ID: 961150419

View in Genome Browser
Species Human (GRCh38)
Location 3:124632903-124632925
Sequence GGCAAATGGTTTCTGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961150419_961150430 18 Left 961150419 3:124632903-124632925 CCAGCAGACAGAAACCATTTGCC 0: 1
1: 0
2: 2
3: 16
4: 219
Right 961150430 3:124632944-124632966 TGGGCCTGAGGGGAGTCATTTGG 0: 1
1: 0
2: 1
3: 22
4: 288
961150419_961150422 -8 Left 961150419 3:124632903-124632925 CCAGCAGACAGAAACCATTTGCC 0: 1
1: 0
2: 2
3: 16
4: 219
Right 961150422 3:124632918-124632940 CATTTGCCAGATTTGGAGATAGG 0: 1
1: 0
2: 1
3: 19
4: 293
961150419_961150424 -2 Left 961150419 3:124632903-124632925 CCAGCAGACAGAAACCATTTGCC 0: 1
1: 0
2: 2
3: 16
4: 219
Right 961150424 3:124632924-124632946 CCAGATTTGGAGATAGGACCTGG 0: 1
1: 0
2: 0
3: 46
4: 559
961150419_961150426 6 Left 961150419 3:124632903-124632925 CCAGCAGACAGAAACCATTTGCC 0: 1
1: 0
2: 2
3: 16
4: 219
Right 961150426 3:124632932-124632954 GGAGATAGGACCTGGGCCTGAGG 0: 1
1: 0
2: 1
3: 32
4: 401
961150419_961150427 7 Left 961150419 3:124632903-124632925 CCAGCAGACAGAAACCATTTGCC 0: 1
1: 0
2: 2
3: 16
4: 219
Right 961150427 3:124632933-124632955 GAGATAGGACCTGGGCCTGAGGG 0: 1
1: 0
2: 2
3: 26
4: 236
961150419_961150428 8 Left 961150419 3:124632903-124632925 CCAGCAGACAGAAACCATTTGCC 0: 1
1: 0
2: 2
3: 16
4: 219
Right 961150428 3:124632934-124632956 AGATAGGACCTGGGCCTGAGGGG 0: 1
1: 2
2: 2
3: 17
4: 240
961150419_961150425 -1 Left 961150419 3:124632903-124632925 CCAGCAGACAGAAACCATTTGCC 0: 1
1: 0
2: 2
3: 16
4: 219
Right 961150425 3:124632925-124632947 CAGATTTGGAGATAGGACCTGGG 0: 1
1: 0
2: 0
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961150419 Original CRISPR GGCAAATGGTTTCTGTCTGC TGG (reversed) Intronic
902618369 1:17636132-17636154 GGCACAGGGTTCCTTTCTGCTGG + Intronic
904388544 1:30163689-30163711 GGCAAATTCATTCTATCTGCTGG + Intergenic
908035912 1:60052894-60052916 GACTAATTGGTTCTGTCTGCCGG - Intronic
908297605 1:62728747-62728769 GGCAAATGTTTTTTGACAGCCGG - Intergenic
908600981 1:65739801-65739823 GTCAAATGGTCTCTGATTGCAGG - Intergenic
910840806 1:91559610-91559632 GGCAAATGCTCTCTGTCTCCTGG - Intergenic
916318145 1:163473207-163473229 GGAAAATGGTCTCTGTGTGCTGG - Intergenic
918488029 1:185049842-185049864 AGCAAATGGTTCCAGTCTCCAGG - Intronic
918998008 1:191787865-191787887 GGACACTGGTTTCTCTCTGCAGG - Intergenic
919818216 1:201455424-201455446 GGCAAGTGTTTTCTGTTTGTAGG - Intergenic
920404860 1:205701531-205701553 AGGAAATGGTTCCTGTCTCCAGG + Intergenic
921291696 1:213663800-213663822 GGGGAATGGCTTCTGTCTGGTGG - Intergenic
921535219 1:216341047-216341069 GTCAAATTGTCTCTGTTTGCAGG + Intronic
922622062 1:226996404-226996426 GTCAAATTGTCTCTGTCTGCAGG - Intronic
1062885762 10:1014977-1014999 GTCTGATGGTTTCTGTCTGATGG + Intronic
1063539374 10:6916831-6916853 GGCATAAGGTTTCTGTTTCCTGG + Intergenic
1063931208 10:11030050-11030072 GGAAAATGTTTTCTGGCTTCTGG - Intronic
1066113166 10:32215242-32215264 TGCAAATAGTTTCTGTCTAGTGG - Intergenic
1066297935 10:34071682-34071704 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1071584816 10:86809740-86809762 GGTAAAGAGTTTCTGTTTGCGGG - Intronic
