723716 5:1504551-1504573 CTAAAAATACAAAAGTAGCCGGG + Intronic
987041166 5:14064226-14064248 ATAAAAATAAAAAGGTAGCCAGG + Intergenic
987105833 5:14638104-14638126 ATAAAAATACAAAGTTAGCCAGG - Intergenic
987115578 5:14724154-14724176 CTAAAAATACAAAAGTAGCCAGG + Intronic
987361153 5:17107904-17107926 CTAAAAATACATAATTAGCCGGG - Intronic
987429265 5:17812394-17812416 ATAAAAATATATATAGAGATAGG + Intergenic
987508980 5:18811151-18811173 CTAAAAATACAAAAGTAGCCGGG - Intergenic
987728844 5:21741423-21741445 ATAAAAATACAAAATTAGCCGGG - Intergenic
988200156 5:28057344-28057366 ATAAAAATACATATATAGAGAGG + Intergenic
988246395 5:28688027-28688049 ATAAAAATAAAAAAGTAGCCAGG - Intergenic
988373516 5:30403569-30403591 AAAAAAAAACATATTGGGCCTGG + Intergenic
988532279 5:32038232-32038254 ATAAAGATACAGCTGGAGGCCGG + Intronic
989074749 5:37552070-37552092 ATAAAAAAAAATATGGAGCTCGG - Intronic
989187825 5:38642181-38642203 ATAAAAATAACTAAGGAGCATGG - Intergenic
989298571 5:39860784-39860806 ATAAAAAGAGATATGCGGCCAGG - Intergenic
989586696 5:43079381-43079403 CAAAAAATAAATTTGGAGCCGGG + Intronic
989612890 5:43312694-43312716 ACAAAAAAAAATATGGAGGCAGG + Intronic
990182072 5:53172580-53172602 CTAAAAATACAAAAGTAGCCAGG - Intergenic
990333302 5:54748364-54748386 GTAAAAAGCCATATGTAGCCAGG + Intergenic
990446903 5:55901774-55901796 CTAAAAATACAAAATGAGCCTGG - Intronic
990450579 5:55928817-55928839 CTAAAAATACAAAATGAGCCAGG - Intergenic
990562451 5:56996649-56996671 ATAAAAATACAAAATTAGCCGGG + Intergenic
991067675 5:62441357-62441379 ATAAAAATACAAAATTAGCCAGG - Intronic
991260805 5:64665814-64665836 ATACAAATACCTATGGGGACTGG + Intergenic
991471930 5:66977922-66977944 ATAAAAATGCCTTTGGAGACAGG - Intronic
991566474 5:68010265-68010287 ATAAGAATAAATAGGGAGCCGGG - Intergenic
992043445 5:72861070-72861092 CTAAAAATACATAACTAGCCGGG - Intronic
992122060 5:73604809-73604831 ATAAAACTACATCAGGAGCTTGG - Intergenic
992402478 5:76424466-76424488 CTAAAAATACAAAATGAGCCGGG - Intronic
993302759 5:86232361-86232383 ATAAAAATACAAAATTAGCCGGG - Intergenic
993349459 5:86830390-86830412 ATAAAAATAAATAATTAGCCAGG + Intergenic
993480210 5:88415342-88415364 ATAAAAATCCATGTGGGGCCGGG + Intergenic
994172967 5:96678547-96678569 ATAAAAATACATGGAGGGCCGGG + Intronic
994495860 5:100512533-100512555 ATAAAAAAACACATGGAGAGAGG + Intergenic
994877645 5:105446404-105446426 CTAAAAATACAAATTTAGCCCGG + Intergenic
995014574 5:107295326-107295348 ATAGAAATACACATGGTGCTAGG - Intergenic
995142754 5:108751029-108751051 ATAAAAATACAAAATTAGCCGGG + Intronic
995261295 5:110107262-110107284 AAAAAAATGCATGTGCAGCCAGG + Intergenic
995381837 5:111543954-111543976 AGAAAAATACATATCTAGCTTGG - Intergenic
995802862 5:116018509-116018531 CTAAAAATACAAAAGTAGCCAGG + Intronic
996049549 5:118916502-118916524 ATAAAAATACAAAATTAGCCAGG + Intronic
996706668 5:126505057-126505079 ATAAAAATACAAAATTAGCCAGG - Intergenic
996722995 5:126648076-126648098 CTAAAAATACAAATTTAGCCGGG + Intergenic
996997354 5:129714122-129714144 AGAAAAATACATATCTGGCCGGG + Intronic
997085239 5:130789673-130789695 AAAAAAATACAAAAGTAGCCGGG + Intergenic
997118599 5:131151768-131151790 CTAAAAATACATAATTAGCCTGG - Intergenic
997913566 5:137900974-137900996 ATAAAAATACAAAATTAGCCGGG + Intronic
997930192 5:138066502-138066524 ATAAAAATAAAAATGTGGCCGGG + Intergenic
997958123 5:138296569-138296591 ATAAAAATACAAAATTAGCCAGG - Intronic
998020321 5:138764630-138764652 ATAAAAATACAAAATCAGCCAGG - Intronic
998074641 5:139225606-139225628 ATAAAAATACATTTGGCACTGGG + Intronic
998259489 5:140618266-140618288 TTAAAAATACAAAATGAGCCAGG + Intergenic
998399371 5:141840454-141840476 ATAAAAATAGAGATGGAGTTGGG + Intergenic
998408803 5:141892124-141892146 AAAAAAATACAAAATGAGCCGGG - Intergenic
998459946 5:142302506-142302528 ATAAAAGTACTAATGCAGCCGGG + Intergenic
