ID: 961151667

View in Genome Browser
Species Human (GRCh38)
Location 3:124643470-124643492
Sequence TTAAGGATTTTGTTGTTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 2, 2: 7, 3: 77, 4: 575}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961151664_961151667 23 Left 961151664 3:124643424-124643446 CCTAGGAATTACTTAGATCTCAT 0: 1
1: 0
2: 2
3: 9
4: 145
Right 961151667 3:124643470-124643492 TTAAGGATTTTGTTGTTGTTCGG 0: 1
1: 2
2: 7
3: 77
4: 575
961151666_961151667 -9 Left 961151666 3:124643456-124643478 CCAGAGAATATTACTTAAGGATT 0: 1
1: 0
2: 0
3: 18
4: 187
Right 961151667 3:124643470-124643492 TTAAGGATTTTGTTGTTGTTCGG 0: 1
1: 2
2: 7
3: 77
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961151667 Original CRISPR TTAAGGATTTTGTTGTTGTT CGG Intronic
900378383 1:2371208-2371230 TTGTGGTTGTTGTTGTTGTTTGG - Intronic
901257314 1:7841282-7841304 TTAATGATTTTTTTTTTTTTTGG + Intronic
901478570 1:9507800-9507822 GTAAGGGTTTTGTTGTGATTAGG + Intergenic
902350627 1:15851225-15851247 TTAAGGATTTGGTCTTTCTTTGG - Intronic
904102666 1:28045799-28045821 TTATGGACTTGGATGTTGTTGGG - Intronic
905330223 1:37189553-37189575 TTAGGGATTTTCTTGTTTTATGG + Intergenic
906180788 1:43816972-43816994 TTAAGGATTCTGCTTTTGGTGGG + Intronic
906552639 1:46678393-46678415 GTAAGGGTTGTTTTGTTGTTAGG + Exonic
906814361 1:48862809-48862831 TTAAGGATTTTTTCTTTGTTTGG - Intronic
906902579 1:49852130-49852152 TTGAGATATTTGTTGTTGTTAGG - Intronic
909313953 1:74191251-74191273 TGAAGTAATTTGTTGTTGGTAGG + Intronic
909962596 1:81865002-81865024 GTAAGGTTTTTTTTGTTTTTTGG - Intronic
910732218 1:90410582-90410604 TCAAGTGTTTTCTTGTTGTTAGG + Intergenic
911087715 1:93992997-93993019 AGAAGGATTTTGTATTTGTTTGG + Exonic
911330786 1:96523469-96523491 TTAAGAATTTTGTAGTTGGCAGG - Intergenic
911626429 1:100130257-100130279 TGTTGGCTTTTGTTGTTGTTGGG + Intronic
911825058 1:102472714-102472736 TTGAGGATGCTGTTGTTTTTGGG + Intergenic
912190298 1:107330796-107330818 TTGAGGATTTTTTTGTTCATAGG + Intronic
912785363 1:112598092-112598114 TTAAATATTTTGTTGTGTTTTGG - Intronic
912834677 1:112985745-112985767 TTAAGACTTTTGATGTTATTGGG - Intergenic
912889113 1:113509173-113509195 TAAACGATTTTGTTGTTATTTGG - Intronic
913262593 1:117013243-117013265 CTAAGGATTTTGTTTTTTTTGGG + Intronic
914257643 1:145973743-145973765 TAAATTGTTTTGTTGTTGTTTGG - Intronic
914265129 1:146032067-146032089 TTAAGTGTTTTGCTGTTGTTTGG + Intergenic
915191793 1:154157061-154157083 TTTTTGTTTTTGTTGTTGTTTGG + Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916821129 1:168399894-168399916 TTAAAGATTTTTTTTTTCTTTGG - Intergenic
916895622 1:169159075-169159097 TTATGATTTTTGTTGTTGCTGGG - Intronic
917111215 1:171550176-171550198 TAAACGTTTTTGTTGTTTTTTGG - Exonic
917114098 1:171584574-171584596 TTATTGCTTTTGTTATTGTTTGG + Intronic
917206483 1:172578276-172578298 TTAATGAAATTGTTGTTGATAGG + Exonic
917264837 1:173210053-173210075 TTGAGGGTTTTGTTGTTGTTTGG + Intergenic
917359890 1:174163626-174163648 TAAAGAATTGTGTTGTTGTTGGG - Intronic
917907985 1:179608201-179608223 TTCAGGATTTTCTCTTTGTTTGG + Intronic
918178270 1:182064333-182064355 TTGATGATTTTGTTGTTTTTAGG + Intergenic
918604721 1:186409497-186409519 ATCAGCATTTTGTTGTTCTTTGG - Intronic
918616650 1:186551522-186551544 TTAATTATTTTTTAGTTGTTTGG + Intergenic
918812972 1:189144065-189144087 TTAAGTATTTTCTGGTTGTTTGG - Intergenic
919290351 1:195622625-195622647 TTAAGGTTTTTGATGTGGTTTGG + Intergenic
919340397 1:196299476-196299498 TTGAGCATTTTGTTGTTTTGGGG - Intronic
919367566 1:196683486-196683508 TTAAGGATTTTGGTTTTGAAGGG + Intronic
920568253 1:206994026-206994048 TTAATTACTTTGATGTTGTTGGG - Intergenic
921034405 1:211362702-211362724 AAAGGGCTTTTGTTGTTGTTGGG - Intronic
921045219 1:211471894-211471916 TTCCTGTTTTTGTTGTTGTTTGG - Intergenic
921172737 1:212563634-212563656 TTTTGATTTTTGTTGTTGTTTGG - Intergenic
921727278 1:218537440-218537462 TGAAGGATTTTGCGTTTGTTTGG + Intergenic
921784342 1:219210510-219210532 TTAAGTATGTTTTTGTTTTTAGG + Exonic
921974640 1:221189222-221189244 TTAAGCTATTTGTTGTTGTCTGG - Intergenic
922010527 1:221579870-221579892 TTGTGCATTCTGTTGTTGTTAGG - Intergenic
923185082 1:231563985-231564007 TTGAGGATTCTGTTTTTGCTGGG + Intronic
923616891 1:235545652-235545674 TTAATGCTTTTGTTGATGTGTGG - Intergenic
1064219335 10:13427040-13427062 TTGAGCATTTTTTCGTTGTTGGG - Intergenic
1064258335 10:13764535-13764557 TTAGTGAGTTTGTTGTTGTTAGG - Intronic
1064504290 10:16012600-16012622 GGAGGGGTTTTGTTGTTGTTTGG - Intergenic
1064597465 10:16960513-16960535 TTAAGCTTTTTGTTTTTGTGGGG - Intronic
1065508303 10:26452176-26452198 TTAAGGTTTTATTTGTTTTTAGG - Intronic
1067537510 10:47124669-47124691 TTAAGGCTTTTGGGGCTGTTGGG + Intergenic
1067670668 10:48318090-48318112 TTAAGGCATTTGTTTTTGTGAGG + Intronic
1067761609 10:49052427-49052449 TTTAGGATTTTTTTTTTTTTTGG + Intronic
1068223814 10:54080163-54080185 TTTAGTATTTTGTTATTCTTTGG + Intronic
1068420827 10:56790082-56790104 TTTAGGATTTTGTTTTAATTTGG - Intergenic
1068499855 10:57830949-57830971 TTAAGGAATTTATTGCTGTTTGG + Intergenic
1068531595 10:58194268-58194290 ATATGGATTTTGTTGTTATTTGG - Exonic
1068752368 10:60609840-60609862 TTAAGGATCATATTTTTGTTAGG - Intronic
1069268457 10:66493546-66493568 TTAATTTTTTTGTTGTTGTTGGG + Intronic