1071993488 10:91124438-91124460 GGCAAAGGTTTTCTGAATGCTGG - Intergenic
1072313782 10:94182158-94182180 GGAAAATGGTTTCTATCTTTGGG + Intronic
1072387367 10:94944721-94944743 GTCAAATTGTCTCTGTTTGCAGG + Intronic
1072844356 10:98812994-98813016 GGCAAATAGTTTCTATGGGCTGG + Intronic
1075772704 10:124953381-124953403 GGTAACGGGTTTCTTTCTGCTGG + Intronic
1078392499 11:10948204-10948226 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
1083968301 11:66056757-66056779 GGCAAATGCATTCTTTCAGCCGG - Intronic
1084771808 11:71348040-71348062 GGCAAATTAGTTGTGTCTGCTGG - Intergenic
1084902084 11:72317235-72317257 GGCAAATGGTTGAGGGCTGCCGG + Intronic
1087569448 11:99906074-99906096 GTCAAATTGTCTCTGTTTGCAGG - Intronic
1089095046 11:115913079-115913101 GGCAGAGGATTTCAGTCTGCTGG + Intergenic
1089577502 11:119456274-119456296 GTCAAATGGTATTTGTCTGTAGG + Intergenic
1089649299 11:119901945-119901967 GGCATCTGGTTTGTATCTGCAGG - Intergenic
1090460817 11:126890195-126890217 GGAGAATGGTTTCTGGCTCCCGG + Intronic
1090622746 11:128575918-128575940 TACCAAGGGTTTCTGTCTGCTGG + Intronic
1092527464 12:9318075-9318097 GGTAAATATTTTCTGGCTGCAGG + Intergenic
1093121325 12:15274922-15274944 GTGAAATGTTTTCTGTGTGCAGG - Intronic
1093382960 12:18517671-18517693 GTCAAATTGTCTCTGTTTGCAGG - Intronic
1093806410 12:23438468-23438490 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1094524443 12:31222516-31222538 GGTAAATATTTTCTGGCTGCAGG + Intergenic
1095108631 12:38266088-38266110 GTCAAATTGTTTCTGTTTGCAGG - Intergenic
1096040417 12:48510433-48510455 TTCCAATGGTATCTGTCTGCTGG - Intronic
1098695013 12:73541386-73541408 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1098707301 12:73706796-73706818 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1100691830 12:97046585-97046607 GTCAAATGTTTACTGTCTTCTGG - Intergenic
1101035919 12:100706425-100706447 CAAAAATGGATTCTGTCTGCAGG - Intergenic
1101635557 12:106537788-106537810 GGCATATGGTTTCTTGCTGTTGG + Intronic
1101739236 12:107487410-107487432 GACACAAGGTCTCTGTCTGCTGG + Intronic
1102627488 12:114247039-114247061 GGCAACTGGCTTCAGTCTTCTGG + Intergenic
1106147048 13:27058799-27058821 GGAAAATGGTTTCTAACTGAAGG + Intergenic
1110675895 13:78243916-78243938 GGCAAATTGTTTTTGTTTTCTGG - Intergenic
1111647438 13:91048575-91048597 TGCAAATAATTTCTGTCTGATGG + Intergenic
1114441099 14:22748603-22748625 GGAAAAAGGATTATGTCTGCAGG + Intergenic
1114576502 14:23719251-23719273 GGCAATTGGGTTCTGTCCTCAGG + Intergenic
1120577358 14:86199580-86199602 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
1126253529 15:46597331-46597353 TGAAAATGTGTTCTGTCTGCTGG + Intergenic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1127902323 15:63350016-63350038 TGCAAATGGTTTCTGTTTGGGGG + Intronic
1127930652 15:63595078-63595100 GGAAACAGGGTTCTGTCTGCAGG - Intergenic
1128529633 15:68435530-68435552 TGCAAAGGTGTTCTGTCTGCAGG + Intergenic
1128729901 15:70014094-70014116 GGCAAATGCTTCCTCCCTGCGGG + Intergenic
1137468974 16:48737530-48737552 GGAGAATGGTTACTGTATGCAGG + Intergenic
1138270716 16:55693981-55694003 GGCTGATGGCTTTTGTCTGCTGG + Intronic