998507481 5:142683658-142683680 ATAAAAATACAAAATTAGCCGGG + Intronic
998866135 5:146504883-146504905 ATAAAAATACAAAATTAGCCGGG + Intronic
998960457 5:147480881-147480903 CTAAAAATACAAAATGAGCCGGG - Intronic
999162082 5:149509834-149509856 AAAAAAATATAAATGAAGCCAGG - Intronic
999589000 5:153123486-153123508 ATAAAAAAAAAAATTGAGCCTGG + Intergenic
999620368 5:153466693-153466715 ATGAAAATACATATAGGGCAAGG + Intergenic
1000356738 5:160404014-160404036 GTAAAAATGCATTTGGAGACAGG + Intronic
1000459858 5:161501028-161501050 TTAAAAATACACATGGACACAGG - Intronic
1000969611 5:167698975-167698997 TTAAAAGTACTTATGGGGCCGGG - Intronic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001055901 5:168449732-168449754 CTAAAAATACAAACGTAGCCAGG - Intronic
1001518792 5:172376188-172376210 CTAAAAATACAAAAAGAGCCAGG - Intronic
1001995047 5:176150715-176150737 ATAAAAATACAAAATTAGCCGGG + Intergenic
1002128816 5:177066760-177066782 ATAAAAATAAATTTGAAGGCTGG + Intronic
1002255823 5:177958075-177958097 ATTAAAATACAAAAGGAGGCCGG - Intergenic
1002287571 5:178175007-178175029 CTAAAAATACATAATTAGCCGGG - Intergenic
1002513999 5:179743211-179743233 ATAAAAATACAAAATTAGCCTGG - Intronic
1002573447 5:180157464-180157486 AAAAAAATACATAATTAGCCGGG + Intronic
1003041984 6:2696764-2696786 ATAAAAATAAAAGTGCAGCCAGG + Intronic
1003421815 6:5965274-5965296 ATAAAAATAAATAAAAAGCCAGG - Intergenic
1003422431 6:5970403-5970425 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1003436712 6:6096508-6096530 ATAAAAACTCACATGGGGCCGGG - Intergenic
1003545549 6:7055470-7055492 ATAAAAATACAAAATAAGCCAGG - Intergenic
1003559351 6:7168092-7168114 CTAAAAATACAAATTTAGCCGGG + Intronic
1003567495 6:7232884-7232906 AGAAAAATACTTTTGGGGCCAGG - Intronic
1003596365 6:7477699-7477721 ATAAAAATACCAAAGGGGCCGGG + Intergenic
1003879242 6:10465309-10465331 CTAAAAATACAAATTTAGCCAGG + Intergenic
1004157363 6:13182070-13182092 ATAAAAATACAAAATTAGCCGGG + Intronic
1004667969 6:17766398-17766420 ATAAAAATACAAAATTAGCCTGG - Intronic
1004718166 6:18239083-18239105 CTAAAAATACAAAAGTAGCCGGG - Intronic
1004863671 6:19833280-19833302 CTAAAAATACATAACTAGCCAGG + Intergenic
1005458039 6:26040440-26040462 ATAAAAATACAAAATTAGCCAGG + Intergenic
1005699607 6:28387119-28387141 TTAAAAATAAATGTGGAGGCTGG - Intronic
1005717540 6:28565511-28565533 ATAAAAATATATTTGAAACCAGG - Intergenic
1005970912 6:30761010-30761032 ATAAAAATACAGAATTAGCCGGG - Intergenic
1006126495 6:31842123-31842145 ATAAAAATACAAAATTAGCCGGG - Intergenic
1006488043 6:34360925-34360947 AAATATATACATATGGGGCCAGG + Intronic
1006694987 6:35923284-35923306 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1006702807 6:35990096-35990118 ATAAAAATACAAAACTAGCCGGG - Intronic
1006755533 6:36412054-36412076 TTAAAAATAAGAATGGAGCCAGG + Intronic
1006825926 6:36936447-36936469 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1007006162 6:38365009-38365031 CTAAAAATACCTTTGGAGACTGG - Intronic
1007080053 6:39093911-39093933 TTAAAAATACAGATGAAGTCTGG + Intergenic
1007096432 6:39215985-39216007 ACAAAACTATATATGGGGCCGGG + Intronic
1007386118 6:41521263-41521285 ATGAAAAGAGATATGGGGCCAGG + Intergenic
1007521732 6:42455192-42455214 AGAAAAATATCTATGGGGCCAGG + Intergenic
1007661837 6:43491449-43491471 CTAAAAATACAAAATGAGCCGGG - Intronic
1007727615 6:43926117-43926139 CTAAAAATACAAAATGAGCCGGG - Intergenic
1007862690 6:44929949-44929971 ATAAAAAAGCATAGGTAGCCTGG + Intronic
1009007587 6:57806776-57806798 ATAATAATACATAAGCAGACAGG - Intergenic
1009277099 6:61696550-61696572 TTTAAAATACATATGTGGCCGGG - Intronic
1009392518 6:63161824-63161846 ATAAAGCTACATATAGAGTCAGG - Intergenic
1009430253 6:63558163-63558185 TTAAAAATGCATATGTGGCCGGG - Intronic
1009665259 6:66670028-66670050 ATAAAAATACATATTGAAACTGG + Intergenic
