ID: 961145500

View in Genome Browser
Species Human (GRCh38)
Location 3:124589623-124589645
Sequence GCCCCAAGGATTTTATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961145500_961145504 13 Left 961145500 3:124589623-124589645 CCAGGGGATAAAATCCTTGGGGC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 961145504 3:124589659-124589681 CTTTTATTTCTTCATCTTCTAGG 0: 1
1: 2
2: 14
3: 118
4: 1134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961145500 Original CRISPR GCCCCAAGGATTTTATCCCC TGG (reversed) Intronic
903755515 1:25657872-25657894 GCCCCAGGGATATGAACCCCAGG + Intronic
903803572 1:25988361-25988383 GCCCCAAAGCTGTTATCCCAAGG + Intronic
904503273 1:30930033-30930055 GTCCCAAGGATTCTATGGCCCGG - Intergenic
915599047 1:156910824-156910846 GCCCAGAGGCTTTTATACCCAGG - Intronic
916053624 1:161052721-161052743 GCCCCGAGGACCTTATGCCCAGG - Exonic
917543876 1:175942054-175942076 GCCCCAAGGAGTTTATGAGCAGG + Intergenic
922752243 1:228075742-228075764 ACCCCAATGCTTTTAGCCCCAGG + Exonic
1067075676 10:43179977-43179999 ACCTCATGGATTTTTTCCCCCGG - Intronic
1069100452 10:64313908-64313930 GAACCAAGGATTCTGTCCCCAGG + Intergenic
1074195699 10:111182895-111182917 GCCACCCTGATTTTATCCCCAGG + Intergenic
1076996252 11:298841-298863 GCCCCAAGGAGTATCTCCTCAGG - Intronic
1077401569 11:2360688-2360710 GCCCCAGGGATCTTAACCACAGG - Intergenic
1081751359 11:45513519-45513541 GTCCCAAGGATGTTATACTCTGG + Intergenic
1082765281 11:57162940-57162962 GCCCCAACGTTATTATCCTCAGG + Intergenic
1083340433 11:61955515-61955537 GCCCCAAGGGTTCTGTCACCCGG - Intronic
1085087935 11:73684651-73684673 GCCTCAATGATTTTAACACCTGG + Intronic
1086579097 11:88376237-88376259 AGCCTAAGCATTTTATCCCCAGG + Intergenic
1087630822 11:100648187-100648209 GCCCAAAAGATATAATCCCCTGG + Intergenic
1089056389 11:115588971-115588993 GCCCAGAGAATTTTATCCACTGG - Intergenic
1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1103038652 12:117676773-117676795 GACCCAACGATTTTACTCCCAGG + Intronic
1104072011 12:125353995-125354017 GCCCCAAGGATGCTATTTCCAGG - Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106239742 13:27901547-27901569 CCCCCACACATTTTATCCCCTGG - Intergenic
1108764503 13:53610299-53610321 TCCCTAAGGATTTTATTCACTGG + Intergenic
1124784939 15:32671055-32671077 CCCACAAGCATGTTATCCCCGGG + Intronic
1130178127 15:81596157-81596179 GCTCCAGGGATTTTCTCCCCTGG - Intergenic
1134761976 16:16722582-16722604 TCCCCTAGAATTTTATCTCCTGG - Intergenic
1134984082 16:18636588-18636610 TCCCCTAGAATTTTATCTCCTGG + Intergenic
1135031885 16:19045140-19045162 GCCCCATGGAGTCTAACCCCAGG + Intronic
1138753519 16:59453930-59453952 GCCCCAAGAATTTTTTAGCCAGG - Intergenic
1203141590 16_KI270728v1_random:1770875-1770897 GCAACAATGATGTTATCCCCAGG + Intergenic
1147954398 17:44124054-44124076 GCCCCTGGGAATCTATCCCCAGG - Intergenic
1148739234 17:49882822-49882844 GCCCCCAGGATCATATCACCGGG - Intergenic
1150873280 17:68939490-68939512 ACTTCAAGGATTTTATCCACAGG - Intronic
1151159469 17:72152774-72152796 TCCTCAAGGATTTTCTCCCTGGG - Intergenic
1160658036 19:283602-283624 GCCCAGAGCATTTTATTCCCTGG - Intronic
1162042483 19:7979140-7979162 GCCCTAAGTAATTTCTCCCCAGG - Intronic
1165157780 19:33798167-33798189 GCCCCCAGGACTTTCGCCCCGGG + Intronic
1168510483 19:56969661-56969683 GAGCCAAGGTTTTTAACCCCAGG + Intergenic
1168516349 19:57013133-57013155 GCCCCCTGGATGGTATCCCCTGG - Intergenic
1168516389 19:57013243-57013265 GCCCCCTGGATGGTATCCCCTGG - Intergenic
1168516430 19:57013355-57013377 GCCCCCTGGATGGTATCCCCTGG - Intergenic
926384799 2:12325474-12325496 GCATCAAGGATTTCTTCCCCAGG + Intergenic
932180614 2:69643389-69643411 GCCCCACGGTTTTTCTCGCCGGG - Intronic
937474485 2:122202826-122202848 ACACCAGGGATGTTATCCCCAGG + Intergenic
938228451 2:129637419-129637441 GCACCAAGTATTTCATCACCTGG + Intergenic
938959950 2:136331807-136331829 GCCCAGAGGATTGTATCCACTGG - Intergenic
939952350 2:148490094-148490116 TCCTCTAGAATTTTATCCCCTGG - Exonic