1138726387 16:59144590-59144612 GGAAAATAGTATCTCTCTGCAGG - Intergenic
1139305046 16:65978129-65978151 ATCAAATGGTTTCTGTGTTCTGG - Intergenic
1139400638 16:66678610-66678632 GGCAAATTAATTCTGTCTGGTGG + Intronic
1139470471 16:67175391-67175413 GGGAAATGGGTTGTGTATGCGGG - Exonic
1139478499 16:67215371-67215393 GGGAGATGGTTCCTGCCTGCAGG + Intronic
1140952577 16:79833377-79833399 GTGAAAGGGTTTCTGTCTTCAGG + Intergenic
1141616381 16:85211974-85211996 ATCAAATGGTTTCTGACTGGGGG + Intergenic
1142053194 16:87974056-87974078 GGCACAGGGTTTCTGTCCTCAGG + Intronic
1143007892 17:3848802-3848824 TGCAAATGTTTTCTGTCTGGTGG - Intergenic
1143307074 17:5955874-5955896 GGCAAGTGGTTGCTGGCTGATGG - Intronic
1148990525 17:51662467-51662489 TGCAAATAGTTTCTTTCTACAGG + Intronic
1151937498 17:77271735-77271757 GGGAGATGGTTCCTGTCTTCTGG - Intergenic
1154375146 18:13802986-13803008 GGCCAATGGGTTCTCTCTACAGG - Intergenic
1154465418 18:14639197-14639219 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1155129131 18:22912599-22912621 GGCCAAAGATTTCTATCTGCAGG - Intronic
1155495959 18:26442040-26442062 GGCAAATGCTTTTTGTTTGAAGG + Intergenic
1156776421 18:40794271-40794293 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1159479082 18:68964036-68964058 AACAAATGGTGTCTGTCTTCGGG + Intronic
1162675026 19:12292731-12292753 GACAAATGATTTCTGCCTTCTGG - Intronic
1163291851 19:16384172-16384194 GGCAGATGGGCTCTGTCTTCGGG - Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164151993 19:22562295-22562317 GTCAAATGGTCTCTGTTGGCAGG - Intergenic
1165143846 19:33719223-33719245 GGCAAATACCTTCTGTCAGCCGG + Intronic
1167140171 19:47644838-47644860 GCAAAAGGTTTTCTGTCTGCAGG + Intronic
927179264 2:20432860-20432882 GGCACATGGTTGCTGTCCACTGG + Intergenic
928332475 2:30368312-30368334 GGCAGAAAGTCTCTGTCTGCTGG - Intergenic
928423865 2:31161814-31161836 GCAAATTGGTTTCCGTCTGCTGG - Intergenic
928446761 2:31339721-31339743 GGCAAGTGGTATCTGTCCTCAGG - Intronic
929564067 2:42973983-42974005 GGGGGCTGGTTTCTGTCTGCTGG + Intergenic
932027424 2:68149590-68149612 AGCACATGGTTTCTAACTGCAGG + Intronic
933603551 2:84358019-84358041 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
935123720 2:100203840-100203862 GGCAAATGTGTTCTGGCTGTGGG + Intergenic
936631796 2:114211253-114211275 GGCAAATCTTTTCTCTCTGAAGG + Intergenic
937590639 2:123609296-123609318 TGCAAATGGCTCCTCTCTGCAGG + Intergenic
937717668 2:125052919-125052941 GGCTGATGGTGGCTGTCTGCTGG + Intergenic
938775782 2:134540154-134540176 GGCAAATGCTTCCTGGCAGCAGG + Intronic
938905569 2:135832888-135832910 GGCAAGTGGCTTCTTCCTGCAGG + Intronic
938977081 2:136489731-136489753 GGTAGATGGTTTTTATCTGCTGG + Intergenic
940037169 2:149323047-149323069 TTCCAATGGTATCTGTCTGCTGG - Intergenic
942217227 2:173733257-173733279 GGCAAATGGAATCTCTCTGGGGG + Intergenic
942218086 2:173742029-173742051 GGCAAATGCGTTGTCTCTGCTGG + Intergenic
942335294 2:174877904-174877926 GGCATATGTTTTTTGTATGCTGG + Exonic
942711951 2:178846773-178846795 GGCAAATGTTTTCTGTGTAGAGG - Intronic
943294886 2:186125537-186125559 GGCAAACAGTTTCTGTGTGTGGG + Intergenic
