ID: 961141324

View in Genome Browser
Species Human (GRCh38)
Location 3:124559156-124559178
Sequence CACAGCTATCACTGTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961141319_961141324 15 Left 961141319 3:124559118-124559140 CCTTATGTATGTAGCGGTCCATG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 961141324 3:124559156-124559178 CACAGCTATCACTGTGGAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 232
961141318_961141324 16 Left 961141318 3:124559117-124559139 CCCTTATGTATGTAGCGGTCCAT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 961141324 3:124559156-124559178 CACAGCTATCACTGTGGAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 232
961141321_961141324 -3 Left 961141321 3:124559136-124559158 CCATGCTGGAAAGAAGCCAGCAC 0: 1
1: 0
2: 0
3: 15
4: 216
Right 961141324 3:124559156-124559178 CACAGCTATCACTGTGGAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961141324 Original CRISPR CACAGCTATCACTGTGGAGC TGG Intronic
902937129 1:19772551-19772573 CACAGCCACCTCTGTGGAGCAGG + Intronic
903153570 1:21429638-21429660 CGCAGCTACCTCTGTGGAGCAGG - Intergenic
904418699 1:30377924-30377946 CTCAGCTGTCACTGGGCAGCTGG + Intergenic
904468348 1:30721024-30721046 CACAGCTAGTATGGTGGAGCAGG + Intronic
904648604 1:31987382-31987404 CTCAGCTATCACTGTGTGACTGG - Intergenic
905209867 1:36366640-36366662 CACAGATCTCACTGTGAAGCCGG - Intronic
905784756 1:40745714-40745736 GACAGCTAGCAATGTGGGGCTGG - Intronic
908409324 1:63847086-63847108 CACTCCTACCACTGTGGAGAAGG - Intronic
910666081 1:89727266-89727288 AACAGCTACCACTGGGCAGCAGG + Intronic
910929215 1:92425894-92425916 CCCAGCTGCCACTGAGGAGCAGG + Intergenic
911664160 1:100535281-100535303 CAAAGCTGTTTCTGTGGAGCAGG + Intergenic
912488835 1:110050062-110050084 CACAGCAATCAATGTGGGGCGGG - Intronic
912756846 1:112331353-112331375 CACAGCACTCACTCTGGACCTGG - Intergenic
913132826 1:115857620-115857642 CACATATACCACTGTGGAGGAGG - Intergenic
913520636 1:119642407-119642429 CAAATGTATCACTCTGGAGCAGG + Intronic
913568716 1:120099346-120099368 CACAGCTGGCACTGTGGTGCCGG + Intergenic
913702192 1:121384261-121384283 CACAGCTGTCATTCTGGAGTGGG - Intronic
914042750 1:144064730-144064752 CACAGCTGTCATTCTGGAGTGGG - Intergenic
914135336 1:144895758-144895780 CACAGCTGTCATTCTGGAGTGGG + Intronic
914289531 1:146260367-146260389 CACAGCTGGCACTGTGGTGCCGG + Intergenic
914392881 1:147237505-147237527 CACAGCTGTACCTGGGGAGCAGG + Intronic
914550567 1:148711120-148711142 CACAGCTGGCACTGTGGTGCCGG + Intergenic
915269851 1:154746299-154746321 CACGGCTATCTCAGAGGAGCAGG + Intronic
916242620 1:162655341-162655363 CAGAGCATTCTCTGTGGAGCAGG - Exonic
917578037 1:176344809-176344831 AACAGCTTGCACTGTGGACCTGG - Intergenic