940495788 2:154426464-154426486 GACCGAAGGTTTCTATCCCCTGG - Intronic
943496079 2:188622381-188622403 CCCCCAAGATTCTTATCCCCTGG + Intergenic
943834493 2:192501699-192501721 GCCCCATGGTGTTTATTCCCAGG + Intergenic
944666725 2:201965128-201965150 GGCCCAAGTATTTTGTCCCTGGG - Intergenic
946079703 2:217106833-217106855 GCTCCAAGGATACTATTCCCTGG + Intergenic
947684962 2:232075464-232075486 TCCCCAAGGGCTTTATCCTCAGG + Intronic
1169661804 20:7986722-7986744 TCCCCAGGTATTTTCTCCCCAGG - Intronic
1171197626 20:23212684-23212706 GCCCCAGGCATTTGTTCCCCAGG - Intergenic
1171216979 20:23359490-23359512 GCCACAAGGTTTTTATTCTCTGG - Intergenic
1171797233 20:29576122-29576144 GCCCCAGGCATTATTTCCCCGGG - Intergenic
1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1178297384 21:31421653-31421675 TCCCCAAGCTTTTTATCACCAGG - Intronic
1179412885 21:41175663-41175685 GCCCCCAGGATTTCATGCCACGG + Intronic
1182619231 22:31609650-31609672 GACCCCAGGGTTTTGTCCCCAGG - Intronic
1182860746 22:33557268-33557290 ACACCAAGGATTTTTTTCCCTGG - Intronic
1183197819 22:36365412-36365434 GCCCCAAGGATGAGATGCCCTGG - Intronic
1185049349 22:48545753-48545775 GCCCCAAGGAGATTGTCGCCTGG + Intronic
959794104 3:110401937-110401959 ACCCAAAGAATTTTATACCCTGG - Intergenic
961145500 3:124589623-124589645 GCCCCAAGGATTTTATCCCCTGG - Intronic
961584256 3:127909374-127909396 ACCCCAGGGATCTCATCCCCAGG + Intergenic
966510963 3:180762898-180762920 ACCCCAAGGATACTGTCCCCAGG - Intronic
975868023 4:78745772-78745794 GCCCCAAAGTATTTAGCCCCTGG - Intergenic
981218006 4:142194645-142194667 ACCCCAAGGATTTTACACTCAGG + Intronic
981817245 4:148844862-148844884 GCCCAAAGTACTTTCTCCCCGGG - Intergenic
983109733 4:163734661-163734683 TCCCCACTGCTTTTATCCCCAGG - Intronic
985979355 5:3449351-3449373 CCCTCAACGATTTTATCTCCAGG + Intergenic
988835649 5:35029820-35029842 CCTCCCAGGATTTTTTCCCCAGG - Intronic
1000004050 5:157166611-157166633 ACACCCAGGATTTTACCCCCAGG - Intronic
1001561830 5:172674750-172674772 GGCCCAATGAGTCTATCCCCTGG - Intronic
1004083537 6:12420979-12421001 GGACAAAGGATTTTATGCCCAGG - Intergenic
1005532049 6:26717748-26717770 ACCCAAAGAATTTTATCCTCAGG - Intergenic
1005538746 6:26783917-26783939 ACCCAAAGAATTTTATCCTCAGG + Intergenic
1005756772 6:28932139-28932161 TCTTCAAAGATTTTATCCCCAGG - Intergenic
1009009601 6:57826162-57826184 ACCCAAAGAATTTTATCCTCAGG + Intergenic
1009559946 6:65226748-65226770 GACCCAAGAATTTTATTCCTTGG + Intronic
1012429817 6:99152795-99152817 GCCCCAAGATTTCTGTCCCCTGG + Intergenic
1015469257 6:133585244-133585266 CCTCCAAGTATTTGATCCCCTGG + Intergenic
1018863677 6:167731510-167731532 GTCCCTAGGATTTTATACGCTGG - Intergenic
1023418947 7:39958778-39958800 GCCTCAAAAATTTTATCCCCAGG - Intronic
1024123631 7:46269930-46269952 GGGCCAAGAATTTTAGCCCCAGG - Intergenic
1026791266 7:73333600-73333622 GCCCCAGGGAGATTCTCCCCTGG - Intronic
1026901516 7:74039995-74040017 GCCCCAAGGATTCTAGCATCTGG - Intronic
1036081518 8:5561842-5561864 GTCCTAAGGATTTTCTCTCCAGG + Intergenic
1037433017 8:18833562-18833584 ACCCCAAAGATTTTCTCCACTGG - Intronic
1037925687 8:22842555-22842577 GCCCCATGGATTTTAAACTCAGG - Intronic
1038955848 8:32467806-32467828 GCCTCAGGGATTTTATAGCCTGG + Intronic
1040516104 8:48136436-48136458 GTGCCAAGGTGTTTATCCCCTGG + Intergenic
1042864999 8:73349331-73349353 GACCCAAGGTGTTTATCCTCAGG + Intergenic
1043522737 8:81063846-81063868 GACCCAAGGATTATATACCCAGG + Intronic
1043868232 8:85399948-85399970 GCCCCAGTGTTTTTCTCCCCGGG - Intronic
1051367395 9:16330598-16330620 GCCCTGAGGATTTTATATCCAGG - Intergenic
1060435042 9:123586003-123586025 GCCCCAAGGATTTTTGCCCTCGG - Intronic
1061373854 9:130212748-130212770 TGCCCAAGAATTTTGTCCCCAGG - Intronic
1185550934 X:981846-981868 GCAACAATGATGTTATCCCCAGG - Intergenic
1188118638 X:26277598-26277620 GCCCCAAGCACTTTAGCCTCTGG + Intergenic
1193468803 X:81875698-81875720 GCCCCAAGCATGTGAACCCCCGG + Intergenic
1194909570 X:99624389-99624411 ACCCTAAAGATTATATCCCCAGG - Intergenic