ID: 961144795

View in Genome Browser
Species Human (GRCh38)
Location 3:124584807-124584829
Sequence GGGCGGCGGGGCAACATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 82}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961144784_961144795 -1 Left 961144784 3:124584785-124584807 CCCGTGCCATGCGGGAGCGCTGG 0: 1
1: 0
2: 0
3: 30
4: 121
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82
961144780_961144795 11 Left 961144780 3:124584773-124584795 CCGGGCTGGCGCCCCGTGCCATG 0: 1
1: 0
2: 1
3: 48
4: 1804
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82
961144778_961144795 13 Left 961144778 3:124584771-124584793 CCCCGGGCTGGCGCCCCGTGCCA 0: 1
1: 0
2: 0
3: 9
4: 95
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82
961144783_961144795 0 Left 961144783 3:124584784-124584806 CCCCGTGCCATGCGGGAGCGCTG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82
961144786_961144795 -2 Left 961144786 3:124584786-124584808 CCGTGCCATGCGGGAGCGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 135
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82
961144774_961144795 28 Left 961144774 3:124584756-124584778 CCCGCCGCGCTCTCACCCCGGGC 0: 1
1: 0
2: 1
3: 24
4: 258
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82
961144777_961144795 24 Left 961144777 3:124584760-124584782 CCGCGCTCTCACCCCGGGCTGGC 0: 1
1: 0
2: 0
3: 22
4: 216
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82
961144779_961144795 12 Left 961144779 3:124584772-124584794 CCCGGGCTGGCGCCCCGTGCCAT 0: 1
1: 0
2: 0
3: 8
4: 210
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82
961144775_961144795 27 Left 961144775 3:124584757-124584779 CCGCCGCGCTCTCACCCCGGGCT 0: 1
1: 0
2: 0
3: 21
4: 184
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82
961144790_961144795 -7 Left 961144790 3:124584791-124584813 CCATGCGGGAGCGCTGGGGCGGC 0: 1
1: 0
2: 0
3: 14
4: 130
Right 961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961144795 Original CRISPR GGGCGGCGGGGCAACATGAA GGG Intronic
900621686 1:3590478-3590500 GGGCGGTGGGGCCTCATGACCGG - Intronic
902627997 1:17688063-17688085 GGGCAGTGGGGCAGAATGAAAGG - Intronic
904467699 1:30718193-30718215 GGGGGGCGGGGCCACATCAGAGG - Intronic
907101651 1:51843106-51843128 GGAGGGCAGGGCAACATGTAAGG + Intronic
916059270 1:161087646-161087668 GGGCTGGGAGGGAACATGAAAGG + Intronic
919759642 1:201089385-201089407 GGGCGCCGGTGCACCATCAATGG - Exonic
920871068 1:209795449-209795471 GGGTGGCAGTGCAACCTGAATGG - Intronic
923702410 1:236312486-236312508 GGGAGGCGGGGAAACAAGGATGG + Intergenic
1072925237 10:99611284-99611306 GGGCAGTGTGGCAAAATGAAGGG - Exonic
1075158698 10:120003776-120003798 GGGAGGCGGGGTACTATGAATGG - Intergenic
1075283329 10:121160485-121160507 GAGAGGTGGGGCAACATGATTGG - Intergenic
1076139118 10:128065412-128065434 GGGCGGTGCTGCAAAATGAAAGG + Intronic
1076866040 10:133166845-133166867 GGGCGGCCGAGCCACATGGAGGG + Intronic
1081736485 11:45408118-45408140 GGGTGGGGAGGCAAAATGAAGGG - Intergenic
1084226582 11:67718772-67718794 GGGAGGCTGAGGAACATGAATGG - Intergenic
1088918174 11:114242749-114242771 GAGCGGCGGGGCATCAAGAGTGG - Intronic
1089003082 11:115068436-115068458 GGGCTGAGGGGGGACATGAAAGG + Intergenic
1094844375 12:34355009-34355031 GTGCGGCGGGGAAACAGAAACGG - Intergenic
1095962847 12:47846241-47846263 GGCCAGCTGGGCAACCTGAAGGG - Intronic
1102253907 12:111405530-111405552 TGGAGGCGGGGCCAGATGAAGGG - Intergenic
1106868498 13:33993642-33993664 GGAAGGCAGGGCAACAGGAATGG + Intergenic
1117823542 14:59676602-59676624 AGGAGGCAGGACAACATGAAAGG + Intronic
1119162787 14:72467302-72467324 GGAAGGAGGGGCAACATTAAGGG + Intronic
1119232589 14:72992605-72992627 GGGCGGGGGGGGCACCTGAATGG - Intronic
1120946424 14:90002122-90002144 GGGTGGCTGGGGAACAGGAATGG - Intronic
1124968808 15:34463676-34463698 AGCAGGCGGGGAAACATGAAAGG + Intergenic
1128687212 15:69695659-69695681 GGCCGTCGGGGCAACCTGGATGG - Intergenic