943352856 2:186816026-186816048 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
945681987 2:212925274-212925296 GAAAAAAGGTTTCTGTCTGTAGG - Intergenic
945991229 2:216396910-216396932 GGCAAGTGGGTGCTGGCTGCTGG + Intergenic
947560548 2:231146329-231146351 GACAAGTGATTTCAGTCTGCTGG - Exonic
1170601271 20:17843353-17843375 GGCAACTGGATTCTGTCTGGGGG - Intergenic
1170817442 20:19726416-19726438 GGAGAATGGATTTTGTCTGCTGG + Intergenic
1172320195 20:33990562-33990584 GCCAAATGAATTATGTCTGCAGG - Intergenic
1174946462 20:54991647-54991669 GGAAAATGGTTTCAGTGGGCTGG - Intergenic
1175366553 20:58460202-58460224 GGCAAAGGGCTTGTGTCTTCAGG - Exonic
1175460903 20:59151253-59151275 GCCACATGGCTTCTGTCTCCTGG + Intergenic
1176809122 21:13519207-13519229 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
1177129077 21:17234473-17234495 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1179365077 21:40751411-40751433 CACACATGGTTTCTGGCTGCTGG - Intronic
1181710324 22:24681091-24681113 GTCAAATTGTTTCTGTTTGCAGG - Intergenic
1181979009 22:26752856-26752878 CCCAAATGGTTTCTGATTGCTGG + Intergenic
1181981262 22:26768502-26768524 GGCAGGTGGTTGCTTTCTGCTGG + Intergenic
1182151233 22:28028518-28028540 GGGAACTGGTTCCTGACTGCTGG + Intronic
1182957217 22:34437745-34437767 GGCAAAAGATATCTGTCTTCTGG + Intergenic
1183241493 22:36661036-36661058 GGCACATGCTTTCTGAGTGCAGG + Intronic
1183666828 22:39250843-39250865 AGCAAATGGCTTCTGTCTCTGGG - Intergenic
949957795 3:9283918-9283940 GGCAAATGAATTCTGCCTGGTGG - Intronic
951155985 3:19353936-19353958 GTCAAATTGTCTCTGTTTGCAGG + Intronic
951238940 3:20267783-20267805 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
952131997 3:30374665-30374687 GGCAAATGGGTAGTGTCTGGAGG + Intergenic
953074445 3:39555400-39555422 GTCAAATGATCTCTGTTTGCAGG + Intergenic
955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG + Intronic
955810274 3:62780632-62780654 TGCAAATGATTTCTGTCTAGTGG + Intronic
956458698 3:69450147-69450169 GGCTAATGATTATTGTCTGCAGG - Intronic
958677616 3:97287181-97287203 GTCAAATGGTTTCTGTTTGTAGG - Intronic
961150419 3:124632903-124632925 GGCAAATGGTTTCTGTCTGCTGG - Intronic
962008588 3:131371870-131371892 AGCACATGGTTTCTCTCTGCTGG - Intergenic
962010624 3:131387220-131387242 GGCACATGGTTTCTCTTTGTGGG - Intronic
963292049 3:143501888-143501910 GTCAAATTGGTTCTGTCAGCTGG - Intronic
964522602 3:157584531-157584553 GGCAAATAGCTTCTGGCTGTCGG + Intronic
965097971 3:164258583-164258605 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
965163492 3:165165738-165165760 GTCAAATTGTTCCTGTTTGCAGG - Intergenic
966042860 3:175512827-175512849 GGCAAATTGTTTGCTTCTGCTGG - Intronic
969171521 4:5367762-5367784 GGCAAATGTCTTTTCTCTGCTGG + Intronic
969352979 4:6608860-6608882 GGCTCACGGTTCCTGTCTGCAGG + Intronic
969422276 4:7104326-7104348 AGAACATGGCTTCTGTCTGCAGG - Intergenic
971392566 4:26199716-26199738 GGCAAGTGGTTTCTTTTTGGGGG + Intronic
971661503 4:29422250-29422272 GGCAAATGCTTTATCTCTGATGG + Intergenic
973585950 4:52391248-52391270 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
976156946 4:82156163-82156185 GTCAAATGGTCTCTCTTTGCAGG + Intergenic