1070472302 10:76794164-76794186 AAAATTATTTTGTTGTTGTTTGG + Intergenic
1070677964 10:78426518-78426540 ATACGTATTTTGTTGTTGTTGGG + Intergenic
1070993735 10:80756305-80756327 TTGATGTTTTTGTTGTTGTTAGG - Intergenic
1071028018 10:81138958-81138980 CTGTGTATTTTGTTGTTGTTGGG - Intergenic
1071088483 10:81891987-81892009 ATGAAGATTTTGTTTTTGTTTGG + Intronic
1072007190 10:91263681-91263703 TTAAAGATTTAGGGGTTGTTCGG + Intronic
1072139982 10:92581000-92581022 TGAAGTGTTTTGTTCTTGTTTGG - Intergenic
1072177213 10:92939143-92939165 GTAAGCATTTTGTAGTTTTTAGG + Intronic
1072262195 10:93689369-93689391 TGGAGGATTTTATTTTTGTTGGG - Intronic
1072382113 10:94883736-94883758 CTGGGGTTTTTGTTGTTGTTGGG - Intergenic
1072395560 10:95036389-95036411 CCAAGGATTTTGTTCTTGTTTGG - Intergenic
1072775183 10:98184089-98184111 TTGAGGGTTTTGTTATTGCTAGG + Intronic
1072934904 10:99702801-99702823 TAAAGGAGTTTGTTTTTGTGAGG - Intronic
1073039535 10:100593128-100593150 TCAATTTTTTTGTTGTTGTTTGG - Intergenic
1073847191 10:107569925-107569947 TTCTGTGTTTTGTTGTTGTTAGG - Intergenic
1073925693 10:108512575-108512597 TTGTTGTTTTTGTTGTTGTTTGG + Intergenic
1074071139 10:110070962-110070984 TTTAGTTTTTTGTTGTTTTTGGG + Intronic
1074221053 10:111438355-111438377 GAAAGGATTTTGTTATTGATTGG + Intergenic
1074500970 10:114024569-114024591 TTAAGGATTTTTTTTTTTTGAGG - Intergenic
1074926312 10:118075927-118075949 TTAAGCATTTTTTTTTTTTTTGG + Intergenic
1075042316 10:119118009-119118031 TTGGGGATTTTGTTGTTGGAAGG - Intronic
1075211109 10:120491830-120491852 TGTTGGGTTTTGTTGTTGTTGGG - Intronic
1076286025 10:129297098-129297120 TTAATGATGTTGTGGTTATTGGG - Intergenic
1076403630 10:130198271-130198293 TTAAGAATTTTGTTGCAGGTTGG + Intergenic
1077513166 11:2982720-2982742 TTAAAGATTCTGTTGCTGCTAGG + Intronic
1079068470 11:17320367-17320389 GTTTAGATTTTGTTGTTGTTGGG + Intronic
1080266721 11:30408882-30408904 TTGAATATTTTGTTGTTGTAAGG + Intronic
1081196798 11:40171178-40171200 TTTAGGAATTTTTTATTGTTTGG + Intronic
1081550847 11:44110505-44110527 TTATGGATTTGGTTGTTCTGGGG + Intronic
1082013145 11:47464378-47464400 TTAAGAATTTTGTTTTACTTTGG - Intergenic
1082042666 11:47698988-47699010 ATGAGTATTTTGTTGTTGTTAGG + Intronic
1082697700 11:56389998-56390020 TTATGGATTGTGATGTTCTTGGG - Intergenic
1082869516 11:57931189-57931211 TTAAAGAATTTGTTTTTTTTGGG + Intergenic
1085573164 11:77577382-77577404 TTTCTGTTTTTGTTGTTGTTTGG + Intronic
1085800379 11:79584070-79584092 TAAAGGATTTTGTGGTGTTTAGG + Intergenic
1086176861 11:83901265-83901287 TTAAGAATTTGGGGGTTGTTGGG + Intronic
1087002720 11:93436792-93436814 TTAAGTAATTTTTTTTTGTTGGG - Intronic
1087864572 11:103208000-103208022 TTCAGGATTTTGATGTTGGAAGG + Intronic
1087869897 11:103279814-103279836 TGAAGGAATTATTTGTTGTTTGG + Intronic
1088542991 11:110932581-110932603 ATAAGGATTTTTTTTTTATTTGG + Intergenic
1088622010 11:111694603-111694625 TTAAGTATTTTATTTTTATTGGG + Intronic
1088855353 11:113745742-113745764 TTGTGTTTTTTGTTGTTGTTTGG - Intronic
1089187454 11:116629089-116629111 TTAAGAATTTTGTGAATGTTGGG - Intergenic
1090427648 11:126619963-126619985 TTAAGGAGTTTGATTTTGTAAGG - Intronic
1090684733 11:129102507-129102529 TTTTTGTTTTTGTTGTTGTTAGG - Intronic
1090712771 11:129402839-129402861 CCAGGGTTTTTGTTGTTGTTTGG - Intronic
1091859395 12:3766212-3766234 TTCAGGATTTTCTTGGTCTTTGG - Intergenic
1092808480 12:12249869-12249891 TGAGGGATTTTGTTGTTTTGGGG - Intronic
1093286687 12:17272376-17272398 TTGGGGGTTTTGTTGTTTTTTGG + Intergenic
1093350032 12:18087708-18087730 TGAGGGCTTTTGTTGTTATTTGG + Intronic
1093480822 12:19602136-19602158 TTAAGACTTTTGGTGCTGTTGGG + Intronic
1093552279 12:20428222-20428244 TTCAGGATTTTGATGTTTTGGGG - Intronic
1095857031 12:46871554-46871576 TTAACTTTTTTGTTGATGTTAGG + Intergenic
1095877068 12:47090831-47090853 TTAACTATTTTGTTGTTCATGGG + Intronic
1096057614 12:48667590-48667612 TGAAGGATTTTGTTTTCCTTTGG - Intronic
1096339690 12:50787030-50787052 GTTTGGATTTTGTTGTTGTTTGG - Intronic
1096562128 12:52443359-52443381 TTATTGTTGTTGTTGTTGTTAGG - Intergenic
1096665813 12:53163578-53163600 TTAAGTATTTTATTCTTTTTTGG - Intronic
1096679256 12:53244088-53244110 GTTAGTTTTTTGTTGTTGTTTGG + Intergenic
1097451136 12:59738321-59738343 TGAAGAATTATGTTTTTGTTAGG - Intronic
1097513611 12:60574525-60574547 TTTAAGACTTTGTTTTTGTTAGG - Intergenic
1097521779 12:60679408-60679430 ATAGGGGTTGTGTTGTTGTTGGG + Intergenic
1097526441 12:60741992-60742014 TTAATGATCTGTTTGTTGTTTGG + Intergenic
1097724610 12:63060656-63060678 TTATCGCTTTTGTTTTTGTTTGG - Intergenic
1097872601 12:64613547-64613569 ATAAGGTTTTTGTTACTGTTGGG - Intronic
1097900386 12:64867148-64867170 TTAATGTTGTTGTTGTTGTTTGG - Intronic
1098693160 12:73515531-73515553 ATATGTATTTTGCTGTTGTTAGG + Intergenic
1099230030 12:80013242-80013264 TTGAGGATTTCTTTTTTGTTAGG + Intergenic
1099367581 12:81787694-81787716 TAGAGGATTTTTTTGTTTTTAGG + Intergenic
1099946136 12:89246400-89246422 CTAAGGTATTTGTTGTTATTGGG + Intergenic
1100100200 12:91094139-91094161 TTAACTCTTTTATTGTTGTTAGG - Intergenic
1100306042 12:93351186-93351208 CTTAGGGTTTTGTTATTGTTTGG - Intergenic
1100880682 12:99013147-99013169 TTAATGACTGTGTTATTGTTAGG - Intronic
