ID: 961144960

View in Genome Browser
Species Human (GRCh38)
Location 3:124585829-124585851
Sequence GGGTGGGGTATTGTAAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961144960_961144973 14 Left 961144960 3:124585829-124585851 CCCCCATTTACAATACCCCACCC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 961144973 3:124585866-124585888 TCTGCTATGCAAAATCCTAATGG 0: 1
1: 0
2: 1
3: 16
4: 158
961144960_961144974 24 Left 961144960 3:124585829-124585851 CCCCCATTTACAATACCCCACCC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 961144974 3:124585876-124585898 AAAATCCTAATGGAACTTTCTGG 0: 1
1: 0
2: 2
3: 29
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961144960 Original CRISPR GGGTGGGGTATTGTAAATGG GGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902164350 1:14557940-14557962 GTTTGGGGTCTTCTAAATGGAGG - Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
903659504 1:24968452-24968474 GGGTGGGACATTGTAAAGGATGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906201687 1:43964578-43964600 GGGTGGGGAATGGGAAAGGGAGG + Intronic
907097940 1:51798855-51798877 GGGTGGGGTTGTGGAAATGGGGG - Intronic
909138898 1:71837692-71837714 GGGATTGCTATTGTAAATGGAGG - Intronic
909385460 1:75050490-75050512 GGGTGGGGAAAGGTAAAAGGTGG + Intergenic
911724584 1:101229189-101229211 GTGTGGGGGCTTGTCAATGGAGG - Intergenic
915616601 1:157044180-157044202 GGGTGGGCTATGGGAATTGGTGG - Intronic
915944835 1:160142028-160142050 TGGTGGGGTATTCTAAAATGTGG - Exonic
924124499 1:240836148-240836170 GGGTGGGGGGTTGATAATGGGGG + Intronic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1065547991 10:26841576-26841598 GGGTGGGGAATGGGAAATGTAGG - Intronic
1066220176 10:33330144-33330166 ATGAGGGGTTTTGTAAATGGTGG - Intronic
1067054096 10:43041324-43041346 GGATGGGTTATAGTGAATGGCGG - Intergenic
1073284659 10:102380441-102380463 GGGGGGAGTATGGTAAAGGGAGG - Intronic
1075605072 10:123799050-123799072 GGGTGGGGTTTTGCAAAGAGAGG - Intronic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1077937607 11:6804942-6804964 GGATGGGGAATTGTTAATGCTGG - Intergenic
1078964976 11:16328481-16328503 GGATGGGGTATAGTTAGTGGTGG - Intronic
1079246890 11:18759076-18759098 GAGTGGGGTAGTGTATCTGGTGG - Intronic
1080384087 11:31800187-31800209 GGATGGGGCATTGGAAGTGGTGG - Intronic
1088755304 11:112880765-112880787 TGGTGGGGGAATGTATATGGAGG - Intergenic
1090858340 11:130631201-130631223 GAGTGGTTTATTGTAAATGGAGG + Intergenic
1091589872 12:1836637-1836659 GGGGAGGGCATTGTCAATGGTGG + Exonic
1091812926 12:3415015-3415037 GGGTTTGGCATTGGAAATGGGGG - Intronic
1096732441 12:53625644-53625666 GGGTGGATTATTGGAAATGAGGG - Intronic
1102530576 12:113543517-113543539 GGGTGGGGTTATCTAAAAGGCGG + Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1107063755 13:36189479-36189501 GGGAAGGGTATTTTATATGGAGG - Intronic
1111533863 13:89576182-89576204 GTGTAGGGTGTTGAAAATGGGGG - Intergenic
