ID: 961148537

View in Genome Browser
Species Human (GRCh38)
Location 3:124616247-124616269
Sequence GCTTAATTATAGAGGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961148537_961148547 15 Left 961148537 3:124616247-124616269 CCCCCCAGCCTCTATAATTAAGC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 961148547 3:124616285-124616307 TTGGTTAAGGTTACTACTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 85
961148537_961148545 2 Left 961148537 3:124616247-124616269 CCCCCCAGCCTCTATAATTAAGC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 961148545 3:124616272-124616294 GTTGCAGTTACCTTTGGTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 123
961148537_961148548 16 Left 961148537 3:124616247-124616269 CCCCCCAGCCTCTATAATTAAGC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 961148548 3:124616286-124616308 TGGTTAAGGTTACTACTGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 113
961148537_961148543 -4 Left 961148537 3:124616247-124616269 CCCCCCAGCCTCTATAATTAAGC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 961148543 3:124616266-124616288 AAGCCTGTTGCAGTTACCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961148537 Original CRISPR GCTTAATTATAGAGGCTGGG GGG (reversed) Intronic
901347834 1:8562776-8562798 GCTAAATTATAGACCCTGGCTGG + Intronic
903103860 1:21056784-21056806 TCTCAATTATGAAGGCTGGGAGG + Intronic
903820984 1:26102479-26102501 GCTTAAATTCAGAGGCTGGTGGG - Intergenic
903821561 1:26106866-26106888 GCTTAAATCCAGAGGCTGTGGGG - Intergenic
905211881 1:36380125-36380147 TCTTGATTACAGAGCCTGGGAGG + Intronic
905247569 1:36625593-36625615 GCTTAGGCATAGAGTCTGGGGGG + Intergenic
905435186 1:37950969-37950991 GCATATTCATAGAGGTTGGGGGG + Intergenic
905776946 1:40674402-40674424 GCTCAAGTCTAGAGGCTGGAGGG - Intergenic
907636542 1:56140757-56140779 TCATAATTCTGGAGGCTGGGAGG - Intergenic
910989453 1:93040062-93040084 TCTCAATTAGAGAGTCTGGGAGG + Intergenic
911528695 1:99017256-99017278 GGTTAATGATAGAGGCTTGCGGG + Intergenic
912652269 1:111449751-111449773 GCTTAGTGATAGAGCCTGGCGGG + Intronic
912841252 1:113041548-113041570 GCCTTATAAAAGAGGCTGGGGGG - Intergenic
914241223 1:145854381-145854403 GTTTAATTATGAAGGCTGGAGGG + Intronic
919569176 1:199224257-199224279 GCATAATTTTAGAGGCTGCATGG - Intergenic
921337508 1:214103098-214103120 GCTTAGTCATAGAGGATGGAAGG - Intergenic
922445943 1:225697488-225697510 TCTTAAGAATGGAGGCTGGGAGG + Intergenic
1063346793 10:5319143-5319165 GCTTAATTGCAGAGACTGGTGGG - Intergenic
1063833397 10:9983373-9983395 ACTTAAGGGTAGAGGCTGGGAGG - Intergenic
1065085592 10:22172453-22172475 GCTTAAGGATAGATGGTGGGAGG - Intergenic
1065280452 10:24132463-24132485 GCTCAATTTTAGAGGCTACGAGG + Intronic
1067335172 10:45355809-45355831 CCTTAATAGTAGAGGCTGAGTGG - Intergenic
1067808081 10:49407065-49407087 GCTTCAGTAAAGAGGCTGGCTGG + Intergenic
1068704723 10:60061971-60061993 AATTCATTATAGAGGCTGGGTGG + Intronic
1070079235 10:73168929-73168951 GCTTAATTGCAGAGGTGGGGAGG - Intronic
1070386354 10:75928216-75928238 GCTTTACAATGGAGGCTGGGTGG + Intronic
1071217830 10:83428603-83428625 GCCTTATGATGGAGGCTGGGCGG + Intergenic
1071970916 10:90905835-90905857 GGTTAATTATAAAGGGTGGATGG + Intronic
1075503871 10:123004500-123004522 GCCTAATTACAGAGGATGGCTGG + Intronic
1076842971 10:133055705-133055727 GCTTAATTACATAGGCTGGACGG - Intergenic
1078363540 11:10688590-10688612 GCTCAATGAGAGAGGCTGAGAGG - Intronic
1085768071 11:79301313-79301335 GCTCAATTACAGAGACTGTGGGG - Intronic