917720919 1:177785700-177785722 GAGAGCTATCACTGTGTACCAGG - Intergenic
920489613 1:206402976-206402998 CACAGCTGTCATTCTGGAGTGGG - Intronic
920801148 1:209188648-209188670 GAGAGCTATCACTCTGGACCAGG - Intergenic
923159733 1:231305794-231305816 CACAGCTATCATTAGGGACCCGG + Intergenic
923227668 1:231954231-231954253 CACAGCTATCTCTGTGTCCCTGG + Intronic
1063386514 10:5619626-5619648 AGCAGCCATCAGTGTGGAGCTGG - Intergenic
1064682495 10:17825107-17825129 CAGAGCTAGAACTGAGGAGCAGG - Intronic
1065104786 10:22372039-22372061 CTCAGCTGTCACTAAGGAGCAGG - Intronic
1066503981 10:36022947-36022969 CACAGCCAGCAATGTGGTGCTGG - Intergenic
1068252126 10:54456186-54456208 CACAGCTTGCACTGTGCACCTGG + Intronic
1068354781 10:55897206-55897228 GACAGCTTACACTGTGGACCTGG - Intergenic
1068856479 10:61803069-61803091 CAAAGCTAGCACTCTGGACCTGG + Intergenic
1069159824 10:65079759-65079781 CACAGCTTGCACTGTGCACCTGG + Intergenic
1069815005 10:71188234-71188256 CACAGCTACCACTCTGGACTTGG - Intergenic
1071695018 10:87862238-87862260 CGGAGCTATCACTGGGGAGTGGG + Exonic
1072339999 10:94438203-94438225 AACAGCAATCACTGAGGAGTGGG - Intronic
1073766336 10:106686731-106686753 CACAGTTGTCACTGTGCATCAGG - Intronic
1075093866 10:119458535-119458557 CACAGCTGTGTCTGTGGGGCAGG - Intronic
1075960476 10:126563596-126563618 CACAGCCATCAATGTGGATTGGG - Intronic
1076155609 10:128202826-128202848 GACAGCTTTCACTGTGCACCTGG + Intergenic
1076358531 10:129870170-129870192 GATGGCTATCACTGTGGAGGAGG - Intronic
1076881127 10:133239719-133239741 CACAGCCTTCACCATGGAGCAGG + Exonic
1077372625 11:2190484-2190506 CACGGCCATCCCTGTGGGGCGGG - Intergenic
1078461769 11:11520034-11520056 AACAGCTGGCACTGGGGAGCAGG + Intronic
1079320691 11:19449217-19449239 CACTTATATCACTGTGGACCAGG - Intronic
1081992954 11:47347469-47347491 CATGGCTATCACTATGGAGAGGG + Exonic
1083529422 11:63405594-63405616 CACAGCATTCACTGTGTAGTTGG - Intronic
1085978015 11:81683841-81683863 CACTGCTTTCACTGTAGAGTTGG - Intergenic
1087125981 11:94626114-94626136 CACAGCTTGCACTGTGCACCTGG - Intergenic
1088113018 11:106283477-106283499 CACTGCTATCACTCTGGTCCAGG + Intergenic
1088544071 11:110942273-110942295 CACAGCCATCACTGGGGTTCTGG + Intergenic
1089111847 11:116063450-116063472 CACAGCTACTACTATGGATCAGG - Intergenic
1089363694 11:117908229-117908251 CACAACCAACCCTGTGGAGCAGG - Intronic
1091443827 12:531833-531855 CACAGCAGTCCCTGTGGGGCAGG + Intronic
1092180825 12:6445518-6445540 GACAGCTCTCACAGTGGGGCCGG - Exonic
1092701753 12:11239348-11239370 CACTGCTGGCACTTTGGAGCTGG + Intergenic
1093398479 12:18713277-18713299 CAGAGCTACAACTATGGAGCAGG - Intronic
1093426283 12:19032571-19032593 AACAGCTAGCACTGTGCACCTGG - Intergenic