1113574229 13:111382754-111382776 GGGTGGGGTTATGGAGATGGTGG + Intergenic
1117034735 14:51716236-51716258 GGTTGGGGTGTGTTAAATGGAGG - Intronic
1119540374 14:75434288-75434310 GGGTGGGGGATAGAAGATGGAGG - Intronic
1121650133 14:95552124-95552146 GGGTGGGATATTGTGAAGGAGGG + Intergenic
1122532301 14:102436912-102436934 GGGTGGGGTATTGGAATTCTAGG + Intronic
1122600556 14:102919618-102919640 GGGTGGTGTGTTATGAATGGTGG - Intergenic
1127309813 15:57742761-57742783 AAGTGGGGTTTTGCAAATGGTGG + Intronic
1128451239 15:67806987-67807009 GGGTGGGGCATTGAGAATGGAGG + Exonic
1131830910 15:96354110-96354132 AGGAGGGGTTTTGTGAATGGGGG - Intergenic
1132072610 15:98792218-98792240 TGGTAGAGTATTGTAAATGTAGG + Intronic
1135474180 16:22759385-22759407 GGGTGAAGTCTTGGAAATGGTGG + Intergenic
1140889384 16:79272073-79272095 GGGTGGGGGGATGTCAATGGGGG + Intergenic
1141257137 16:82412754-82412776 GGGTGGGGTATGGTAGGTGTTGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1145207732 17:20993592-20993614 GGGAGGCACATTGTAAATGGTGG + Intergenic
1149546859 17:57510264-57510286 AGGTGGGATGTTGTGAATGGTGG + Intronic
1153053405 18:921953-921975 GGTTGGGGCATTGTAATTGAGGG - Intergenic
1153432290 18:5030911-5030933 GGGAGTGGTAGTGGAAATGGGGG + Intergenic
1155433349 18:25785460-25785482 GGCTGGGGCATTGGATATGGTGG - Intergenic
1162194478 19:8973766-8973788 GGGTGGGTGATTGTAAAGGGTGG + Exonic
1162797691 19:13095265-13095287 GGGTGGGGTGGGGTAAGTGGAGG - Exonic
1163870502 19:19817268-19817290 GGGAGGGGAATGGCAAATGGAGG - Intronic
1163879298 19:19903257-19903279 GGGAGGGGAATGGCAAATGGAGG + Intronic
1163884490 19:19953831-19953853 GGGAGGGGAATGGCAAATGGAGG - Intergenic
1163898418 19:20079589-20079611 GGGAGGGGAATGGCAAATGGAGG + Intronic
1163939889 19:20481822-20481844 GGGAGGGGAATGGCAAATGGAGG + Intergenic
1166071829 19:40392552-40392574 TGCTGGGGTCTTGGAAATGGGGG + Intergenic
1167328335 19:48838152-48838174 GGGTGGGGGTGTGTACATGGGGG + Intronic
1167445592 19:49535256-49535278 GGGACGGGCATTGTAACTGGAGG - Intronic
925887944 2:8409836-8409858 TGGTGGTGTATTGTAGATGTAGG - Intergenic
926027117 2:9555398-9555420 GGGCGGGGTATTGGCGATGGTGG - Intronic
926124675 2:10264801-10264823 GTGTGGGGTGTGGTAAATCGTGG + Intergenic
929167783 2:38901061-38901083 GAGTGGGGTATCCTAAATGCAGG - Intronic
932137702 2:69245316-69245338 AGGTGGGGGAGTGTAGATGGGGG - Exonic
932571775 2:72942010-72942032 GGGTGTGGTTTTGTGAATTGTGG - Intergenic
933269828 2:80221421-80221443 GGGTGGGGTATTGTAAGAAATGG - Intronic
933840566 2:86282940-86282962 GGGTGGGGGATAGTGCATGGTGG - Intronic
935658338 2:105443893-105443915 GGGTGGGATAGAGGAAATGGAGG - Intergenic
938742907 2:134249407-134249429 GGCTGGGGTATGGAGAATGGAGG - Intronic
939885358 2:147675660-147675682 GAGTTGGTTATTGTAAAGGGAGG - Intergenic
946486648 2:220106959-220106981 GAGAGGGATATTGGAAATGGGGG - Intergenic
1172649375 20:36492132-36492154 GGGTGAGGTATTGGAAGAGGTGG + Intronic
1172667887 20:36613485-36613507 GGGTGGGGCCTGGTTAATGGTGG + Exonic