1101033610 12:100683930-100683952 ACATGGATTTTGTTGTTATTAGG - Intergenic
1101184361 12:102258535-102258557 TTATGTATTCTGTAGTTGTTTGG + Intergenic
1101844016 12:108347128-108347150 CTAAGGATTTTGATATGGTTTGG - Intergenic
1102803158 12:115755125-115755147 AAAAGGATTTTTTTGTTGTATGG + Intergenic
1103602092 12:122060654-122060676 TCATGGGTTTTGTTGTTTTTGGG + Exonic
1103694803 12:122806113-122806135 TTAAGATATTTGTTTTTGTTGGG + Intronic
1104505996 12:129332941-129332963 TTAAGTATTTTCTCATTGTTGGG - Intronic
1105412903 13:20186201-20186223 TTTTTGATGTTGTTGTTGTTTGG + Intergenic
1106687906 13:32081175-32081197 TTAAAAATTTTTTTCTTGTTTGG - Intronic
1107139557 13:36983114-36983136 TAAATGATTTTGCTGATGTTAGG - Intronic
1107669450 13:42729114-42729136 TTGAGGATATTGTGTTTGTTAGG - Intergenic
1107677412 13:42811344-42811366 TGAAGGAGTTTGTTGTTGTTTGG + Intergenic
1107747464 13:43525827-43525849 CTTGGGTTTTTGTTGTTGTTGGG + Intronic
1108716699 13:53086382-53086404 TTGGGATTTTTGTTGTTGTTTGG - Intergenic
1108994623 13:56712490-56712512 TTAATGATTCTGTGATTGTTTGG + Intergenic
1110160611 13:72373819-72373841 TTCTCCATTTTGTTGTTGTTTGG + Intergenic
1110607992 13:77455816-77455838 ATATGTATTTTGTAGTTGTTGGG - Intergenic
1111908660 13:94285315-94285337 TTGAGCATTTTATTGTGGTTGGG + Intronic
1112270881 13:97968537-97968559 TTATGTATTTTGGTGCTGTTAGG + Intronic
1112527805 13:100168918-100168940 TGAGGGTTTTTATTGTTGTTGGG + Intronic
1112843101 13:103604516-103604538 TTTAGGATTTTGATGTTTTCTGG - Intergenic
1112843110 13:103604740-103604762 GTGTGTATTTTGTTGTTGTTGGG - Intergenic
1113126728 13:106987474-106987496 CTGGGGAATTTGTTGTTGTTGGG + Intergenic
1113273689 13:108704366-108704388 TTAAGAATTTCGTTTTTGCTGGG + Intronic
1114740079 14:25087798-25087820 TTTGGTTTTTTGTTGTTGTTTGG - Intergenic
1114876818 14:26730756-26730778 TTACAGAATTTGTTGATGTTAGG + Intergenic
1115079042 14:29428461-29428483 TTAAGTATTTTGTAGGTGTCTGG - Intergenic
1115657719 14:35459693-35459715 TTTTGGATTTTGTTGTGGTAGGG + Intergenic
1115737151 14:36345265-36345287 TTAAAGATTTTGTAAGTGTTTGG + Intergenic
1116071760 14:40055894-40055916 TTAAGGGTTTTTTTTTTTTTTGG - Intergenic
1116805792 14:49492974-49492996 TTAATTATTTTTTTGTTTTTGGG - Intergenic
1117880475 14:60308568-60308590 TTAAGTATTGTCTTGGTGTTTGG - Intergenic
1118101622 14:62611665-62611687 TTATGTATTTTGTAGGTGTTGGG - Intergenic
1118624138 14:67641943-67641965 TTAACCATTTTTTTATTGTTGGG + Intronic
1119052982 14:71388939-71388961 TTTTAGTTTTTGTTGTTGTTTGG + Intronic
1119593358 14:75910977-75910999 TGCAGGGTTTTTTTGTTGTTGGG + Intronic
1120544691 14:85796424-85796446 TGAAACACTTTGTTGTTGTTTGG - Intergenic
1120688445 14:87565399-87565421 TCAAGTATTTTGTTGTTGACTGG - Intergenic
1121062719 14:90930674-90930696 TTGTGGGTTTTGTTGTTTTTAGG - Intronic
1122463410 14:101915040-101915062 TGAAGGTTTTTGTTTTGGTTTGG + Intronic
1123465945 15:20515770-20515792 ATATGTATTTTGCTGTTGTTGGG + Intergenic
1123652169 15:22485269-22485291 ATATGTATTTTGCTGTTGTTGGG - Intergenic
1123742592 15:23294129-23294151 ATATGTATTTTGCTGTTGTTGGG - Intergenic
1123760733 15:23430357-23430379 ATATGTATTTTGCTGTTGTTGGG + Intergenic
1124127872 15:26954138-26954160 TGTTGTATTTTGTTGTTGTTGGG - Intergenic
1124160546 15:27264664-27264686 TTTACTTTTTTGTTGTTGTTTGG - Intronic
1124268367 15:28257721-28257743 ATATGTATTTTGTTGTTGTTGGG - Intronic
1124276668 15:28331746-28331768 ATATGTATTTTGCTGTTGTTGGG + Intergenic
1124306032 15:28579860-28579882 ATATGTATTTTGCTGTTGTTGGG - Intergenic
1125081015 15:35673227-35673249 CTAAGGATTTTCTTGTCGTGTGG - Intergenic
1125158323 15:36614758-36614780 TTTTTGTTTTTGTTGTTGTTTGG - Intronic
1125245640 15:37634907-37634929 TTAAGGATATTTTCTTTGTTAGG - Intergenic
1126154434 15:45552277-45552299 TTAAGTATCTTTTTGTTATTAGG - Intergenic
1126365351 15:47888325-47888347 TTAGCCATTTTATTGTTGTTGGG - Intergenic
1127460486 15:59194174-59194196 TTAAGGATTTTTTTTTTTTTTGG - Intronic
1128697184 15:69775696-69775718 ATATGCATTTTGTTATTGTTTGG + Intergenic
1129104171 15:73294518-73294540 TTAAGTTTTTTGTTTTTCTTTGG + Intronic
1129487011 15:75883777-75883799 TAAAGCATTATGTTGTTGATAGG + Intronic
1130266819 15:82413076-82413098 TAAAGCATTATGTTGTTGATAGG + Intergenic
1130385455 15:83407310-83407332 TTTATGTTGTTGTTGTTGTTTGG - Intergenic
1130505206 15:84533802-84533824 TAAAGCATTATGTTGTTGATAGG - Intergenic
1131585255 15:93685770-93685792 CTATAGTTTTTGTTGTTGTTAGG - Intergenic
1132264232 15:100453189-100453211 TGTAGTATTTTTTTGTTGTTGGG - Intronic
1133495200 16:6311336-6311358 TTTTGGGTTTTGTTCTTGTTAGG + Intronic
1133951861 16:10401731-10401753 TTATGGGCTTTTTTGTTGTTGGG + Intronic
1134514488 16:14875788-14875810 TTAATGATCTTTCTGTTGTTCGG + Intronic
1134702165 16:16274441-16274463 TTAATGATCTTTCTGTTGTTTGG + Intronic
1134969665 16:18520209-18520231 TTAATGATCTTTCTGTTGTTTGG - Intronic
1135201450 16:20440991-20441013 TTAATCATTTCCTTGTTGTTTGG - Exonic
1135217656 16:20586876-20586898 TTAATCATTTCCTTGTTGTTTGG + Intergenic
1136675206 16:31897927-31897949 TTGTGTATTTTGCTGTTGTTGGG + Intronic
1137424877 16:48369860-48369882 TTAAGGATTCAGGTGTAGTTAGG - Intronic
1137752063 16:50871636-50871658 TTCAGGATTTTCTGGTTATTCGG + Intergenic
1137758873 16:50924655-50924677 TTAAGGATTTTGTAGTGGGCCGG - Intergenic