1100920796 12:99484252-99484274 CTCAGATATCATTGAGGAGCAGG + Intronic
1105534070 13:21247787-21247809 CACACCCATCACCGTGGAGCTGG + Intergenic
1106173767 13:27310677-27310699 CACGGCGATCACTGTTGAGACGG + Intergenic
1107049374 13:36031068-36031090 CTGAGCAATCACTGTGGTGCTGG - Intronic
1108813657 13:54263601-54263623 CACAGCTATCACAGCAGAGAAGG - Intergenic
1109109246 13:58294481-58294503 GACAGCTATCACAGTGTTGCAGG - Intergenic
1111144855 13:84166766-84166788 GACAGCTTTCACTGTGCACCTGG - Intergenic
1113214278 13:108020071-108020093 CACATAGATCACTGTGCAGCAGG + Intergenic
1113965711 13:114152420-114152442 CACAGCAGGCACTGTGGCGCCGG - Intergenic
1114134597 14:19833956-19833978 AACAGCTGTCACTGTGGGACTGG + Intergenic
1116090987 14:40306952-40306974 CACATCTACCATAGTGGAGCAGG - Intergenic
1116559458 14:46359733-46359755 CACAGCTTGCACTGTGCATCTGG - Intergenic
1118840520 14:69506673-69506695 CAAATGTATCACTGTGGTGCTGG - Intronic
1118971008 14:70637909-70637931 CACAGACAACTCTGTGGAGCGGG + Intergenic
1119670100 14:76511901-76511923 CACAGCTACTTCTGTGGAGACGG - Intergenic
1119898763 14:78242750-78242772 CTCAGCTATCCATGTGGATCCGG - Intronic
1121556896 14:94844914-94844936 CACAACTATTTCTGTCGAGCAGG + Intergenic
1122874865 14:104659379-104659401 CACGGATCTCACTGTGGAGGGGG - Intergenic
1123061835 14:105598007-105598029 CCCCGCTGCCACTGTGGAGCCGG - Intergenic
1123086573 14:105719738-105719760 CCCCGCTGCCACTGTGGAGCCGG - Intergenic
1123577646 15:21689528-21689550 AACAGCTGTCACTGTGGGACTGG + Intergenic
1123614270 15:22132009-22132031 AACAGCTGTCACTGTGGGACTGG + Intergenic
1125530700 15:40411670-40411692 CACAGCCTTCATTGTGGAGAAGG + Exonic
1126066253 15:44828318-44828340 CACAGCTATCAGTGTGGCCAGGG + Intergenic
1126093630 15:45072549-45072571 CACAGCTATCAGTGTGGCCAGGG - Intronic
1127859600 15:62982156-62982178 CACAGGGATCACTGTGGACCGGG - Intergenic
1128455959 15:67831569-67831591 CACATCTATCCCTCTGGAGTTGG + Intronic
1131718639 15:95142499-95142521 CACAGCAATGACTGTAGAGAAGG - Intergenic
1202986515 15_KI270727v1_random:423773-423795 AACAGCTGTCACTGTGGGACTGG + Intergenic
1132485355 16:187476-187498 CACCGGTATCACAGTGTAGCTGG - Intergenic
1138508686 16:57494565-57494587 CACTGATACCACTGTGGAGGTGG + Intergenic
1139290636 16:65855241-65855263 CACAGGTGTCACTGAGTAGCAGG + Intergenic
1140719671 16:77760002-77760024 CACAGGAATCACTGGGGATCTGG - Intergenic
1140730667 16:77852982-77853004 CACAGTAAACTCTGTGGAGCTGG + Intronic
1141363618 16:83421041-83421063 CACAGCTTTTACTGTGGACAGGG - Intronic
1141781878 16:86168007-86168029 CACACCTTGCTCTGTGGAGCAGG - Intergenic
1141994144 16:87626292-87626314 CACAGTTATCACCATGGAGCTGG + Intronic
1142279858 16:89142175-89142197 CAGGGCTATCACTGAGAAGCAGG + Intronic