1009987078 6:70793893-70793915 ATAAAAATACATAATTAGCCAGG - Intronic
1010761513 6:79728650-79728672 ATTCAAATACATATGGATCTTGG + Intergenic
1010967790 6:82232718-82232740 ATAAAAAAATAATTGGAGCCGGG + Intronic
1011100302 6:83712932-83712954 TTAAAAATACATATTGAGGCTGG + Intergenic
1011162335 6:84404954-84404976 TTAAAAATAAATATGCAGCCAGG - Intergenic
1011567837 6:88697561-88697583 ATAAAAATAAATATGAATTCTGG + Intronic
1011578048 6:88826620-88826642 ATAAAAATACAAAATTAGCCAGG + Intronic
1011586150 6:88927499-88927521 CTAAAAATACATAATTAGCCGGG + Intronic
1011707072 6:90012090-90012112 ATAAAAGTAGATATAGAGGCTGG - Intronic
1012521318 6:100124552-100124574 ATAAAAATACAAAGTTAGCCGGG + Intergenic
1012566982 6:100669412-100669434 ATAAAACTTTATATGGATCCTGG - Intronic
1012936816 6:105376808-105376830 ATAAAAATAGGTAGGCAGCCAGG + Intronic
1013104122 6:107011921-107011943 ATAAAAATACAAAATTAGCCGGG + Intergenic
1013186025 6:107758974-107758996 ATAAAAATAAATATGGTGCTAGG + Intronic
1013215349 6:108022325-108022347 TTAAAAATACATATTTGGCCAGG - Intergenic
1013291053 6:108719172-108719194 ATAAGAAAACTTATGAAGCCGGG - Intergenic
1013340582 6:109211093-109211115 CTAAAAATACAAATTTAGCCAGG - Intergenic
1013380495 6:109565180-109565202 TTAAAAATACCCATGAAGCCAGG + Intronic
1013494216 6:110682019-110682041 ATAAAAATACGAATGGATTCTGG - Intronic
1013496344 6:110701245-110701267 AGAAAAAGAAAAATGGAGCCGGG + Intronic
1013496451 6:110702153-110702175 ATAAAAATAAATAAGAGGCCAGG + Intronic
1013517429 6:110901109-110901131 CTAAAAATACAAATTTAGCCAGG + Intergenic
1013521334 6:110936462-110936484 CTAAAAATACAAAATGAGCCGGG - Intergenic
1013522475 6:110945730-110945752 CTAAAAATACAAAATGAGCCGGG + Intergenic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1014409300 6:121094460-121094482 ATAAAAATACAGAAGTGGCCAGG - Intronic
1014463431 6:121727799-121727821 CTAAATATACATATTGAGCCAGG + Intergenic
1015121552 6:129706589-129706611 ATAAAAAAGGACATGGAGCCGGG + Intronic
1015276761 6:131390315-131390337 ATAAAAATACAAAATTAGCCAGG + Intergenic
1015554882 6:134451133-134451155 ATACACATATATATGAAGCCAGG - Intergenic
1015623542 6:135157158-135157180 ATAAAAATACAAAATTAGCCAGG - Intergenic
1016129100 6:140443335-140443357 ATAAAAATACAGAAGTAGCCAGG + Intergenic
1016208603 6:141501462-141501484 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1016247243 6:141997088-141997110 ATAAAGATACATATAGAGCAGGG + Intergenic
1016468354 6:144348771-144348793 TTAAAAATACAAAATGAGCCGGG + Intronic
1016487162 6:144553747-144553769 CTAAAAATACAAAAGTAGCCGGG + Intronic
1016636497 6:146298178-146298200 ACAAAAGTATATATGGAGTCAGG - Intronic
1016791409 6:148070270-148070292 AAAAAAATCCATATGAGGCCGGG - Intergenic
1017045883 6:150346848-150346870 CTAAAAATACAAAATGAGCCGGG - Intergenic
1017095980 6:150805686-150805708 CTAAAAATACAAAATGAGCCGGG - Intronic
1017756893 6:157537111-157537133 TTAAAAAGATAGATGGAGCCGGG - Intronic
1017790593 6:157795117-157795139 ATAAAAACACATCTTGAGGCGGG + Intronic
1017988415 6:159465117-159465139 ATTTACATACATATGGAGCCTGG - Intergenic
1018351751 6:162966770-162966792 ATAAAAATACATGTCGGGGCCGG - Intronic
1018396359 6:163380750-163380772 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1018589093 6:165397411-165397433 ATAAAAATATAAATGAAGGCTGG + Intronic
1018697321 6:166400618-166400640 ATAAAAATACAAAAAAAGCCGGG - Intergenic
1019011248 6:168845133-168845155 ATAAAAACAAAAATGTAGCCAGG - Intergenic
1019747271 7:2707982-2708004 CTAAAAATACAAAATGAGCCGGG - Intronic
1019982962 7:4635060-4635082 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1019989221 7:4680805-4680827 AAAAAAATACAAAATGAGCCGGG + Intergenic
1020120374 7:5499902-5499924 TTAAAAATATATATATAGCCAGG + Intronic
1020400901 7:7776163-7776185 AAAACAAGACATATGGAACCAGG + Intronic
1020417164 7:7959471-7959493 CTAAAAATACAAAAGTAGCCGGG - Intronic