1137938295 16:52656606-52656628 TTTTTGTTTTTGTTGTTGTTGGG - Intergenic
1137949067 16:52764771-52764793 TTAAGGCTGTTGTAGTTGTAAGG - Intergenic
1138730432 16:59188114-59188136 TTATGGGTTTTGTTGTTGTGTGG + Intergenic
1138896166 16:61207256-61207278 TTAAGTATTTTGGGGCTGTTGGG + Intergenic
1139081043 16:63521778-63521800 TTAAGGGTTTTCTTTTTCTTAGG - Intergenic
1139363229 16:66416449-66416471 ATCATGATTTTGTTGTTGTTAGG - Intergenic
1139687043 16:68612007-68612029 ATATCTATTTTGTTGTTGTTGGG + Intergenic
1139868905 16:70087710-70087732 TTTTGTTTTTTGTTGTTGTTTGG - Intergenic
1139898328 16:70306679-70306701 TGCAGGAATTTGTTGTTGTAAGG - Intronic
1140076342 16:71702439-71702461 TCTTGGCTTTTGTTGTTGTTTGG + Intronic
1140092288 16:71848540-71848562 TTTAGAATTTTGTTGTTCTTTGG + Intronic
1140340081 16:74149433-74149455 TTAATGATTTTGTTATTGCTTGG + Intergenic
1144514276 17:15905265-15905287 TTAGTTGTTTTGTTGTTGTTGGG + Intergenic
1146384574 17:32358481-32358503 TAATGGAAATTGTTGTTGTTAGG + Exonic
1146483595 17:33225496-33225518 TTAATGATTTTGTATTTGTGGGG - Intronic
1146557341 17:33837380-33837402 TTATGGATTTTGTGAGTGTTAGG - Intronic
1147355155 17:39889832-39889854 GTAAGTTTTTTGTTGTTGTTGGG + Intergenic
1147587612 17:41661371-41661393 TTAAACATTTTCTTGTTGTTGGG - Intergenic
1147812849 17:43185533-43185555 CTAAGGTTTTTGTTTTAGTTTGG - Intronic
1147837086 17:43341205-43341227 TTAATGATTTTTCTGTTGATGGG + Intergenic
1148022164 17:44560409-44560431 TGTGGGTTTTTGTTGTTGTTTGG + Intergenic
1148508638 17:48148852-48148874 TTAAGGTTATTGAGGTTGTTTGG + Intronic
1149047181 17:52260501-52260523 TTTTGTTTTTTGTTGTTGTTGGG + Intergenic
1149874625 17:60219188-60219210 TTAAGGTTTTTGTTGTTGTTTGG - Intronic
1150059741 17:62056147-62056169 TGAAGGTTTTTGGTTTTGTTGGG + Intronic
1150088414 17:62296439-62296461 TTAAGGTTTTTGTTGTTGTTTGG - Intergenic
1150385458 17:64755916-64755938 TAAAACATTTTTTTGTTGTTGGG - Intergenic
1150992363 17:70274344-70274366 TGAAAGGTTTTGTTGTTGGTAGG + Intergenic
1151046303 17:70923574-70923596 TAGAGGTTTTTGTTTTTGTTTGG + Intergenic
1151132732 17:71915024-71915046 TTAAGTACTTTGTTGATGTTGGG + Intergenic
1151162457 17:72176780-72176802 TTGAGGCTTTTGTTGGTGTTAGG - Intergenic
1152848743 17:82618767-82618789 TGATGGTTTTTGTTGTTGGTGGG - Intronic
1153467249 18:5402179-5402201 TAGAGATTTTTGTTGTTGTTGGG - Intronic
1153540908 18:6153603-6153625 TTAGGGATTTTGATATGGTTTGG + Intronic
1154318797 18:13327593-13327615 TTAAGGATTTTGGTGTTAAATGG + Intronic
1154393165 18:13960830-13960852 TTCAGCTTTTTGTTGTTGTAAGG + Intergenic
1155108752 18:22693100-22693122 TTAAGGATATTCCTGATGTTAGG - Intergenic
1155478229 18:26257051-26257073 TTAAGAATGCTATTGTTGTTAGG + Intronic
1155930964 18:31708221-31708243 TTAATGAATTTGTTGTTGACAGG + Intergenic
1156055125 18:32993179-32993201 TTAAGGATTTTGTTCTTCTGAGG + Intronic
1156068993 18:33181827-33181849 TTCCCTATTTTGTTGTTGTTAGG - Intronic
1157038686 18:44010429-44010451 TTTTGAATTTTTTTGTTGTTAGG + Intergenic
1157345803 18:46831752-46831774 ACAAGGGTTTTGTTTTTGTTTGG - Intronic
1158181528 18:54721023-54721045 TTATGTATTTTGTTGGAGTTTGG + Intronic
1158259905 18:55595057-55595079 TTAAGGGTTTTGTCATTTTTTGG - Intronic
1158295100 18:55987772-55987794 TTATGGATTTTTTTTTTTTTTGG + Intergenic
1158420962 18:57293583-57293605 TAAAAGATTTAGTAGTTGTTGGG - Intergenic
1158650924 18:59284914-59284936 TTTTGGTTGTTGTTGTTGTTGGG - Intronic
1158958129 18:62561789-62561811 TTTAAGGTTTTGTTGTTGTCTGG + Intronic
1159157557 18:64604102-64604124 TTAAGGACTTAGTTGATGCTAGG + Intergenic
1159181443 18:64911599-64911621 GGAAGAATTTTGTTGTTGTTTGG - Intergenic
1160068854 18:75606784-75606806 TTAAAGATTTTTTTTTTTTTTGG + Intergenic
1160552801 18:79705762-79705784 CTTAGTCTTTTGTTGTTGTTGGG + Intronic
1160706660 19:533017-533039 TGGATGTTTTTGTTGTTGTTGGG + Intronic
1164077188 19:21830446-21830468 ATAATTATTTTGTTGTTGTTGGG - Intronic
1164682551 19:30145319-30145341 TTAATTGTTTTGTTGTTGATGGG + Intergenic
1167782667 19:51609907-51609929 TAAGTAATTTTGTTGTTGTTTGG + Intergenic
925318706 2:2944572-2944594 CTTTGGATTTTGTTGTTGATAGG - Intergenic
925470626 2:4157411-4157433 TAGAGAATTTTATTGTTGTTGGG + Intergenic
925753108 2:7107680-7107702 TTAAGGAATTTTTTATTGTTAGG - Intergenic
925873464 2:8291665-8291687 TTAATCATTTTCCTGTTGTTAGG - Intergenic
926043844 2:9695172-9695194 TTACTGATTTTTTTGTTGTTTGG + Intergenic
926501731 2:13663021-13663043 TGAAGGAATTTATTTTTGTTTGG + Intergenic
926654963 2:15392531-15392553 TTAAGTATTTTATTCTTGTTTGG - Intronic
926939230 2:18117547-18117569 TTTAGGATTTCGTTGCTGTCTGG + Intronic
927061059 2:19420019-19420041 GTATGTATTTTGTTGATGTTTGG - Intergenic
927115394 2:19895840-19895862 TTTTGTATTTTATTGTTGTTTGG - Intergenic
927588061 2:24327997-24328019 TTATGGATTTTTTTTTTTTTTGG - Intronic
928552053 2:32382358-32382380 TTCAGCATTTTGTTTTGGTTTGG - Intronic
929166437 2:38886637-38886659 TTAAGGTTTTTTTAATTGTTGGG - Intronic
929497685 2:42460469-42460491 TTAAGGATTGGATTGTTGTTAGG - Intronic
930042469 2:47138388-47138410 TTAAGGTTTTTTTTTTTTTTTGG + Intronic
930570967 2:53086640-53086662 TTAAGTTTTTTGTTTTGGTTTGG + Intergenic
930690992 2:54364343-54364365 TGATGGTTTTTGTTTTTGTTTGG - Intronic
931358526 2:61558160-61558182 TTATTATTTTTGTTGTTGTTTGG + Intergenic
932136636 2:69236743-69236765 TTAAGAATTTCTTTGTTGTTGGG - Intronic