1143143801 17:4759930-4759952 CAAATCTATCACTCTGGTGCCGG - Intergenic
1144623572 17:16833186-16833208 CAAGGCTGTCACTGTGGGGCAGG - Intergenic
1144882857 17:18439530-18439552 CAAGGCTGTCACTGTGGGGCAGG + Intergenic
1145149374 17:20504856-20504878 CAAGGCTGTCACTGTGGGGCAGG - Intergenic
1146756744 17:35439258-35439280 CCCAACCTTCACTGTGGAGCTGG - Exonic
1146902826 17:36599562-36599584 GGCAGCCATCACTGTGAAGCTGG + Intronic
1146979251 17:37144408-37144430 CTTAGCTCTCACTGTGGGGCGGG - Intronic
1147577906 17:41613122-41613144 CAAGGCTGTCACTGTGGGGCAGG - Intronic
1148326042 17:46784041-46784063 CTCAGCTCTCATTGTGCAGCTGG + Intronic
1149214223 17:54335290-54335312 AACAGCAATCACTGGGGAGAGGG - Intergenic
1149741686 17:59052400-59052422 AACAGCTAACATTGTGTAGCCGG - Intronic
1151394423 17:73812819-73812841 CACAGCTGTCACTTTGGGGAAGG + Intergenic
1152088985 17:78236706-78236728 CACAGCCTTGACAGTGGAGCTGG - Intronic
1152450367 17:80374784-80374806 GACAGCTATGACAGTTGAGCTGG + Intronic
1152496146 17:80673408-80673430 CACTGTTATCACTGTGGAGGTGG + Intronic
1152600165 17:81258295-81258317 CCCATCTATCACGGGGGAGCCGG + Intronic
1158537101 18:58318109-58318131 CACAGGTATGAGTGTGGAGAGGG + Intronic
1159508066 18:69361029-69361051 TACAGCTTGCACTGTGGACCTGG + Intergenic
1159528074 18:69619208-69619230 CACGGCTGTGACTGTGGACCAGG + Intronic
1160047522 18:75400623-75400645 GACAGCTGTCACTCTGGAGGAGG + Intergenic
1160432722 18:78822909-78822931 GACAGCAATCACTCTGAAGCTGG + Intergenic
1160947204 19:1649149-1649171 CACGGTTATCACTGCGGAGCAGG - Intronic
1161984192 19:7644874-7644896 CACAGCTACCCCTCTGGACCCGG + Intronic
1162383572 19:10347222-10347244 CACATGTATCACTGTGGTACAGG + Intergenic
1162406203 19:10475497-10475519 GACAGCTATCACTGTTGAACAGG - Intergenic
1164210143 19:23091450-23091472 CACAGCTTGCACTGTGCACCTGG + Intronic
1167982833 19:53290241-53290263 CAGTGCTTTCACTGTGGAGGAGG - Exonic
1168696514 19:58406904-58406926 CACAGGTGTCACTGAGGAACAGG + Intronic
925021763 2:575299-575321 CACGGCTATCACTGTGCATGAGG + Intergenic
925064996 2:922582-922604 CCCAGCAATCTCTGTGGGGCAGG - Intergenic
925361082 2:3280759-3280781 CACAGCTTTCACTGTGGCACTGG - Intronic
929390971 2:41467932-41467954 CTCAGATATCACTGTGGCTCAGG - Intergenic
929572404 2:43030842-43030864 CACATCAGTCACTGTGTAGCTGG - Intergenic
930701211 2:54458564-54458586 CACAGCTGTGACTGGGGAGAGGG + Intronic
934090067 2:88543416-88543438 CACAGCAATCACTGTGGAGGTGG + Intergenic
935580224 2:104750179-104750201 CACAGCTCCCACTGGAGAGCAGG + Intergenic
938063258 2:128268039-128268061 CGCAGCTACCTCTGTGGAGCAGG + Exonic
938205587 2:129419490-129419512 CACAGCAAACCCTGTGGAGAGGG - Intergenic
942889054 2:180965024-180965046 GACAGCTTGCACTGTGCAGCTGG + Intergenic