1020801972 7:12743194-12743216 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1021015705 7:15528807-15528829 ATAAAAATACAAAATTAGCCGGG - Intronic
1021090202 7:16473942-16473964 ATAAAAATACAAAATTAGCCGGG + Intronic
1021220828 7:17973689-17973711 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1021264858 7:18507650-18507672 CTAAAAATACAAATTTAGCCAGG - Intronic
1021293654 7:18876861-18876883 CTAAAAATACAAAATGAGCCAGG - Intronic
1021674014 7:23062389-23062411 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1022398575 7:30014022-30014044 CTAAAAATACAAAAGTAGCCGGG - Exonic
1022664310 7:32396181-32396203 ATTAAAATGGATATGTAGCCAGG + Intergenic
1022664855 7:32401240-32401262 ATAAAAATAGAAATGTAGGCCGG + Intergenic
1022715537 7:32894846-32894868 AGAAAAATAAACATGCAGCCGGG + Intergenic
1022747677 7:33189312-33189334 TTAAAAATAAAAATGGGGCCAGG - Intronic
1022835697 7:34111872-34111894 CTAAAAATACAGAAGTAGCCAGG - Intronic
1023116281 7:36865706-36865728 AAAAAATTAAACATGGAGCCTGG - Intronic
1023120862 7:36907031-36907053 ATAAAAAGACAAATGAAGCATGG - Intronic
1023696753 7:42855844-42855866 AAAAAAATTCATATGAGGCCAGG + Intergenic
1023789911 7:43745790-43745812 CTAAAAATACAAAATGAGCCAGG - Intergenic
1023970663 7:44988393-44988415 CTAAAAATACAAAATGAGCCGGG + Intergenic
1024003664 7:45209554-45209576 ATAAAAATACAAAATTAGCCGGG + Intergenic
1024388917 7:48784809-48784831 AAAAAAATAAATAAGTAGCCAGG - Intergenic
1024432410 7:49303999-49304021 CTTAAAATTCATATGGAGGCTGG - Intergenic
1024644475 7:51359661-51359683 CTAAAAATACAAATTTAGCCGGG - Intergenic
1024726777 7:52207155-52207177 ATAAAAAGACATATACGGCCGGG + Intergenic
1024887783 7:54164015-54164037 ATAAAAATAAAAATTAAGCCAGG - Intergenic
1024998617 7:55295320-55295342 ATACATAGACATATTGAGCCAGG + Intergenic
1025066088 7:55857209-55857231 ATAAAAATACAAAATTAGCCAGG + Intronic
1025119109 7:56285217-56285239 ATAAAAATAAATCTGGCGGCCGG + Intergenic
1025171431 7:56760717-56760739 ATAAAAGTACATATATAGCTGGG - Intergenic
1025275059 7:57574660-57574682 ATAAAAGCACAAAGGGAGCCAGG - Intergenic
1025296597 7:57780074-57780096 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1025700437 7:63814782-63814804 ATAAAAGTACATATATAGCTGGG + Intergenic
1025832079 7:65061077-65061099 ATAAAACTACATATATAGCTGGG + Intergenic
1025946265 7:66107249-66107271 ATAAAAATAAAAATGAAGGCCGG - Intronic
1025989189 7:66482608-66482630 ATAAAAATACAAAATTAGCCAGG + Intergenic
1026064553 7:67058769-67058791 TTAAAACTACATATGGGGCCAGG - Intronic
1026080040 7:67209731-67209753 TTAAAAATACAAAAGTAGCCGGG - Intronic
1026130587 7:67617343-67617365 AAAAAAATACAAATTTAGCCGGG - Intergenic
1026289146 7:68990254-68990276 CTAAAAATACATAATTAGCCAGG + Intergenic
1026610572 7:71855987-71856009 ATACATATACATATTGAGACAGG + Intronic
1026697052 7:72604299-72604321 TTAAAAATACAAAAGTAGCCGGG + Intronic
1026713745 7:72767952-72767974 TTAAAACTACATATGGGGCCAGG + Intronic
1026800781 7:73398529-73398551 CTAAAAATACAAAATGAGCCAGG - Intergenic
1026912559 7:74099567-74099589 CTAAAAATACAAACGTAGCCAGG + Intronic
1026917302 7:74128537-74128559 CTAAAAATTCATGTGGAGGCTGG - Intergenic
1027213379 7:76167578-76167600 ATATATATATATTTGGAGCCCGG + Intergenic
1027286426 7:76650022-76650044 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1027489717 7:78808222-78808244 ATAAAAATACAGCTGAAGGCTGG - Intronic
1027526812 7:79279402-79279424 AGAGAAATACATGTGTAGCCTGG + Intronic
1028390785 7:90314326-90314348 ATAAGAATAAACATGGGGCCAGG + Intergenic
1028694949 7:93698578-93698600 ATAAAAATACAAAATTAGCCTGG - Intronic
1028708757 7:93882883-93882905 ATAAACTTACATATGGAAGCAGG - Intronic
1028912352 7:96222737-96222759 TTAAAAATACAAAAAGAGCCGGG - Intronic
1029244335 7:99188012-99188034 CTAAAAATACAAAATGAGCCGGG + Intronic