1173360134 20:42336430-42336452 GGAGGGGGGGTTGTAAATGGTGG + Intronic
1175482988 20:59324584-59324606 GGGGGGGGTATTGTTAAGTGGGG - Exonic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178628132 21:34235487-34235509 GGAAGGGGTCTTGTAAATTGCGG - Intergenic
1181572273 22:23773985-23774007 GGGTGGGGTAGAGTGAATGGGGG + Intronic
1183018128 22:35006645-35006667 GGGTGGGGTAATGTCAGTGCAGG - Intergenic
1185408385 22:50670657-50670679 GGGTGTGGACTTGTAGATGGAGG + Intergenic
951116027 3:18863063-18863085 AGGTAGGTTATTGAAAATGGGGG + Intergenic
952712357 3:36444116-36444138 GGGTAGGATATTCAAAATGGTGG + Intronic
953293711 3:41691550-41691572 GGGGGAGGTATTGTTAGTGGTGG - Intronic
953510919 3:43538215-43538237 GTTTGGGGTATTGTTAATGTGGG + Intronic
954413427 3:50381208-50381230 AGTTGGGGGATTCTAAATGGGGG - Intronic
955677631 3:61465330-61465352 GGGTGGGGTAGGGTTACTGGTGG - Intergenic
955968630 3:64414213-64414235 GGGTTGGTTATTGGAAAAGGTGG + Intronic
956034806 3:65079441-65079463 GGGTGGGGAAATGGATATGGAGG - Intergenic
956105169 3:65809904-65809926 GGGTGGGGAATTCAGAATGGGGG - Intronic
961144960 3:124585829-124585851 GGGTGGGGTATTGTAAATGGGGG - Intronic
965496709 3:169407180-169407202 AGTTTGGGTACTGTAAATGGTGG - Intronic
969950896 4:10834289-10834311 AGGTGGGGTAGTGTCAAAGGAGG + Intergenic
970995856 4:22267045-22267067 GGGTGGGTTATTATAAAGTGAGG + Intergenic
971959564 4:33467801-33467823 GGGTGGGGAATTAGATATGGCGG + Intergenic
975434179 4:74332085-74332107 GGTTCATGTATTGTAAATGGTGG - Intergenic
977462367 4:97341095-97341117 TGGTGGGGTTTTCTAAATGTAGG - Intronic
978440627 4:108729921-108729943 GGGTGGGGCAATGCATATGGAGG + Intergenic
981477416 4:145200751-145200773 GGGTGGGGGAGTGTGAAAGGGGG + Intergenic
981553018 4:145960792-145960814 GGGTTGAGGAATGTAAATGGGGG + Intergenic
985146168 4:186896272-186896294 GGGTGGGGTTTTATTGATGGCGG + Intergenic
986531732 5:8744112-8744134 GTGTGGGATATTGAAAATGCAGG - Intergenic
987713737 5:21538601-21538623 GGGTTGATTTTTGTAAATGGTGG - Intergenic
991406596 5:66306093-66306115 GGGTGGGATATTTGAAATAGAGG + Intergenic
994183967 5:96798399-96798421 GGGTGGGGTATAGTTGATGGAGG + Intronic
998777688 5:145620455-145620477 GTGGGGGATATTGAAAATGGGGG + Intronic
999431391 5:151528143-151528165 GGTAGGGGGATTGTGAATGGAGG + Intronic
1000222925 5:159231528-159231550 GGGTGGTGCTTTGCAAATGGTGG + Intergenic
1002773940 6:312659-312681 GGGTGGGGTGTTGGAAAGGGAGG + Intronic
1003418839 6:5938056-5938078 GGCTGGAGTTTTGTAAAGGGAGG + Intergenic
1010123273 6:72404786-72404808 GGGTGGGGGATAGGAAAAGGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1012630672 6:101462836-101462858 GGGTGGGGTTTAGTGAAAGGAGG + Intronic
1013002676 6:106039984-106040006 GGTGTGGGTATTGTAAAGGGAGG - Intergenic
1013890835 6:115025029-115025051 AGGTGTGGTATTATAAGTGGGGG - Intergenic
1014086148 6:117346683-117346705 GGTAGGGGTATTGATAATGGGGG - Intronic
1015995013 6:138988201-138988223 GGCCGGGGCACTGTAAATGGCGG - Exonic