944053245 2:195495637-195495659 ATCTGCTCTCACTGTGGAGCTGG - Intergenic
944808920 2:203308964-203308986 CACAGCTTGCACTGTGCACCTGG + Intergenic
945250697 2:207764234-207764256 CACAGCCAGCTTTGTGGAGCTGG - Exonic
946125283 2:217557406-217557428 CAAAGCTTTCACTGGGGTGCAGG - Intronic
948481546 2:238253380-238253402 CACAGCAGGCACTGTGAAGCTGG + Exonic
948693966 2:239723418-239723440 AAGAGGTACCACTGTGGAGCTGG - Intergenic
1171112573 20:22497729-22497751 AACAGCTTCCACTGTGGACCAGG + Intergenic
1171403098 20:24892112-24892134 CACAGCTTCCCCTGTGGAGGTGG + Intergenic
1174420716 20:50397354-50397376 CACAGCTACCACCGAGGTGCAGG + Intergenic
1177187076 21:17808554-17808576 GACAGCTTTCACTGTGCACCTGG + Intronic
1178232856 21:30807033-30807055 CACAGGCATCACTGTGGCCCAGG + Intergenic
1178887189 21:36493670-36493692 CACAGCTAACATTGTGGAGCGGG + Intronic
1180706313 22:17812241-17812263 CACAGCTGCCGCTGTGGGGCTGG - Intronic
1181611095 22:24012548-24012570 CCCAGTTATCACTCTGGATCAGG + Intronic
951289935 3:20863128-20863150 AACAGCTTGCACTGTGCAGCTGG - Intergenic
952589159 3:34930740-34930762 CACATCTCTCATTGTGCAGCAGG - Intergenic
952665015 3:35893960-35893982 CACAGGTATAAGTGTGGAGCAGG - Intergenic
952923772 3:38307058-38307080 CCCAGCTCTCAGGGTGGAGCAGG + Intronic
953021080 3:39113612-39113634 CACAGCAGTCACTGTGGGGTGGG + Intronic
953502934 3:43455350-43455372 CAGAGGTATGACTGTGGAGGTGG + Intronic
953503803 3:43463193-43463215 GACAGCTTTCACTGTGCACCTGG + Intronic
955803359 3:62708587-62708609 GAGAGCTATCTCTGTGGAGAGGG + Intronic
957787509 3:84901362-84901384 CACAGCTTGCACTGTGCACCTGG + Intergenic
957790395 3:84933138-84933160 CTGAGCAATCACTCTGGAGCTGG - Intergenic
959719403 3:109470074-109470096 CACAGCTTGCACTGTGCACCTGG + Intergenic
961141324 3:124559156-124559178 CACAGCTATCACTGTGGAGCTGG + Intronic
962563410 3:136632482-136632504 CACAGCTATCATTTTTGAGAAGG - Intronic
963007481 3:140739498-140739520 CACAGTTCTCACAGTGGAACAGG - Intergenic
963471564 3:145748192-145748214 CACAGCTTGCACTGTGCATCTGG - Intergenic
967376744 3:188812380-188812402 CACTGCTACCATTGTGGAACTGG - Intronic
967779503 3:193419858-193419880 CACAGCTATCACTTGGGCCCTGG - Intronic
967991200 3:195132137-195132159 CACAGCTGTAAATGTGGAGGTGG - Intronic
969282520 4:6180570-6180592 TATAGCTCTCACTGTGTAGCAGG + Intronic
970306062 4:14733864-14733886 GACAGCTTTCACTGTGCACCTGG - Intergenic
974317900 4:60306247-60306269 GACAGCTTTCACTGTGCACCTGG - Intergenic
974733648 4:65900435-65900457 AACAGCTAGCACTGTGCACCTGG + Intergenic
979856148 4:125636975-125636997 CACAGCTTGCACTGTGTACCTGG - Intergenic
980560043 4:134460607-134460629 CACAGCTTGCACTGTGCACCTGG + Intergenic
984442596 4:179791808-179791830 CACAGCTTGCACTGTGCACCTGG + Intergenic