1130991603 15:88879068-88879090 GGCTGCCGGGGCAACATGATGGG + Exonic
1137476237 16:48811767-48811789 GGGAGGCGGGGCAAGAAGGATGG - Intergenic
1137554293 16:49460976-49460998 TGGCAGGGGGGTAACATGAAAGG - Intergenic
1142292983 16:89201231-89201253 GGGCTGCGGGGCAGCAGGGACGG + Intronic
1142737201 17:1908496-1908518 GGGTGGCTGGGAAACTTGAAAGG + Intergenic
1144965816 17:19076697-19076719 GGGCGGTGGGGCGACAGGATGGG + Intergenic
1144982152 17:19175485-19175507 GGGCGGTGGGGCGACAGGATGGG - Intergenic
1144986071 17:19202754-19202776 GGGCGGTGGGGCGACAGGATGGG + Intergenic
1145886530 17:28385637-28385659 GGGAGGGGTGGCAACAGGAAGGG + Intronic
1147190685 17:38736242-38736264 GGGAGGCGGGGCAATGGGAAGGG + Intronic
1148149031 17:45385232-45385254 GGGCGGTGGGGCATCTGGAAAGG + Intergenic
1148341634 17:46876768-46876790 GGCCGGCTGGGCAGCTTGAAGGG - Exonic
1151305085 17:73257985-73258007 GGGAGCCGAGGCAGCATGAAGGG + Intronic
1151466501 17:74289158-74289180 GGGCTGGAGGGCAACAGGAAGGG - Intronic
1203191970 17_KI270729v1_random:199067-199089 CGGCGGCGGGGCAAAAAGCAGGG - Intergenic
1153855020 18:9136980-9137002 GGGGGGCGTGGCGACAGGAAAGG + Intronic
1156538748 18:37888999-37889021 GGGCTGCAGGGCAACCTGCAAGG + Intergenic
1161062013 19:2219946-2219968 GGGCAGCGGGGGAACTTGAGCGG - Intronic
1161394539 19:4038217-4038239 GGGCGGCGGGGCATCCGGAGGGG - Exonic
925946611 2:8870004-8870026 GGGGGGCAGGGGAACATGGAAGG - Intronic
926170260 2:10548738-10548760 GGGCCCCGGGGCAACAGGACCGG - Intergenic
927965034 2:27263008-27263030 GGGCGGCGGGGCCACCAGAGTGG + Exonic
943600898 2:189919842-189919864 TGGAGGAGGGGCAAGATGAAGGG - Intronic
947319738 2:228903815-228903837 AAGAGGCAGGGCAACATGAAAGG - Intronic
948214276 2:236216959-236216981 GTGCAGCGGGGCAACCTGGAAGG - Intronic
948923667 2:241080607-241080629 GGGCGGGGAGCCAACCTGAAGGG + Intronic
1170735757 20:19012972-19012994 AGGGGGCGGGGCGACAGGAAAGG - Intergenic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
957176949 3:76824044-76824066 GGGTGGTGGCACAACATGAAAGG - Intronic
961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG + Intronic
988793936 5:34634778-34634800 GGGAGACAGGGCAAAATGAATGG + Intergenic
992931330 5:81649630-81649652 GGGAGGGAGGGGAACATGAATGG + Intronic
1008046063 6:46852454-46852476 GGGCCGTGTGGCAACATAAATGG - Intergenic
1008381936 6:50846253-50846275 GGGCGGGGGTCCTACATGAAAGG - Exonic
1010428225 6:75749376-75749398 CGGCGGCGGGGCTACCTGTACGG - Exonic
1018926787 6:168212429-168212451 GGGCAGCGGGGCAGCAGGCAGGG + Intergenic
1019511032 7:1417367-1417389 GGGAGAAGGGGCAACAGGAAGGG - Intergenic
1021866756 7:24965930-24965952 GAGGGGTGGGGCCACATGAATGG - Intronic
1027342202 7:77221555-77221577 GGGTGGGGGTGCAGCATGAAGGG - Intronic
1035573807 8:691204-691226 GGGGGCCCGGGCAACAGGAAAGG + Intronic
1037879180 8:22564893-22564915 GGGTGGCGGGGGAACCTGGATGG + Intronic
1037892258 8:22629571-22629593 AGCTGGCGGGGCAAGATGAAAGG + Intronic
1037920460 8:22802057-22802079 GGGGGGAGGGGCAGCAGGAAGGG - Intronic
1042561126 8:70072422-70072444 GCGCGGCGGGGCTGCAAGAAGGG + Intergenic
1042715215 8:71765048-71765070 GGGAGCCAGGGCAACATGGATGG + Intergenic
1045517186 8:102870208-102870230 GGGAGGTGGGGCCTCATGAAAGG + Intronic
1046763937 8:118049535-118049557 GGGATGCAGGGCACCATGAATGG - Intronic
1047292290 8:123541118-123541140 GGGCGGCGGGGCGGCGGGAACGG + Exonic
1049583451 8:143422777-143422799 GGGGGGCGGGGGGGCATGAAGGG - Intronic
1049610669 8:143553386-143553408 GGGCGGCGGGGCTCCAAGGAAGG - Exonic
1053482502 9:38425921-38425943 GGGCGGTTAGGCACCATGAAGGG + Intergenic
1062454200 9:136628027-136628049 GGGCTGCGGCGCCACATGGATGG + Intergenic
1185894182 X:3843561-3843583 GGGCGGCGCGGCGGCATCAACGG + Exonic
1185899301 X:3881985-3882007 GGGCGGCGCGGCGGCATCAACGG + Intergenic
1185904418 X:3920414-3920436 GGGCGGCGCGGCGGCATCAACGG + Intergenic
1187443852 X:19343865-19343887 GGGCCGCGGGCCAACCAGAACGG - Intergenic