1029482364 7:100820961-100820983 CTAAAAATACAAAAGTAGCCGGG + Intronic
1029540278 7:101178728-101178750 AAAAAAATACAAAAGTAGCCGGG + Intronic
1029565070 7:101331357-101331379 ATAAAAATAAAAATAGAGACTGG + Intergenic
1030041741 7:105457721-105457743 ACAAAAATGCACAGGGAGCCAGG + Exonic
1030302800 7:107991424-107991446 CTAAAAATACAAAAGTAGCCGGG + Intronic
1030312809 7:108085032-108085054 ATAAGAAAATATATGGGGCCTGG - Intronic
1030458831 7:109806182-109806204 ATAAAAAGTTATATGGGGCCTGG + Intergenic
1030573612 7:111258665-111258687 CTAAAAATACAAATGTAGCCAGG - Intronic
1031019147 7:116608102-116608124 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1031036517 7:116793601-116793623 ATAAGAACACATATGCAGCCAGG + Intronic
1031775188 7:125900358-125900380 ATCAAAATTCCAATGGAGCCAGG + Intergenic
1032038705 7:128540085-128540107 ATAAAAATACAAAATTAGCCGGG - Intergenic
1032185544 7:129722228-129722250 CTAAAAATACAAAAGTAGCCGGG + Intronic
1032216408 7:129960827-129960849 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1032604851 7:133338911-133338933 ATAAAAATACAAAATTAGCCAGG - Intronic
1032714043 7:134489066-134489088 TGAAAAATATATATGGGGCCGGG + Intergenic
1032726559 7:134594779-134594801 CTAAAAATACAAAATGAGCCGGG + Intergenic
1032744245 7:134770240-134770262 ATAAGAAGACACATGGAGCGGGG - Intronic
1032755212 7:134883939-134883961 ATAAAAATACAAAATTAGCCGGG + Intronic
1032998633 7:137477954-137477976 TTAAAAATACAAATGTAGCTGGG - Intronic
1033138014 7:138800858-138800880 CTAAAAATACAAAAGCAGCCGGG - Intronic
1033377416 7:140775498-140775520 CTAAAAATACAAAATGAGCCAGG - Intronic
1033389134 7:140909262-140909284 ATAAAAATACAAAATTAGCCGGG + Intronic
1033683063 7:143615279-143615301 CTAAAAATACAAAATGAGCCGGG + Intergenic
1033701549 7:143842359-143842381 CTAAAAATACAAAATGAGCCGGG - Intergenic
1033726534 7:144124299-144124321 ATAAAAATACAAAATTAGCCAGG + Intergenic
1034152193 7:148925834-148925856 ATAAAAATACAAAATTAGCCAGG - Intergenic
1034182535 7:149149392-149149414 CTAAAAATACAAAAGGACCCGGG - Intronic
1034195878 7:149246971-149246993 CTAAAAATACAAAATGAGCCGGG - Intronic
1034211814 7:149370338-149370360 AAAAAAATACAGATGAGGCCAGG - Intergenic
1034502360 7:151459077-151459099 AGAAAAATAAATTTGGGGCCGGG - Intergenic
1035216891 7:157374418-157374440 ATAAAAATACAAAATTAGCCGGG - Intronic
1035223611 7:157421350-157421372 CTAAAAATACAAAGTGAGCCGGG - Intergenic
1035461015 7:159039161-159039183 TTAAAAATACACATGCAGCCGGG + Intronic
1036038321 8:5044993-5045015 ATAAAAATACATAAAAAGGCTGG + Intergenic
1036186941 8:6630618-6630640 CTAAAAATACAAAATGAGCCAGG + Intronic
1036404907 8:8446071-8446093 ATAAAAATACAAAGTTAGCCCGG + Intergenic
1036517334 8:9456699-9456721 ATAAAACTACATCTGGATCTGGG + Intergenic
1036522935 8:9508984-9509006 ATAAAAATGTATATTTAGCCTGG + Intergenic
1037233850 8:16693421-16693443 AAAAAACTACATATAGGGCCGGG + Intergenic
1037436502 8:18869348-18869370 ATAAAAATACAAAATTAGCCAGG - Intronic
1037523890 8:19706303-19706325 ATACAGATACAGATTGAGCCTGG - Intronic
1038232271 8:25712464-25712486 ATAAAAATACATAAGTGGCCGGG + Intergenic
1038695702 8:29804531-29804553 ATAAAAAGCCACATGTAGCCAGG - Intergenic
1038762963 8:30401779-30401801 CTAAAAATACAAAATGAGCCGGG - Intronic
1039551146 8:38443890-38443912 CTAAAAATACAAAATGAGCCAGG + Intronic
1039873312 8:41565782-41565804 CTAAAAATACATAATTAGCCGGG - Intergenic
1039913628 8:41844033-41844055 ATAAAAATACAAAAGTAGCTGGG - Intronic
1039931026 8:41989211-41989233 TTAAAAATGCTTATGTAGCCGGG + Intronic
1040032148 8:42834684-42834706 AAAAAAATACATGTGTGGCCAGG - Intergenic
1040502404 8:48016641-48016663 ATAAAAATACAAAATTAGCCAGG - Intronic
1040956856 8:52988392-52988414 ATAAAAATACAAAATTAGCCAGG - Intergenic
1040972985 8:53157618-53157640 ATAAAAATACAGTTAGGGCCAGG - Intergenic
1041298307 8:56384665-56384687 AGAAAATTACATATGGATCTAGG + Intergenic