985925614 5:3014239-3014261 CAGAGCTATCACTGTGCATCAGG + Intergenic
988091046 5:26542015-26542037 CACAGCTTTCACTGTGCACCTGG + Intergenic
988768050 5:34403276-34403298 CACAGCTAGCACTGTGCAGTTGG - Intergenic
990845000 5:60127447-60127469 GGCAGCTATCACTGTGGTTCAGG + Intronic
991186606 5:63815794-63815816 AACAGCTTTCACTGTGCACCTGG + Intergenic
992310994 5:75498863-75498885 CACAGCTTGCACTGTGCACCTGG + Intronic
992924493 5:81567649-81567671 CACAGCTTGCACTGTGCACCTGG + Intronic
993215836 5:85021659-85021681 CACAGCTTGCACTGTGCACCTGG - Intergenic
993409314 5:87554499-87554521 GACAGCTTGCACTGTGCAGCTGG - Intergenic
993532047 5:89037158-89037180 AACAGCCATCACTGTGTACCGGG + Intergenic
994649903 5:102513905-102513927 CACAGATCTCACTGTGAAGATGG + Intergenic
997361970 5:133300897-133300919 CCCCGCTTTCTCTGTGGAGCCGG + Intronic
998846492 5:146315462-146315484 CACACCTATCCCTGTGAAGCAGG + Intronic
1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG + Intergenic
1001704147 5:173729657-173729679 TTCAGCACTCACTGTGGAGCAGG + Intergenic
1002075655 5:176706841-176706863 CACACCTATCACTGTGCAATGGG + Intergenic
1002837481 6:877198-877220 CACAGCCATCCCTGAGGAGAGGG - Intergenic
1003204524 6:3994941-3994963 CACTTCTAAAACTGTGGAGCGGG + Intergenic
1003242047 6:4353516-4353538 AACTGCAAACACTGTGGAGCAGG - Intergenic
1003377050 6:5589052-5589074 CACACCCATCACCGTGGAGCTGG - Intronic
1003962753 6:11224311-11224333 AACCCCTGTCACTGTGGAGCTGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1004996477 6:21198696-21198718 CAAAGCTCTCACAGTGAAGCTGG - Intronic
1007309735 6:40935769-40935791 CACAGCCATCTCGGTGAAGCAGG - Intergenic
1008076644 6:47152721-47152743 CACAGCAATCACTAAGAAGCCGG + Intergenic
1008434372 6:51457685-51457707 AAGAGCTATCACTCTGGACCAGG - Intergenic
1009275271 6:61670065-61670087 AACAGCTATCTCTGAGGAGTAGG + Intergenic
1010350404 6:74867354-74867376 CACAACTAAGACTGTGGAACCGG + Intergenic
1015347233 6:132174685-132174707 AACAGCTTGCACTGTGCAGCTGG - Intergenic
1015508483 6:134013935-134013957 AACAGCTATAACTGGGGAGATGG + Intronic
1016279819 6:142403634-142403656 AACAGATATCACTGTGGATTGGG + Intronic
1017185344 6:151595043-151595065 CACAGCTGTCACTGTTAGGCAGG + Intronic
1017523681 6:155224237-155224259 AGCAGCCACCACTGTGGAGCCGG - Intronic
1017724542 6:157267874-157267896 CAAAGCCAGCACCGTGGAGCTGG + Intergenic
1019125028 6:169832604-169832626 CACAGCTCTCCCTGTGGCTCTGG - Intergenic
1025250260 7:57347111-57347133 CACAGCTACCACCGAGGTGCAGG - Intergenic
1025295928 7:57775329-57775351 CACAGCCATCACTTTGGACATGG - Intergenic
1027300361 7:76827712-76827734 GACAGCTTGCACTGTGGACCAGG - Intergenic
1030459094 7:109808318-109808340 CACAGCTTGCACTGTGCACCTGG + Intergenic