1087115494 11:94520377-94520399 TCTAAATTATACAGGCTAGGTGG - Intergenic
1089915329 11:122149768-122149790 TCTTAATTAGAGAGCCTAGGTGG + Intergenic
1091483684 12:861784-861806 TCTTAATTATGGAGGCCAGGAGG - Intronic
1094779957 12:33779306-33779328 TTTTAATTATAGAGGCTGTATGG + Intergenic
1097954939 12:65474664-65474686 GCTTCATTGTGGCGGCTGGGAGG - Intronic
1102736181 12:115162247-115162269 GGTTAATTAGAGAAGTTGGGAGG + Intergenic
1104665054 12:130641929-130641951 GCTTATCTATAGAGTCAGGGTGG - Intronic
1105716612 13:23071895-23071917 GCTTGAGGATAGAGGGTGGGAGG - Intergenic
1106399183 13:29411459-29411481 TTTTAATTATAGAGGCTTTGTGG + Intronic
1108476985 13:50830014-50830036 GCTAAATAAAAGCGGCTGGGAGG - Intronic
1110468865 13:75834826-75834848 TCTTAATTATAGAGGCTAGATGG + Intronic
1111875222 13:93885035-93885057 GCTAAATGTTAGATGCTGGGTGG + Intronic
1113500223 13:110767479-110767501 GCTGGCTGATAGAGGCTGGGAGG + Intergenic
1113573276 13:111373872-111373894 GCTTAATTATAGATGCAGAATGG + Intergenic
1113638804 13:111942726-111942748 ATTTAATTGTAGAGGCTGTGAGG - Intergenic
1117161977 14:52998564-52998586 GCTTCATTCCAGAGGCTGAGAGG - Intergenic
1117192532 14:53306963-53306985 GGCTAATTATGGAGGGTGGGAGG - Intergenic
1117699637 14:58400015-58400037 GCATAAGAATAGAGGCAGGGTGG - Intronic
1117721412 14:58632118-58632140 TCTTAATTAAAGAGGCTGTGCGG + Intergenic
1117864466 14:60131127-60131149 TCATAGTTCTAGAGGCTGGGAGG - Intronic
1122675091 14:103406181-103406203 GCTTAATTAGTGAGGCATGGTGG - Intronic
1133481023 16:6170740-6170762 GCTTGAGGATAGAGGGTGGGAGG - Intronic
1134352665 16:13452300-13452322 GCTTAATTATAGATGCTTCAGGG + Intergenic
1137481984 16:48859451-48859473 GCTTCATCAAGGAGGCTGGGAGG - Intergenic
1144964697 17:19069319-19069341 GCTTTGTTATCCAGGCTGGGGGG - Intergenic
1144983270 17:19182855-19182877 GCTTTGTTATCCAGGCTGGGGGG + Intergenic
1144984955 17:19195384-19195406 GCTTTGTTATCCAGGCTGGGGGG - Intergenic
1150157445 17:62865932-62865954 GCTGAAATGTAGAGGCTGGGAGG + Intergenic
1150157531 17:62866691-62866713 GCTGAAATGTAGAGGCTGAGAGG - Intergenic
1157861139 18:51141491-51141513 TCTTAATTTTAGCTGCTGGGTGG + Intergenic
1167120287 19:47512681-47512703 GTTTTATTTTAGAGGCTGCGAGG - Intronic
1167135394 19:47612602-47612624 GCTTAGCTGTAGGGGCTGGGGGG + Intronic
1168385523 19:55959957-55959979 GCTAAATCATGGAGGCTTGGGGG + Intronic
925080845 2:1064524-1064546 GCGTGACTATAGAGGATGGGAGG + Intronic
929352493 2:40975114-40975136 GCTTAATTATAGATGTTGGATGG + Intergenic
935000325 2:99007863-99007885 ATTTAATTATAGAGGCTATGTGG - Intronic
935555337 2:104503435-104503457 TCTTCATTAAAGGGGCTGGGTGG + Intergenic
940886920 2:158998300-158998322 TCTTAATTATAGAATCTAGGTGG - Intronic
941064284 2:160883489-160883511 GTTGAATTATACAGGCTGGCAGG - Intergenic
941492495 2:166159674-166159696 GCTTACTTCTAGAAGATGGGGGG - Intergenic
942945268 2:181665396-181665418 GATGAATTATACAGCCTGGGGGG - Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945634317 2:212328426-212328448 CCTTAATTATAGAATCTAGGAGG - Intronic
946514595 2:220397865-220397887 GCATAATTATATACCCTGGGAGG - Intergenic
948216232 2:236235343-236235365 GCTTAATCATATAGCCTAGGTGG + Intronic
948672665 2:239578439-239578461 GCATGATTACAGAGGCTGAGGGG + Exonic
948960280 2:241329451-241329473 GCTTAATAAAATAGGCTGGTAGG - Intronic
1169374981 20:5059250-5059272 TCTGAATGACAGAGGCTGGGAGG - Intergenic
1172938855 20:38640867-38640889 GCATCATTATAGAGGCTGGCAGG - Intronic
1173570177 20:44070899-44070921 GCTCAGTTGTGGAGGCTGGGAGG + Intergenic
949095315 3:78748-78770 GCTAAAGTACAGAGCCTGGGTGG - Intergenic