1016422742 6:143901737-143901759 GGGTGGGGTAATGTAGAGAGAGG - Intronic
1021790507 7:24199990-24200012 GGATAGGGTTTTGCAAATGGTGG + Intergenic
1023766405 7:43515127-43515149 GAGTGGGGAATTCTAGATGGAGG + Intronic
1024252796 7:47519238-47519260 GGGGGGGATATCTTAAATGGGGG - Intronic
1024402067 7:48935826-48935848 GGCTTGGGTACTGGAAATGGTGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026508739 7:71009674-71009696 GAGTGGGGGATTGCAAAGGGAGG + Intergenic
1026649003 7:72198591-72198613 GAGTGGGTTATTTTAAAGGGTGG - Intronic
1028770572 7:94615768-94615790 GAGTGATGTAGTGTAAATGGTGG - Intronic
1029440104 7:100582704-100582726 GGGTTGGGGAATGTCAATGGAGG + Intronic
1029479196 7:100802684-100802706 GGGTGAGGTAGTGAAAAGGGCGG - Exonic
1029794221 7:102876525-102876547 CGGTGGGGTCTTTTAAATGAAGG - Intronic
1032405735 7:131654030-131654052 GGGTGCTGTATTGTATATGTAGG + Intergenic
1032706252 7:134423171-134423193 GGGTGGGGCATTGGAGATGGAGG + Intergenic
1036703224 8:11027891-11027913 GGGTGGGATGTTGATAATGGGGG - Intronic
1038141570 8:24850762-24850784 GGATGGGGGATTTTAAATGGAGG - Intergenic
1039081555 8:33738859-33738881 TGGTGGGATAATGTAAACGGCGG + Intergenic
1044323545 8:90833772-90833794 GGTTGGGGCATTGGAAATGGAGG - Intronic
1046941136 8:119932772-119932794 TGGTGGGGTACTTTAAATAGGGG + Intronic
1047673094 8:127170364-127170386 GGGAGGAGTAGTGTAAATGAGGG - Intergenic
1051104244 9:13560125-13560147 GTCTGGGGTATTGTAAAAGTGGG - Intergenic
1052240686 9:26269265-26269287 GAGTGGAGTATAGAAAATGGAGG - Intergenic
1056063271 9:82906947-82906969 GAGTGGGGGAATGTAAAGGGAGG + Intergenic
1056317214 9:85401595-85401617 GGGTGTGGTATTGTAATTCTTGG - Intergenic
1056541827 9:87577916-87577938 GGGTTGGGGATTGGAACTGGAGG + Intronic
1060947271 9:127577400-127577422 GTGTGGGGTATTGGATCTGGAGG - Intronic
1060947280 9:127577435-127577457 GTGTGGGGTATTGGATCTGGAGG - Intronic
1060947289 9:127577470-127577492 GTGTGGGGTATTGGATCTGGAGG - Intronic
1060947298 9:127577505-127577527 GCGTGGGGTATTGGATCTGGAGG - Intronic
1060947307 9:127577540-127577562 GCGTGGGGTATTGGATCTGGAGG - Intronic
1060947316 9:127577575-127577597 GCGTGGGGTATTGGATCTGGAGG - Intronic
1060947325 9:127577610-127577632 GCGTGGGGTATTGGATCTGGAGG - Intronic
1061058285 9:128236507-128236529 GGGTGGGGAAGAGTGAATGGAGG - Intronic
1061581806 9:131542164-131542186 GTGTGGGGTGTTGAAAATGAGGG - Intergenic
1195317333 X:103691967-103691989 GGGTGGGGATTTGTCAAAGGAGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195681230 X:107548039-107548061 GGTTGGGGTATGGTTGATGGTGG - Intronic
1195834362 X:109096067-109096089 GGGTGGGGTACTGGAAAGAGTGG + Intergenic
1195952703 X:110292899-110292921 GTGTGGGGTGTTGTTAATGGGGG + Intronic
1199705558 X:150421952-150421974 GGCTGGGGAATTGTAATCGGTGG + Intronic
1199916307 X:152345205-152345227 GGATGGGGTCTTGTAAGTTGAGG - Intronic
1200244418 X:154515636-154515658 GGGTTTGGTTTTGGAAATGGAGG - Intronic