1042114633 8:65417285-65417307 GTAAAAATAAATATGAAGGCAGG + Intergenic
1042264889 8:66898461-66898483 CTAAAAATACAAAATGAGCCAGG + Intronic
1042295407 8:67212241-67212263 CTAAAAATACAAAATGAGCCGGG - Intronic
1042567762 8:70129829-70129851 CTAAAAATACAAAAGTAGCCGGG - Intronic
1043270452 8:78326871-78326893 ATAATAATATCTAAGGAGCCTGG - Intergenic
1043412226 8:80009453-80009475 ATAAAAATACAAAATTAGCCAGG + Intronic
1043697516 8:83239074-83239096 ATAAAGATACAAAATGAGCCAGG - Intergenic
1044400148 8:91760982-91761004 ATAAAAATAGATATGTAACAGGG - Intergenic
1044568283 8:93689162-93689184 ATAAAAATACAAAATTAGCCAGG + Intergenic
1044577878 8:93791177-93791199 ATAAAAATACATTTGTAGCTGGG - Intronic
1044590446 8:93909208-93909230 ATAAAAATACAAAATTAGCCAGG - Intronic
1044658760 8:94574870-94574892 CTAAAAATACAAATTTAGCCGGG + Intergenic
1044831107 8:96250412-96250434 ATAAAAATAATAATGGAGCCAGG + Intronic
1044993588 8:97817972-97817994 CTAAAAATACAAATTTAGCCGGG - Intronic
1045220359 8:100192917-100192939 ATAAAAATGCATTTGAAACCAGG - Intronic
1045464836 8:102460348-102460370 ATATATATATATATGTAGCCAGG + Intergenic
1045484826 8:102622651-102622673 TTAAAAATTCAGATGCAGCCAGG - Intergenic
1045624707 8:104030189-104030211 ATTAAAATACACATAGAGCCTGG + Intronic
1045765622 8:105664493-105664515 ATAAAAATACAAAATTAGCCAGG - Intronic
1046008049 8:108509822-108509844 ATAAAAATAAAAAATGAGCCAGG + Intergenic
1046331855 8:112726600-112726622 GTTAAATTACATATGGAGCTTGG + Intronic
1046904199 8:119554655-119554677 ATAAAAATACATCTGAGGCTGGG - Intergenic
1046934196 8:119870678-119870700 ACAATAATACAAATGAAGCCAGG - Intergenic
1047096718 8:121634069-121634091 ATAAAAATACAAAATTAGCCAGG - Intronic
1047114654 8:121827916-121827938 ATAAAAATACAAAATTAGCCGGG - Intergenic
1047248716 8:123166057-123166079 ATAAAGATACAGAGGGAGTCGGG + Intergenic
1047335547 8:123932402-123932424 TTAAGAATAAATACGGAGCCTGG - Intronic
1047620763 8:126604830-126604852 ATAAAAATACATTTAGAACTAGG + Intergenic
1047973683 8:130108934-130108956 CTAAAAATACAAAATGAGCCGGG - Intronic
1048862106 8:138731138-138731160 CTAAAAATACAAAATGAGCCAGG + Intronic
1049701198 8:144013658-144013680 AGAATAATACACATGGGGCCAGG + Intronic
1050113068 9:2236424-2236446 GTGAAAATACATATTGAGGCCGG + Intergenic
1050370038 9:4911601-4911623 AAAAAAATATGTATGGGGCCAGG + Intergenic
1050449768 9:5767746-5767768 CTAAAAATACAAAATGAGCCAGG - Intronic
1050546959 9:6717207-6717229 CTAAAAATACAAAAGTAGCCGGG + Intergenic
1050842065 9:10162755-10162777 ATATAAATATATATGGAGCTGGG + Intronic
1050869049 9:10542877-10542899 ATAAAAATACAAAATTAGCCTGG - Intronic
1051187960 9:14480530-14480552 ATGAAAATACAAATAGACCCAGG - Intergenic
1051275577 9:15394883-15394905 AAAAAAATACATATATGGCCGGG + Intergenic
1051620559 9:19045924-19045946 CTAAAAATACAAAAGTAGCCGGG + Intronic
1051630418 9:19135510-19135532 ATAAAAATACAAAATTAGCCAGG + Intronic
1052038376 9:23708931-23708953 TTAAAAATATTAATGGAGCCGGG - Intronic
1052288469 9:26815447-26815469 ATAAAAATGCATATCAGGCCGGG + Intergenic
1052602483 9:30653035-30653057 ATAAAATTACATATGCAAGCAGG + Intergenic
1052646994 9:31249261-31249283 ATAAAAATACAAAATTAGCCAGG + Intergenic
1052910298 9:33874962-33874984 TTAAAAATACATTTTGAGGCCGG - Intronic
1052925192 9:34009554-34009576 ATAAAAAAACATTTTGAACCGGG - Intronic
1052933745 9:34076469-34076491 ATAAAAATACAAAATTAGCCGGG + Intergenic
1052979251 9:34435964-34435986 CTAAAAATACAAAATGAGCCAGG - Intronic
1053096347 9:35331406-35331428 TTAAAAATACAAATTTAGCCGGG - Intronic
1053182625 9:35986757-35986779 ACAAAAAGACATTTGGGGCCAGG + Intergenic
1053210762 9:36225640-36225662 ACAAAAATACATCTAGAGCTGGG + Intronic
1053320861 9:37097849-37097871 TAAAAAATACATGTGGAGGCCGG + Intergenic
1053660551 9:40273573-40273595 CTAAAAATACAAAATGAGCCAGG + Intronic
