ID: 961142664

View in Genome Browser
Species Human (GRCh38)
Location 3:124568168-124568190
Sequence CTAAATTTAAAAATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2856
Summary {0: 2, 1: 4, 2: 114, 3: 620, 4: 2116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961142660_961142664 24 Left 961142660 3:124568121-124568143 CCAGATTATATAAAGAACTCCTG 0: 2
1: 17
2: 205
3: 791
4: 1705
Right 961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG 0: 2
1: 4
2: 114
3: 620
4: 2116
961142661_961142664 5 Left 961142661 3:124568140-124568162 CCTGCAACTCAACAACAACAACC 0: 1
1: 3
2: 60
3: 203
4: 689
Right 961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG 0: 2
1: 4
2: 114
3: 620
4: 2116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961142664 Original CRISPR CTAAATTTAAAAATGGACAA AGG Intronic
Too many off-targets to display for this crispr