933081879 2:77999813-77999835 TTCAGGAATTTATTGTGGTTTGG - Intergenic
933099282 2:78231312-78231334 TTAAGGATTTTTTTTTTAATAGG + Intergenic
933109384 2:78378493-78378515 ATAAGAATTTTGTTGGTGGTGGG + Intergenic
933349245 2:81132445-81132467 TTTGGGATTTTGTTTTTGGTGGG + Intergenic
933917154 2:87007153-87007175 TTGCTGGTTTTGTTGTTGTTGGG + Intronic
934005842 2:87762761-87762783 TTGCTGGTTTTGTTGTTGTTGGG - Intronic
934027852 2:88015954-88015976 ATATGGTTTTTGTTTTTGTTTGG - Intergenic
934377377 2:92845025-92845047 TTGAGGATTTCGTTGTTATCGGG + Intergenic
934428005 2:93660317-93660339 TTGAGGATTTCGTTGTTATCGGG + Intergenic
934445315 2:93939941-93939963 TTGAGGATTTCGTTGTTATCGGG + Intergenic
934880710 2:97974832-97974854 TGAAGGATTTTTTTGTAGTGTGG - Intronic
935768795 2:106396861-106396883 TTGCTGGTTTTGTTGTTGTTGGG - Intronic
935911305 2:107899064-107899086 TTGCTGGTTTTGTTGTTGTTGGG + Intergenic
935969415 2:108515902-108515924 TTGCTGGTTTTGTTGTTGTTGGG + Intergenic
936115103 2:109695829-109695851 AAAAGGTTTTTTTTGTTGTTAGG + Intergenic
936133082 2:109864105-109864127 TTGCTGGTTTTGTTGTTGTTGGG + Intergenic
936211615 2:110507380-110507402 TTGCTGGTTTTGTTGTTGTTGGG - Intergenic
936277389 2:111112044-111112066 AAAGTGATTTTGTTGTTGTTTGG + Intronic
936368506 2:111883188-111883210 TTAAGGTTTTTTTTTTTGTGGGG - Intronic
936420753 2:112361957-112361979 TTGCTGGTTTTGTTGTTGTTGGG - Intergenic
936440772 2:112550835-112550857 TTTCTGATTTTTTTGTTGTTTGG + Intronic
936666415 2:114601861-114601883 TTAAGGGTTATCTTGTTGATTGG + Intronic
936707212 2:115088770-115088792 TTAAGGTTTTTTTTGTTTTTTGG - Intronic
936862552 2:117034618-117034640 TGAAGAATTCTGTTGTTTTTGGG - Intergenic
937567870 2:123317934-123317956 TGAAACATCTTGTTGTTGTTGGG + Intergenic
939088011 2:137744771-137744793 TTAAGGGCTCTGATGTTGTTTGG - Intergenic
939133307 2:138263623-138263645 TTAAAGATTTTTTTGGTTTTAGG + Intergenic
939297042 2:140280331-140280353 TAAAAGATTTTGTTGTTGTGGGG + Intronic
939675282 2:145064696-145064718 TTTAGGAATTTGTTGCTGGTTGG - Intergenic
940086026 2:149860133-149860155 TTTGGTATTTTGTTGTTGTTTGG + Intergenic
940295414 2:152117510-152117532 TTAGGGATTTGATTTTTGTTTGG - Exonic
941343072 2:164331023-164331045 CAAGGGTTTTTGTTGTTGTTGGG + Intergenic
941655190 2:168135981-168136003 TAAAGGATTTTTTTTTTTTTTGG + Intronic
941976473 2:171410435-171410457 TTATGTGTTTTGTTGTTGTTTGG - Intronic
942258522 2:174133127-174133149 CTAACTTTTTTGTTGTTGTTAGG + Intronic
942356500 2:175118340-175118362 TCAAGAATCTTGTTGGTGTTGGG + Exonic
942969796 2:181944301-181944323 TTAAGGTTGTTGTTGCTGTCTGG - Intergenic
944326233 2:198407639-198407661 TTAAGTTTCTTGTTGTTTTTGGG + Intronic
944752009 2:202718576-202718598 TTAAAAATTTTGTTGTTGGTTGG + Intronic
944821364 2:203435368-203435390 TTAAGGTTTTTTTTTTTTTTTGG - Exonic
945085391 2:206126862-206126884 TAAAGCTTTTTGTTGTTTTTGGG - Intronic
945449747 2:209979834-209979856 TAGAGCTTTTTGTTGTTGTTTGG - Intronic
945522280 2:210843687-210843709 CTAAGGATTTTGAGGTTGGTTGG + Intergenic
945531173 2:210954850-210954872 TTGTGCATTTTGTTGTTGTTGGG + Intergenic
945675415 2:212850236-212850258 TTTAGGATTTTTTGGTTGATAGG + Intergenic
947488326 2:230572588-230572610 TTCTTGTTTTTGTTGTTGTTTGG + Intergenic
947491119 2:230594821-230594843 TGAAGGAATTTATTTTTGTTTGG - Intergenic
1169503292 20:6182360-6182382 TGAAGGATTTTTTTTTTTTTTGG + Intergenic
1170219636 20:13928550-13928572 TTTAGAATTTTGTTGTTGATTGG - Intronic
1171099546 20:22370068-22370090 TTAAGGACTTTTGTGTTCTTTGG + Intergenic
1171100081 20:22374709-22374731 TTCACAAATTTGTTGTTGTTGGG - Intergenic
1171162231 20:22938160-22938182 TTAAGATTTTTGTTGTTGTTGGG + Intergenic
1171546489 20:26005931-26005953 TTGGCGATTTTGTTTTTGTTTGG - Intergenic
1171863251 20:30420657-30420679 GTAAGTATTTTATTGTTGGTGGG - Intergenic
1172406304 20:34692353-34692375 TTTATCTTTTTGTTGTTGTTGGG + Intergenic
1172677986 20:36688597-36688619 ATTAGAATATTGTTGTTGTTTGG + Intronic
1172726877 20:37051010-37051032 TTAAGTTTTTTTTTGTTTTTAGG + Intronic
1172988701 20:39015264-39015286 TTAAGGATGTGGTTGTTGGGTGG - Intronic
1173262583 20:41450148-41450170 TTAATGATTTTGTAGTTGTTGGG - Intronic
1173977460 20:47197766-47197788 TTAAGTATTTGGTATTTGTTTGG + Intergenic
1175365666 20:58453715-58453737 TTCAAGGTTTTTTTGTTGTTGGG + Intergenic
1177120690 21:17133360-17133382 TGAAGGAATTTGTTTTTATTTGG - Intergenic
1177360181 21:20058276-20058298 ATGTGTATTTTGTTGTTGTTTGG - Intergenic
1177776273 21:25570288-25570310 TTAATGATTATGTTTTTGATTGG + Intergenic
1177777037 21:25579705-25579727 TTCAGCATTTTTATGTTGTTAGG - Intergenic
1177885380 21:26740325-26740347 GTAAGAATTGTGTTGTTGGTAGG - Intergenic
1178693475 21:34770648-34770670 TTAAATGTTTTGTTGTTTTTAGG - Intergenic
1178787310 21:35665658-35665680 GTAAGATTTTTGTTGATGTTTGG - Intronic
1179164127 21:38922234-38922256 TTAAGGAGCGTTTTGTTGTTCGG + Intergenic
1179263626 21:39781860-39781882 TTAAGAATTCTTTTGATGTTAGG + Intronic
1181515445 22:23408903-23408925 TTAAGGTTTTTTTTTTTTTTTGG - Intergenic
1181620124 22:24085290-24085312 TTTAGCACTTTGCTGTTGTTAGG + Intronic
1184142988 22:42589969-42589991 ATATGTATTTTCTTGTTGTTAGG - Intronic
949694214 3:6675435-6675457 ATAAGAATTTTATTGTTGTAAGG - Intergenic