1053707775 9:40771728-40771750 CTAAAAACACATTTGCAGCCAGG + Intergenic
1053910927 9:42902917-42902939 CTAAAAATACAAAATGAGCCAGG + Intergenic
1054355187 9:64054113-64054135 ATAAAGATACAAATGCAGGCTGG - Intergenic
1054361557 9:64126491-64126513 CTAAAAATACAAAATGAGCCAGG + Intergenic
1054372671 9:64419791-64419813 CTAAAAATACAAAATGAGCCAGG + Intergenic
1054417685 9:64892512-64892534 CTAAAAACACATTTGCAGCCAGG + Intergenic
1054524060 9:66102711-66102733 CTAAAAATACAAAATGAGCCAGG - Intergenic
1054680298 9:67909566-67909588 CTAAAAATACAAAATGAGCCAGG + Intergenic
1054855398 9:69893758-69893780 ATAAAAATACATTATAAGCCTGG - Intronic
1055053332 9:72001021-72001043 ATATAAATAAATATAGGGCCGGG - Intergenic
1055314614 9:75021775-75021797 ATAAAAAAACAAAATGAGCCAGG + Intronic
1055452009 9:76439518-76439540 TTAAAAACACAAATGGGGCCAGG - Intronic
1055525510 9:77129334-77129356 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1055530048 9:77175159-77175181 ATAAAAAGTTATTTGGAGCCTGG - Intergenic
1055605668 9:77967816-77967838 CTAAAAATACAAAATGAGCCGGG + Intronic
1055967663 9:81881384-81881406 ATAAAAATACAAAATTAGCCAGG - Intergenic
1056251999 9:84758550-84758572 ATAAAAATACAAAATTAGCCGGG - Intronic
1056384162 9:86081726-86081748 CTAAAAATACAAAAGCAGCCAGG + Intronic
1056387850 9:86113884-86113906 ATAAAAATAAATATGCTGGCTGG - Intergenic
1056504094 9:87240408-87240430 TTCAAAATAAACATGGAGCCCGG + Intergenic
1056653170 9:88486305-88486327 ATAAAAATACAAAATTAGCCGGG - Intergenic
1057455268 9:95203095-95203117 ATAAAAAGACACATGAGGCCAGG + Intronic
1057629648 9:96708939-96708961 ATAAGCATCCATGTGGAGCCAGG - Intergenic
1057781597 9:98055178-98055200 CTAAAAATACAAAATGAGCCAGG - Intergenic
1057836712 9:98451287-98451309 ATAAAATCTCACATGGAGCCTGG - Intronic
1057939084 9:99264911-99264933 ATAAAAGTAAATCTAGAGCCGGG - Intergenic
1058599292 9:106652241-106652263 ATAAAAATACAAAATTAGCCAGG - Intergenic
1058716780 9:107729455-107729477 ATAAAAATACAATTAGAGGCTGG - Intergenic
1058998988 9:110328643-110328665 ATAAAAATACAAAATTAGCCGGG + Intronic
1060132376 9:121116350-121116372 AAAAAAATGCCTATGAAGCCTGG - Intronic
1060503083 9:124177835-124177857 TAAAAAACATATATGGAGCCAGG - Intergenic
1060830495 9:126711628-126711650 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1061057329 9:128231360-128231382 TTAAAAATACAAAAGTAGCCGGG - Intronic
1061317491 9:129805433-129805455 AAAAAAAAAAAGATGGAGCCTGG + Intronic
1061342871 9:129997161-129997183 CTAAAAATACAAAAGTAGCCGGG + Intronic
1061967300 9:134022789-134022811 CTAAAAATACAAAATGAGCCAGG + Intergenic
1062086389 9:134651183-134651205 ATAAAAATGCACATCAAGCCTGG + Intronic
1062667074 9:137680310-137680332 CTAAAAATACAAATTTAGCCAGG + Intronic
1203732479 Un_GL000216v2:103463-103485 ATAAAAATACAAAATTAGCCAGG - Intergenic
1203743515 Un_GL000218v1:23218-23240 ATAAAGATACAAATGCAGGCTGG - Intergenic
1203703797 Un_KI270742v1:18179-18201 ATAAAGATACAAATGCAGGCTGG - Intergenic
1203626329 Un_KI270750v1:28513-28535 ATAAAAGCACAAAGGGAGCCAGG - Intergenic
1185493238 X:535496-535518 CTAAAAATACAAAAAGAGCCAGG - Intergenic
1185579976 X:1204387-1204409 TTAAAAATACATAATTAGCCGGG - Intronic
1185736045 X:2497230-2497252 CTAAAAATACAAAATGAGCCAGG + Intronic
1185754002 X:2638259-2638281 ATAAAACTAAATGTGGACCCTGG - Intergenic
1185951684 X:4442481-4442503 ATAAAAATACATTACCAGCCTGG + Intergenic
1186121427 X:6366612-6366634 ATGAAACTACATAGAGAGCCTGG - Intergenic
1186386880 X:9119154-9119176 AGGACAATACATGTGGAGCCGGG + Intronic
1186991160 X:15069926-15069948 ATAATAATAAATATATAGCCTGG + Intergenic
1187023894 X:15412710-15412732 ATAGAATTAAATATGGAGGCGGG - Intronic
1187118478 X:16379707-16379729 TAAAAAAAGCATATGGAGCCAGG + Intergenic
1187215715 X:17274578-17274600 ACAAAAATACATATGCAACAAGG - Intergenic
1187357843 X:18594885-18594907 ATAAAAATACATAGACGGCCGGG + Intronic