1031790095 7:126092179-126092201 AACAGCTTTCACTGTGCACCTGG - Intergenic
1033837708 7:145335619-145335641 GACAGCTTTCACTGTGCACCTGG - Intergenic
1034750004 7:153559813-153559835 AACAGCTTTCACTGTGCATCTGG - Intergenic
1034913557 7:155018190-155018212 CAGAGTTATCACAGTGAAGCAGG - Intergenic
1036747260 8:11418606-11418628 CACTGCCATCACGGTGGAGGAGG + Intronic
1036909773 8:12746809-12746831 AACAGCTAGAACTCTGGAGCTGG - Intronic
1038110949 8:24496463-24496485 CACAGCTTGCACTGTGCACCTGG + Intronic
1038991720 8:32875428-32875450 GACAGCTAGCAATGTGGTGCGGG - Intergenic
1041351348 8:56950892-56950914 GACAGCTTTCACTGTGCACCTGG - Intergenic
1041552236 8:59116478-59116500 CACAACTACAATTGTGGAGCTGG + Intronic
1041799169 8:61779969-61779991 AACTTCTGTCACTGTGGAGCTGG + Intergenic
1042274736 8:66992533-66992555 GAGAGCTCTCACTGGGGAGCAGG + Intronic
1042324008 8:67509011-67509033 CACAGCTTACATGGTGGAGCAGG + Intronic
1042675098 8:71311602-71311624 CAAAGCTAACACTGCGGAACAGG + Intronic
1042979816 8:74513734-74513756 CCCAGCTATCACTGTGATTCAGG + Intergenic
1043680762 8:83022213-83022235 AACAGCTTTCACTGTGCACCTGG - Intergenic
1047422088 8:124715644-124715666 CACAGTTATCACTGTGACACTGG - Intronic
1048301268 8:133252968-133252990 CACAGCCTCCACTCTGGAGCTGG - Intronic
1050635106 9:7604187-7604209 CACAGATAAAACTGTGTAGCTGG - Intergenic
1051345599 9:16148061-16148083 CACAGATTTCTCTGTGCAGCAGG - Intergenic
1053298359 9:36931112-36931134 CACAGGTATCCCTTGGGAGCTGG + Intronic
1057326884 9:94073428-94073450 CACAGCTATCACTACAGATCTGG - Intronic
1058581226 9:106460056-106460078 CACAGCTAGAAATCTGGAGCAGG - Intergenic
1059268313 9:113056545-113056567 CACAGCTCTCACCGCGGCGCTGG + Exonic
1059298154 9:113290893-113290915 CACAGCTATCACATTGCAACCGG + Exonic
1060105063 9:120868607-120868629 GGCATCTAGCACTGTGGAGCAGG - Intronic
1060395989 9:123317263-123317285 AACAGCTAACATGGTGGAGCTGG + Intergenic
1060799144 9:126532646-126532668 CACAGCTCTCGCTGTGGGTCAGG - Intergenic
1062027431 9:134346998-134347020 CCCAGCTGTCACTGTGGAGGTGG + Intronic
1186480748 X:9894865-9894887 CAAAGCTGTCACTGCGGAGAGGG - Exonic
1186722015 X:12314814-12314836 CACAGCTAACACTGTGAAAGTGG + Intronic
1190151998 X:47956872-47956894 CACAGCTCGTACTGGGGAGCTGG + Intronic
1190160660 X:48029277-48029299 CACAGCTCGTACTGGGGAGCTGG - Intronic
1191734787 X:64377302-64377324 CACAGCTTGCACTGTGCACCTGG + Intronic
1193421788 X:81292020-81292042 CACAGCTTGCACCGTGGACCTGG - Intronic
1194485096 X:94476661-94476683 CAGGGCTCTCCCTGTGGAGCAGG + Intergenic
1196478225 X:116113388-116113410 GACAGCTTGCACTGTGGACCTGG - Intergenic
1201304827 Y:12541563-12541585 CAAAGCTGTCACTGTGCAGAGGG - Intergenic
1202580495 Y:26375779-26375801 CACAGGTATAACTGTGGAAATGG + Intergenic