976438670 4:85047747-85047769 GTCAAATTGTCTCTGTTTGCGGG + Intergenic
976647981 4:87405358-87405380 TTCCAATGGTATCTGTCTGCTGG + Intergenic
978288565 4:107109390-107109412 GTCAAACGGTCTCTGTTTGCAGG + Intronic
980568405 4:134577098-134577120 GGCAAATTTTTGCTGTCTTCTGG + Intergenic
982324270 4:154112975-154112997 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
983167034 4:164490524-164490546 GGCAATTGGTTCCTGACTTCAGG + Intergenic
983376138 4:166930972-166930994 GGAAAATTGTTTCTGTGTGTAGG - Intronic
983645408 4:169985349-169985371 AGTAAATGGTTTCTGTCAACAGG - Intergenic
984101243 4:175489024-175489046 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
984386422 4:179065538-179065560 GGCAAATGGTAGCAGTGTGCAGG + Intergenic
985332346 4:188851952-188851974 GTCAAATGGTCTCTTTTTGCAGG - Intergenic
986214809 5:5709585-5709607 GGCAGATGGTTGTTGGCTGCTGG - Intergenic
987298065 5:16571793-16571815 GGTAAAAGGTTTGTGTGTGCTGG - Intronic
987833207 5:23125550-23125572 GTCAAATTGTTTCTGTTTGCAGG - Intergenic
988373948 5:30408793-30408815 GACAAATGGTTTGTGTCAGGAGG - Intergenic
989624750 5:43418696-43418718 GGGACATGGTCTCTGTCTGCAGG + Intergenic
989766757 5:45095117-45095139 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
994198118 5:96942090-96942112 GGCAAATGTTTTCTATCTCTTGG - Intronic
995911392 5:117191853-117191875 GGCTAATGGTTTCTATAAGCAGG + Intergenic
997343218 5:133163206-133163228 CGAAAATGGTTTCTCTCTCCGGG + Intergenic
998136143 5:139675746-139675768 GGCAAATAGTTTCTGTCTCCCGG + Intronic
999869604 5:155735552-155735574 TGCCAGTGGTTTCTGGCTGCTGG + Intergenic
1001333290 5:170777455-170777477 GGCAAATGGGTCCTGACTGGAGG - Intronic
1004760500 6:18660599-18660621 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1005770086 6:29060559-29060581 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
1006895093 6:37463119-37463141 GGCAACTGGGTTTGGTCTGCTGG + Intronic
1007858530 6:44883088-44883110 GTCAAATTGTCTCTGTTTGCAGG + Intronic
1008956952 6:57226116-57226138 GGCAGATGGTTTGTGTCCTCTGG + Intergenic
1008977224 6:57441769-57441791 TGCAAATAATTTCTGTCTGGTGG - Intronic
1009505441 6:64471295-64471317 GTCAAATTGTCTCTGTTTGCAGG + Intronic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1014356810 6:120421973-120421995 AGCCAGTGGTTTCTGGCTGCTGG - Intergenic
1016080422 6:139848543-139848565 GGATAATGGTTTGTGTCTTCGGG + Intergenic
1016734350 6:147460326-147460348 GCCAAATTGTCTCTGTTTGCAGG + Intergenic
1021293777 7:18878457-18878479 GAGAAATGGTTTCTGTCTCAAGG - Intronic
1021659770 7:22908394-22908416 GCCAAATCGTGTCTGTGTGCTGG - Intergenic
1024808464 7:53178431-53178453 GGGAAATGTTTTCTGTTTTCTGG - Intergenic
1025647571 7:63433258-63433280 GGTGGTTGGTTTCTGTCTGCAGG - Intergenic
1031613371 7:123853171-123853193 GTCAAATTGTCTCTGTTTGCAGG - Intronic
1032234196 7:130105710-130105732 GTCAAAGGGTTTCTGGGTGCTGG + Intronic
1032432679 7:131874614-131874636 GGCCACTGGTTACTGTCTACAGG - Intergenic
1033200668 7:139366666-139366688 GGTAAATGTTTTCGGTTTGCGGG - Intronic
1033800909 7:144900991-144901013 GTGAAATTGTCTCTGTCTGCAGG - Intergenic