1187519722 X:20002881-20002903 TTTAAAATACATATTGAGGCCGG - Intergenic
1187877871 X:23819160-23819182 ATAAAAATCCATAATGAGGCTGG + Intergenic
1188016722 X:25114481-25114503 ATAAATAAACAAATGCAGCCGGG - Intergenic
1188213257 X:27447913-27447935 TTAAAAATACAAATTAAGCCGGG - Intergenic
1188550440 X:31358496-31358518 ATAAAAATGCATATAGCCCCAGG + Intronic
1188837054 X:34970925-34970947 CTAAAAATACAAAATGAGCCAGG - Intergenic
1189015545 X:37093018-37093040 CTAAAAATACAAAATGAGCCGGG - Intergenic
1189431948 X:40954829-40954851 AAAAAAATACAAAATGAGCCGGG + Intergenic
1189479385 X:41381198-41381220 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1189796915 X:44654115-44654137 ATAAAAATAAAAATTTAGCCAGG - Intergenic
1189818847 X:44850085-44850107 CTAAAAATACAAAAGTAGCCAGG - Intergenic
1189819514 X:44856924-44856946 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1189919851 X:45892688-45892710 ATAAAAATACAAAAGTAGCCAGG + Intergenic
1190080203 X:47350812-47350834 ATAAAAATACAAAATTAGCCAGG + Intergenic
1190226466 X:48549660-48549682 CTAAAAATACAAAAGTAGCCAGG - Intronic
1190283212 X:48944859-48944881 ATAAAAATACAAAAGTAGTCAGG + Intronic
1190301582 X:49060261-49060283 CTAAAAATACAAAAGTAGCCAGG + Intronic
1190728515 X:53208664-53208686 ATAAAAATACAGAATTAGCCGGG - Intronic
1192121882 X:68464283-68464305 CTAAAAATACAAAAGTAGCCGGG - Intergenic
1192462191 X:71326199-71326221 CTAAAAATACAAAATGAGCCAGG + Intergenic
1192470078 X:71390832-71390854 CTAAAAATACAAAATGAGCCGGG + Intronic
1192903029 X:75521016-75521038 AGAAAATTACAAATGGAGTCAGG + Intronic
1193078513 X:77381709-77381731 ATAAATACAATTATGGAGCCAGG + Intergenic
1193519135 X:82507496-82507518 ATAAAAATAAAAATTGGGCCAGG - Intergenic
1193604779 X:83553041-83553063 ATAAAAATACAAAATTAGCCAGG - Intergenic
1193645086 X:84057848-84057870 TCAAAAATGCATTTGGAGCCCGG - Intergenic
1193814945 X:86093319-86093341 ATAAAAATAAAAAAGGAGGCTGG + Intergenic
1194021640 X:88698574-88698596 AAAAAAATACATGTAGAGTCTGG + Intergenic
1195435493 X:104839008-104839030 ATAAAAATAAAAAATGAGCCAGG - Intronic
1196274128 X:113746794-113746816 ACAAAAAGACATTTGGAGTCAGG + Intergenic
1196598421 X:117571764-117571786 ATAAAGATACACATGGACTCTGG - Intergenic
1196610811 X:117712873-117712895 TTAAAAATATTTATGGAGCTTGG + Intergenic
1196987713 X:121293217-121293239 ATTAAACTACATTTGGAGTCAGG + Intergenic
1197188673 X:123620156-123620178 TTAAAATTAAATATGGAGCAAGG + Intronic
1197940208 X:131781303-131781325 ATAAAAATACAAATTTAGCCGGG - Intergenic
1197978637 X:132193389-132193411 ATAAGAGTACATCTGGGGCCGGG - Intergenic
1198249880 X:134869912-134869934 CTAAAAATACATAATTAGCCGGG + Intergenic
1198372883 X:136008394-136008416 ATAAAAATACAAAATTAGCCGGG - Intronic
1198568781 X:137933523-137933545 ATAAAAATGCATGTGTAGGCTGG + Intergenic
1198913851 X:141643946-141643968 AACAAAATACATATGGACCTCGG + Intronic
1198926139 X:141798475-141798497 CTAAAAATACAAAATGAGCCAGG - Intergenic
1199121774 X:144062680-144062702 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1199233528 X:145466573-145466595 CTAAAAATACAAAAGTAGCCAGG + Intergenic
1199353180 X:146829277-146829299 ATTAAAATACCTTTGGGGCCGGG + Intergenic
1199538500 X:148930955-148930977 TTAAGAATTCATATGCAGCCGGG + Intronic
1199549844 X:149047344-149047366 AAAAGAATACAAATGGAGCTGGG - Intergenic
1199800269 X:151243806-151243828 ATATATATACATATGAAGCTAGG - Intergenic
1199883670 X:151997351-151997373 CTAAAAATACAAAATGAGCCGGG - Intergenic
1200788861 Y:7282219-7282241 ATAAAAATTCATGGGAAGCCAGG + Intergenic
1200792996 Y:7315967-7315989 CTAAAAATACAAAATGAGCCGGG - Intergenic
1201018537 Y:9627839-9627861 ATAAAAAAACAAATGAGGCCAGG - Intergenic
1202578628 Y:26354817-26354839 CTAAAAATACAAAATGAGCCAGG - Intergenic
1202628470 Y:56884159-56884181 ATAAAAATACAAAATTAGCCAGG + Intergenic