951009514 3:17660122-17660144 TTAGGTATTTTGTAGTTGCTTGG - Intronic
951090288 3:18564871-18564893 TTCAGTATTTTCTTGCTGTTTGG + Intergenic
951824806 3:26856813-26856835 TTAAGGATTTTTGTTTTGTTTGG - Intergenic
952570128 3:34703426-34703448 ATATGTATTTTGTTATTGTTCGG - Intergenic
952600319 3:35072257-35072279 TTTAGGATTTTTTTTTTTTTTGG + Intergenic
953528846 3:43719920-43719942 TTAGGGAATTTGTAGTTGTTAGG + Intronic
953615497 3:44487092-44487114 TTCAGGATTTTTTTGTTTTTTGG + Intergenic
953731237 3:45450089-45450111 TAGAGGGTTTTGTTGTTGTGGGG + Intronic
955262301 3:57405333-57405355 TTATATGTTTTGTTGTTGTTAGG + Intronic
955628558 3:60947458-60947480 TAAAAGATTTTGTTGTCATTTGG + Intronic
955762484 3:62302489-62302511 TTCAGGATTTTTTTTTTGTTTGG - Intergenic
955985700 3:64572221-64572243 TTCAGGCTTTTGTTTCTGTTGGG + Intronic
956107889 3:65840675-65840697 TTAAGGATTTTGGTGTGGGTGGG + Intronic
956554865 3:70508925-70508947 TTATGGGTTTTGTTGTTTTTTGG + Intergenic
957016929 3:75076928-75076950 TTAAGGATTATTTTGTCTTTAGG + Intergenic
957074660 3:75592399-75592421 ATAATGTTTTTGTTGTTCTTAGG + Intergenic
957368853 3:79264018-79264040 TTAAGTGTTTAGTTGTTGTCTGG - Intronic
957888046 3:86316367-86316389 TTAAGGCTTTTGGAGTTGTTAGG + Intergenic
957918557 3:86718106-86718128 TTAAGGATCTTGATATAGTTTGG + Intergenic
958859254 3:99425584-99425606 TTATGCATTTTTTGGTTGTTGGG - Intergenic
958889610 3:99768998-99769020 GAAAGGATTTTGTTGTTATTTGG + Intronic
959188849 3:103083455-103083477 TTGAAATTTTTGTTGTTGTTTGG + Intergenic
959494294 3:107031105-107031127 TTTTGGAATTTGCTGTTGTTTGG - Intergenic
959516978 3:107279095-107279117 TTATTGTTTTTGTTGTTTTTTGG - Intergenic
959603883 3:108221671-108221693 TTAAGGCTTTTTTTCTAGTTTGG - Intronic
959867662 3:111289773-111289795 TTTAGGATTCTGCAGTTGTTGGG + Intergenic
960209546 3:114944123-114944145 TTTAGTTTTTTGCTGTTGTTTGG - Intronic
960477645 3:118148766-118148788 TTAAAAATTTTGTTTTTGTTGGG + Intergenic
960516647 3:118608965-118608987 TTAGGGATTTTGTCTTGGTTTGG - Intergenic
961151667 3:124643470-124643492 TTAAGGATTTTGTTGTTGTTCGG + Intronic
961590132 3:127973155-127973177 TTAAGTATTTTGGTGGTGGTGGG - Intronic
962338210 3:134557305-134557327 TTAAAGTTTATGTTTTTGTTAGG + Intronic
963194576 3:142512118-142512140 TTATTGTTGTTGTTGTTGTTTGG - Intronic
963331196 3:143918161-143918183 TTTAGGTTTTCGTTGTTGTCGGG + Intergenic
965014887 3:163145225-163145247 TTAAGGTTTTTTTTGTTTTTTGG + Intergenic
965126089 3:164631463-164631485 TGAAGAAGTTTTTTGTTGTTTGG + Intergenic
965215289 3:165855754-165855776 TTATGCTTTTTATTGTTGTTTGG - Intergenic
965387565 3:168063153-168063175 TTAAGTAGTTTGGTGGTGTTGGG - Intronic
965877114 3:173338164-173338186 TTAAATATTTTGTTGTTTTTTGG - Intergenic
967219042 3:187234051-187234073 TTATGGGTTTTGTTATTGTTGGG - Intronic
967374835 3:188789076-188789098 GTGAGTCTTTTGTTGTTGTTGGG + Intronic
968496077 4:916516-916538 TTAAAAATTTTGTTGTTTTCTGG - Intronic
970252062 4:14126998-14127020 TTAAGGATTTGAGTGCTGTTTGG - Intergenic
970865067 4:20748748-20748770 TGAAGGCTTTTATTTTTGTTAGG - Intronic
971608758 4:28693954-28693976 TTAAGGATTTGCTTGTTCGTGGG + Intergenic
971950487 4:33339500-33339522 TAGAGGAATTTTTTGTTGTTAGG + Intergenic
972475375 4:39445063-39445085 TTAAGGGCTTTGTTTTAGTTTGG + Intronic
972777634 4:42257629-42257651 TTCTGGCTTTTTTTGTTGTTTGG + Intergenic
972994972 4:44869337-44869359 TGAAGGAATTTATTTTTGTTTGG + Intergenic
973038634 4:45442421-45442443 ATTAGGATTTTGTTTTTTTTTGG - Intergenic
973595428 4:52483893-52483915 TTTAGGATTTTGATGATGCTTGG - Intergenic
974268499 4:59618079-59618101 TTAGGGATTTCCTTCTTGTTGGG + Intergenic
974404450 4:61447917-61447939 TTGTTGTTTTTGTTGTTGTTTGG - Intronic
974813439 4:66975346-66975368 TTAAGGTTTTAGGTTTTGTTGGG - Intergenic
974957542 4:68660945-68660967 TCAAGGATTTTTCTTTTGTTTGG + Intronic
975606610 4:76161436-76161458 ATAGTAATTTTGTTGTTGTTGGG - Exonic
975625408 4:76341024-76341046 TTAAGGTTTATTTTGTGGTTTGG + Intronic
975797027 4:78017483-78017505 TTTACCATTTTGTTGTTGTTTGG - Intergenic
975862325 4:78690639-78690661 TTAAGGCTTTTTTTTTTTTTTGG - Intergenic
975931240 4:79525691-79525713 TTAACTATTTTGTTGTGGGTAGG + Intergenic
976031108 4:80754917-80754939 TTCAAGGTTTTGTTGTTGTAAGG + Intronic
976652838 4:87454248-87454270 TTAAGTATGTTCATGTTGTTGGG + Intronic
976968478 4:91075700-91075722 CAAAGGATTTTTTTGTTGTGTGG + Intronic
976974162 4:91146775-91146797 TGAAGGAATTTATTTTTGTTTGG + Intronic
977053888 4:92164497-92164519 CTAAGGATTTTGATATGGTTTGG - Intergenic
977295366 4:95203420-95203442 TTACTTTTTTTGTTGTTGTTGGG + Intronic
977719763 4:100225310-100225332 TAAAGCATTTTGTTGTGGTTGGG - Intergenic
978233263 4:106426153-106426175 TTAAGACCTTTGTTCTTGTTTGG + Intergenic
978286816 4:107088579-107088601 TTAATGAGTTTTTTGTGGTTGGG + Intronic
978369845 4:108019109-108019131 TTTAGAATTTTGTTGCTTTTAGG + Intronic
978884878 4:113756662-113756684 TTCAGTATTTGCTTGTTGTTAGG + Intronic
979657538 4:123213369-123213391 ATAAGATTTTTGTTGTTGTTAGG - Intronic
979664119 4:123292368-123292390 TCAAAGATTTTGTTTTGGTTTGG + Intronic
979813651 4:125071332-125071354 TTAGTGATTTTGTTTTTCTTAGG - Intergenic
979817428 4:125127441-125127463 TTGAGGTTTTTGTTGTGGCTAGG - Intergenic
980141898 4:128928127-128928149 TTGTTGTTTTTGTTGTTGTTGGG - Intronic