1034382713 7:150712472-150712494 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1034934815 7:155192011-155192033 TGCAAATGATTTCAGTCTGGTGG + Intergenic
1036784746 8:11678686-11678708 AGCAAATGTTTTGTTTCTGCTGG + Intronic
1037669528 8:21002196-21002218 GGCAAAGGGTTTCCAACTGCAGG - Intergenic
1040511951 8:48104008-48104030 GGAAAATGGGTTGTGTCTGGAGG - Intergenic
1040520868 8:48174902-48174924 GACAAATGGTTTCTGTCTACTGG - Intergenic
1041366305 8:57109076-57109098 GTCAAATTGTTTCTGTTTGCAGG + Intergenic
1042111324 8:65384147-65384169 GTCAAATGGTCTCTGTTTGCAGG + Intergenic
1042349742 8:67765072-67765094 GGAAAATGCTTTCTATATGCTGG + Intergenic
1042356576 8:67835018-67835040 GGCACACGGTCTCTGTGTGCAGG - Intergenic
1042461004 8:69068456-69068478 GGTAATTGGTTTCGGTGTGCTGG - Intergenic
1042622334 8:70720237-70720259 GTCAAATTGTCTCTGTTTGCAGG - Intronic
1042725846 8:71876021-71876043 GCCAAATTGTCTCTGTTTGCAGG - Intronic
1043367881 8:79556566-79556588 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
1043503389 8:80878017-80878039 GGAGAATGGATTCTATCTGCAGG - Intergenic
1044204328 8:89474599-89474621 GGCCCAGGGTGTCTGTCTGCTGG + Intergenic
1044405624 8:91822687-91822709 GTCAAATTGTTTCTGTTTGCAGG + Intergenic
1044544531 8:93444859-93444881 GGCAAAAGGATTCTGTTGGCTGG - Intergenic
1044632601 8:94293714-94293736 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1044852327 8:96441192-96441214 GGTAAATGGTTGCTGTTAGCAGG + Intergenic
1046106852 8:109676339-109676361 GTCAAATTGTCTCTGTTTGCAGG + Intronic
1046475039 8:114731137-114731159 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
1046992597 8:120476458-120476480 GTCAAATTGTCTCTGTTTGCAGG + Intronic
1048105198 8:131400433-131400455 GTCAAATGGTATCTGTCTTTAGG + Intergenic
1048773162 8:137917371-137917393 GGCAGATGATTTTTGTCTGAGGG - Intergenic
1050364003 9:4857214-4857236 GGCACAGGGTTTCTTTCTGGGGG - Intronic
1052322079 9:27178702-27178724 GGCAAATGGATTCTGTTAACTGG - Intronic
1057304656 9:93905094-93905116 GGCAAAGGCTATATGTCTGCTGG - Intergenic
1186367961 X:8915255-8915277 AGCAAGTGGCTTCTGACTGCAGG + Intergenic
1188128712 X:26403426-26403448 GGCAAATTCTTTCTGGCTGTTGG + Intergenic
1190833680 X:54081333-54081355 TGCAAGTGGTTTCTGTCGGTGGG - Exonic
1191121323 X:56908778-56908800 GTCAAATCGTGTCTGTTTGCAGG - Intergenic
1191731801 X:64344185-64344207 GGCAAAAGATTTCCCTCTGCTGG - Intronic
1192396265 X:70784532-70784554 GTCAAATTGTCTCTGTTTGCAGG + Intronic
1193019549 X:76776711-76776733 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
1194228801 X:91296451-91296473 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
1194476791 X:94368827-94368849 GGCAAAAGGTTTGGGACTGCTGG - Intergenic
1194967196 X:100302114-100302136 GGCACATGGCTTCTATCTTCAGG - Intronic
1197208842 X:123813023-123813045 TGCAAATGATTTCTGTCTGGTGG - Intergenic
1197817315 X:130511679-130511701 GGCAAAAGGATTTTGTCTTCTGG + Intergenic
1199003995 X:142674452-142674474 GTCAAATTGTCTCTGTTTGCAGG - Intergenic
1199401854 X:147407578-147407600 GTCAAATTGTCTCTGTTTGCAGG + Intergenic
1201353830 Y:13075948-13075970 GTCAAATTGTTCCTGTTTGCAGG + Intergenic
1201689653 Y:16748968-16748990 GTCAAATAGTCTCTGTTTGCAGG - Intergenic