950704774 3:14772971-14772993 GGTTTATTATAGAAGCTTGGAGG - Exonic
952800164 3:37283255-37283277 GCTTAAATATATAGGCTGGCTGG + Intronic
954041569 3:47891756-47891778 GCTCAATAATGGGGGCTGGGTGG + Intronic
956307246 3:67839070-67839092 GCTTAATTCTAGAGCCACGGAGG - Intergenic
957142481 3:76379048-76379070 GCTTAATGATGGAGGGTGGTGGG + Intronic
960221318 3:115112470-115112492 GATAGATAATAGAGGCTGGGAGG - Intronic
961148537 3:124616247-124616269 GCTTAATTATAGAGGCTGGGGGG - Intronic
962682350 3:137813421-137813443 ACTTAATTTTAGATGCTGGAAGG - Intergenic
963293998 3:143524970-143524992 TCATGATTCTAGAGGCTGGGAGG - Intronic
964327465 3:155562861-155562883 GTTTGATGATATAGGCTGGGGGG - Intronic
966028442 3:175315308-175315330 GCTAAATAATAGAGGGTGGGAGG + Intronic
966250138 3:177856459-177856481 GCTTAATTATAGATTTTGGTAGG - Intergenic
966920063 3:184605251-184605273 GCTTAATCATAGAGTTGGGGTGG + Intronic
967788143 3:193519543-193519565 GCTTAATTATATAGGATGGTTGG - Intronic
970669501 4:18379893-18379915 CCTTTATTATAGAGACTGGAAGG + Intergenic
978360849 4:107930213-107930235 GGTTAATTATAGAAGATGAGAGG + Intergenic
979748963 4:124252411-124252433 TGTTAATTGTAGAGGCAGGGTGG - Intergenic
983169915 4:164523632-164523654 GGTTAATTAGATAGGCAGGGTGG + Intergenic
986100204 5:4601302-4601324 ACTTCATTATAGAGGAAGGGAGG - Intergenic
987765708 5:22226422-22226444 GCTTAAATATGGATGGTGGGGGG + Intronic
992061632 5:73055196-73055218 GCTTAATGATAGGGGGTGTGAGG + Intronic
996583671 5:125060520-125060542 ACATAATTACAGAGGCTTGGTGG - Intergenic
997482355 5:134195757-134195779 GTTTAATTATAGAGACTGACCGG - Exonic
1000806275 5:165796800-165796822 GTTGGATTTTAGAGGCTGGGAGG - Intergenic
1001465672 5:171963434-171963456 GCTTAATTAGAGAGACAGGGAGG + Intronic
1002870121 6:1159474-1159496 ACTTAAGGGTAGAGGCTGGGAGG - Intergenic
1010580283 6:77588202-77588224 GCTTGATGATAGTGGCTGGCAGG + Intergenic
1010862107 6:80925656-80925678 GCTTAAGTGTAAAGGATGGGTGG - Intergenic
1014445708 6:121524856-121524878 GCTTAATAATACCGGCTGGTAGG + Intergenic
1015528709 6:134199152-134199174 ACTTGATGATAGAGGATGGGAGG + Intronic
1020572424 7:9882554-9882576 GATTAATTATAAAGGATGAGTGG + Intergenic
1020886545 7:13825054-13825076 ATTTAATTATAGGGGCTGGTGGG + Intergenic
1020983181 7:15097122-15097144 GCTTAACTATTGGGGCGGGGGGG - Intergenic
1023347451 7:39286034-39286056 GCTTAAGTACAGATGCTGGTGGG - Intronic
1026904661 7:74056216-74056238 GCTCAGTGAGAGAGGCTGGGCGG - Intronic
1027633662 7:80641757-80641779 GATTAATTATAGATGCTCTGGGG + Intronic
1031586667 7:123538821-123538843 ACATAATCATAGAGGATGGGAGG + Exonic
1032398320 7:131606675-131606697 GGTGAGTTGTAGAGGCTGGGAGG - Intergenic
1036152174 8:6308830-6308852 GATTACTTACAGAGGCTGGAAGG - Intergenic
1044841105 8:96337940-96337962 GATCACTTAAAGAGGCTGGGTGG - Intergenic
1186211054 X:7251186-7251208 ACATAATTACAGAGGCTGGATGG - Intronic
1186513344 X:10147699-10147721 CTTTAATTATAGAGGCTTGTTGG + Intergenic
1187260520 X:17681480-17681502 GCTTAACTACAGAGTCTGGGTGG + Intronic
1187791192 X:22951924-22951946 GCTTAATTGCAGAGCCTGGAAGG - Intergenic
1188473392 X:30564956-30564978 GCAGCAGTATAGAGGCTGGGTGG - Intronic
1194004257 X:88470875-88470897 TGGTAATTATAGAGGCTGGAGGG + Intergenic
1198608261 X:138368489-138368511 GCTTCATTATAGAGGGAGGAGGG + Intergenic
1198691574 X:139290637-139290659 GCATAATTTTATAGGCTGAGAGG - Intergenic
1199595090 X:149500742-149500764 GCTTCATTCTAGAAGCTGGTGGG - Intronic
1201981260 Y:19912459-19912481 GCTTAATTATAATGACTGAGAGG - Intergenic