980142568 4:128938283-128938305 CCAAGAATTTTGTTGTTGTTGGG - Intronic
980410843 4:132416210-132416232 TTAAGGCTTTTATTTTTGTTGGG - Intergenic
980411793 4:132429681-132429703 TGAAGGAATTTATTTTTGTTTGG + Intergenic
980777425 4:137454465-137454487 TTAAGGATAATTTTGTTGGTAGG - Intergenic
980856681 4:138449246-138449268 GTCAGAATTTTGTTGCTGTTTGG - Intergenic
981036843 4:140179101-140179123 TTTTGGCTTTTGTTGTTGTGTGG - Intergenic
981121205 4:141052669-141052691 TTAAAGATTTTGTTGTGACTGGG - Intronic
981711386 4:147712275-147712297 TTAAGACTTTTGTTGTTTTTTGG - Intergenic
981739048 4:147983935-147983957 TTTTTGATTTTGTTATTGTTTGG + Intronic
981871326 4:149489928-149489950 TTAAAATTTTTGTTTTTGTTTGG + Intergenic
983318630 4:166166517-166166539 TTAAGCATTTTGTTTTTGCCAGG + Intergenic
983544250 4:168945784-168945806 TCTAAGTTTTTGTTGTTGTTTGG - Intronic
983925953 4:173402498-173402520 GGAAGGATTTTGCTGTTTTTTGG - Intronic
984235942 4:177159121-177159143 TTAAGTATATTGATTTTGTTGGG - Intergenic
984399737 4:179246583-179246605 TTAAGTATTTTGTTTTTATTTGG - Intergenic
985867055 5:2522375-2522397 TTAAGCATATTGATATTGTTTGG + Intergenic
986906622 5:12502163-12502185 TTCAGGCTTTTGTTGTTATCAGG + Intergenic
986911043 5:12557349-12557371 ATAAGCATTTTGTTGATATTGGG - Intergenic
987021993 5:13883853-13883875 TGAAAGATTTTTTTTTTGTTTGG - Intronic
987921973 5:24295180-24295202 TTGAGGATTTTGTTTGAGTTTGG + Intergenic
988153073 5:27412753-27412775 TTAAGGATAGTTTTTTTGTTTGG + Intergenic
988876258 5:35449894-35449916 TTAGGGATTTTATTATTTTTTGG - Intergenic
989266706 5:39483127-39483149 TTGGGGATTTTTTTTTTGTTTGG - Intergenic
990280124 5:54241268-54241290 TTAGGGATTTTTTAGATGTTAGG - Intronic
990321498 5:54634087-54634109 TTAAGGAGTTTGTTGGTCCTTGG + Intergenic
990961058 5:61394036-61394058 GTAAGGACTTTGTTTTAGTTTGG + Intronic
991611355 5:68452894-68452916 TTATGGGTTTTATTTTTGTTTGG - Intergenic
991952093 5:71956125-71956147 TCAAGAATTTTGTTTTTCTTTGG + Intergenic
992535442 5:77697377-77697399 TTGGGGTTTTTGTTATTGTTGGG - Intronic
992637280 5:78736966-78736988 TTATTGTTGTTGTTGTTGTTGGG + Intronic
993120875 5:83773092-83773114 TTAAGCATTTTGTTATTACTAGG + Intergenic
993225762 5:85166010-85166032 TTAAGTATTTTGATATGGTTTGG + Intergenic
993933719 5:93974626-93974648 ATATATATTTTGTTGTTGTTGGG - Intronic
993941465 5:94063387-94063409 TTCACGATTTTGTTGATGGTAGG - Intronic
993943685 5:94093688-94093710 TTAAGAATTTTGGGGCTGTTGGG - Intronic
994135348 5:96280237-96280259 TTGTGGTTTTTGTTGCTGTTTGG + Intergenic
994516577 5:100779976-100779998 CTTTGTATTTTGTTGTTGTTGGG + Intergenic
994560654 5:101366863-101366885 TGAAAGATTTTATTGTTGTAGGG + Intergenic
995102637 5:108332596-108332618 TTTTGTTTTTTGTTGTTGTTGGG + Intronic
995566635 5:113437815-113437837 TTATGGATTTGGTTGCTCTTGGG + Intronic
996612598 5:125400623-125400645 TGATTGATTTTGATGTTGTTAGG + Intergenic
998827542 5:146118900-146118922 TTAGGGATGTTGTTGTTTATAGG - Intronic
1001509095 5:172305444-172305466 TTCAAGAGTTTTTTGTTGTTTGG - Intergenic
1004818276 6:19336362-19336384 TTAAAGTTTTTGTTGTTTTATGG - Intergenic
1004825872 6:19420572-19420594 TTTTGGTTGTTGTTGTTGTTGGG + Intergenic
1004957287 6:20742620-20742642 TTAAGAATTTTCTAGTTTTTAGG + Intronic
1005215617 6:23524370-23524392 TTGATGTTTTTGTTTTTGTTTGG + Intergenic
1005545087 6:26859091-26859113 TTAAGTGTTTTGCTTTTGTTTGG - Intergenic
1005731765 6:28704361-28704383 CCATGGATTTTGTTTTTGTTTGG - Intergenic
1005834047 6:29694342-29694364 TCAAAGATTTTATTTTTGTTAGG + Intergenic
1006721655 6:36157400-36157422 TTATTGTTTTTATTGTTGTTTGG - Intergenic
1007550246 6:42723699-42723721 TTTGGTATTTTATTGTTGTTTGG - Intergenic
1007841711 6:44721724-44721746 ATAAAGTTTTTGTTATTGTTCGG + Intergenic
1008364760 6:50664874-50664896 TTTAGCATTTTCTTGTTATTTGG + Intergenic
1009296105 6:61949821-61949843 TTATGGATGTTTTTGTTTTTAGG - Intronic
1010570559 6:77468724-77468746 TTAAGAATTTTGCTTTTCTTCGG - Intergenic
1010809260 6:80280141-80280163 TTAAGGAATTTGTTTTTATGTGG + Intronic
1011290953 6:85776637-85776659 TTATTGCTGTTGTTGTTGTTTGG - Intergenic
1011384270 6:86777862-86777884 TTAAGGATTTTTTTTTTTTCTGG - Intergenic
1011854935 6:91678249-91678271 TTAAGGATTTTGTTTATGAGAGG + Intergenic
1011913751 6:92475386-92475408 TTACGTATTTTGATGTTCTTTGG - Intergenic
1011997956 6:93617273-93617295 TTAAGGAATTAGTGCTTGTTCGG - Intergenic
1012704551 6:102504772-102504794 TTAAACATTTTCTTGTTATTTGG + Intergenic
1013644459 6:112122665-112122687 TTAAGGATATTTTTGGTGATAGG + Intronic
1013668562 6:112373828-112373850 TTATGCATTTTGGTTTTGTTTGG + Intergenic
1014100230 6:117503659-117503681 TTATGTATTTTATTGTTTTTGGG - Intronic
1014566487 6:122955745-122955767 TATAGGATTTTGTTGTTCTTTGG - Intergenic
1015184053 6:130393284-130393306 TTAAGGAATTTGATCTTGTAAGG + Intronic
1015197986 6:130544942-130544964 TTAAGCATTTTTTGGTTGGTCGG - Intergenic
1015696572 6:135987119-135987141 TTAAGGATCACTTTGTTGTTTGG - Intronic
1016286193 6:142475807-142475829 TTCAGGATTTAGTTTTTTTTTGG - Intergenic
1016468989 6:144355080-144355102 GTAATTTTTTTGTTGTTGTTCGG + Intronic
1016629254 6:146208615-146208637 TTATGCATTTTGAAGTTGTTAGG + Intronic
1016873457 6:148841058-148841080 TTTACAATTTTGTTTTTGTTGGG - Intronic
1016926650 6:149356823-149356845 TTTAGGATTTTGTTTTTGTTTGG + Intronic
1017411147 6:154169006-154169028 TTAAGACTTTTGGAGTTGTTGGG - Intronic
1017806410 6:157949989-157950011 TTAAGAATGTTGTTGGTATTTGG - Intergenic
1018179503 6:161208861-161208883 TTAATGATTTTTTTCCTGTTAGG - Intronic
1018249694 6:161856712-161856734 TTAAGTATTTTGTTTCTTTTAGG + Intronic
1019858563 7:3634398-3634420 TTAAGCCTTTGGTTTTTGTTTGG + Intronic
1020312934 7:6883102-6883124 ATAATCTTTTTGTTGTTGTTAGG + Intergenic
1020707594 7:11565143-11565165 TTAATGCTGTTTTTGTTGTTAGG - Intronic
1020725049 7:11801720-11801742 TCATTGTTTTTGTTGTTGTTTGG - Intronic
1020857403 7:13447514-13447536 TTAAGGATTGTTTTGATGGTAGG + Intergenic
1020974959 7:14993993-14994015 TTGAAGATATTGTTGTTGTTAGG - Intergenic
1021424906 7:20487937-20487959 TCATGGATTTTCTTTTTGTTGGG - Intergenic
1021661450 7:22923091-22923113 ATGAGTATTTTGTTGTTGTTGGG - Intergenic
1021789948 7:24194726-24194748 TTTAGGTCTTTGTTGTTATTCGG + Intergenic
1022635583 7:32131399-32131421 GTAATGATTTATTTGTTGTTTGG + Intronic
1022803156 7:33794757-33794779 TTTATGATTTTTTTGTTTTTCGG - Intergenic
1023005735 7:35865017-35865039 TTTAGGATTTTTTTTTTTTTTGG + Intronic
1023739605 7:43266751-43266773 TTGAGAATTTTTCTGTTGTTAGG - Intronic
1023807372 7:43882622-43882644 TGACGTTTTTTGTTGTTGTTTGG - Intronic
1024086934 7:45901409-45901431 TAAAGGATTTGGTAGTTGTAGGG + Intergenic
1024341441 7:48267139-48267161 ATATGTATTATGTTGTTGTTGGG + Intronic
1025157968 7:56626882-56626904 TTATGTATTATGTTATTGTTGGG + Intergenic
1026048302 7:66923113-66923135 TTCAGGATTTTGTTATGGTTAGG + Intronic
1026384513 7:69832809-69832831 TTAATGTTTTTGTTGTTGTTAGG - Intronic
1026494516 7:70890851-70890873 TTATGGATTTTGTGTTTGTTTGG - Intergenic
1027113386 7:75458527-75458549 TTTTTGTTTTTGTTGTTGTTTGG - Intronic
1027115670 7:75477883-75477905 TTTTTGATTTTGTTGTTCTTTGG - Intronic
1027285636 7:76643122-76643144 TTTTTGTTTTTGTTGTTGTTTGG - Intergenic
1027547453 7:79546342-79546364 TTTAGAATTTTGGTTTTGTTGGG + Intergenic
1027748685 7:82112522-82112544 TTAAGGTGTTTGGTGTTCTTGGG - Intronic
1027848251 7:83413666-83413688 TTAGGCATTTAGCTGTTGTTTGG + Intronic
1028010823 7:85641616-85641638 TTAAAGTTTTTGGTGTTATTAGG - Intergenic
1028185787 7:87784550-87784572 TAAAGGAATTTATTTTTGTTTGG + Intronic
1028228601 7:88278901-88278923 ATGAGGTTTTTGTTGTTTTTTGG - Exonic
1028421846 7:90641718-90641740 AAATGGATTTTGTTGATGTTTGG + Intronic
1028714936 7:93954953-93954975 TAAAAGTTTTTGTTGTAGTTGGG - Intergenic
1029411437 7:100414369-100414391 TTGGGGTTTTTGTTTTTGTTTGG + Intronic
1029894544 7:103968797-103968819 TAATTGTTTTTGTTGTTGTTAGG - Intronic
1030145247 7:106346421-106346443 TTAAGGGTTTTTGTTTTGTTTGG - Intergenic
1030280024 7:107764214-107764236 TTGAGTTTTTTGTTTTTGTTTGG + Intergenic
1031115121 7:117658990-117659012 TTCATGATTTTGTCTTTGTTTGG + Intronic
1031235183 7:119166846-119166868 TTAATTATTTTGTAGTTGTTTGG + Intergenic
1031318394 7:120287840-120287862 TTAAATGTTCTGTTGTTGTTGGG - Intronic
1031455269 7:121971444-121971466 TTGAGGGTTTTGTTTTTCTTAGG + Intronic
1031514482 7:122685210-122685232 TAAAGGAGTTTGATATTGTTTGG - Intronic
1031804052 7:126286275-126286297 TGAAGGATTTTGTTTTAATTGGG + Intergenic
1031872847 7:127106320-127106342 TAAATGATTTTGTTGTTCATAGG - Intronic
1032462953 7:132125567-132125589 TTTGGGATTTTGGAGTTGTTTGG - Exonic
1033123457 7:138686539-138686561 CTAAGGAGTTTTTTGTTTTTTGG + Intronic
1033938637 7:146622345-146622367 TCCTGGTTTTTGTTGTTGTTGGG + Intronic
1034631267 7:152532261-152532283 TTTTGGTTGTTGTTGTTGTTTGG - Intergenic
1035550556 8:520784-520806 TCAGGTTTTTTGTTGTTGTTTGG + Intronic
1037131567 8:15413097-15413119 TTAAGGCTTTTGAAGATGTTGGG - Intergenic
1037200253 8:16243522-16243544 TTATGGGTTTTCTTGTTATTTGG - Intronic
1037407873 8:18563206-18563228 TTAAGGTATTTGTTCATGTTAGG - Intronic
1037666872 8:20977275-20977297 TTAAGGATTCTGATGTGGTCAGG + Intergenic
1038287916 8:26222504-26222526 TTGTTGTTTTTGTTGTTGTTTGG + Intergenic
1038804420 8:30777294-30777316 TAAGGGGTTTTGTTGTTGTGGGG + Intronic
1040570886 8:48608664-48608686 ATATGGATTCTGCTGTTGTTGGG - Intergenic
1041428408 8:57749637-57749659 TGGAGTATTTTTTTGTTGTTAGG + Intergenic
1041560704 8:59215183-59215205 TGAAGGAATTTATTTTTGTTTGG + Intergenic
1041563912 8:59253429-59253451 TTAAGCATTTTTGTCTTGTTTGG + Intergenic
1041627554 8:60047965-60047987 TGGAAGATTTTGTTTTTGTTGGG - Intergenic
1041693466 8:60713111-60713133 TTTTGTTTTTTGTTGTTGTTGGG + Intronic
1042885312 8:73543236-73543258 GAAAGGATTTTGTGGTTGTCTGG + Intronic
1043270544 8:78328025-78328047 TTAAGAATTTTGATATTGTTTGG - Intergenic
1043495348 8:80794689-80794711 TTACAGATTTTGTTTCTGTTTGG + Intronic
1044776813 8:95698538-95698560 TTTGGTTTTTTGTTGTTGTTTGG - Intergenic
1045803663 8:106130982-106131004 TCAAGGATTCTGTAGCTGTTGGG + Intergenic
1046178456 8:110610493-110610515 TTGAGGTTTTTATGGTTGTTTGG + Intergenic
1046442145 8:114271010-114271032 TCAAGCATTTTCTTCTTGTTTGG + Intergenic
1048017813 8:130513158-130513180 TTGGGGATTTTGGTGTTTTTTGG + Intergenic
1048037564 8:130692350-130692372 TGAAGGAATTTGTTTTTGTTTGG + Intergenic
1048218910 8:132523486-132523508 TTAAGCATTATGTTCATGTTCGG + Intergenic
1048416010 8:134228660-134228682 TTATGGATTTTGTGGCTCTTGGG + Intergenic
1048513863 8:135087141-135087163 TTCAGCTTTTTGTTGTTGTTAGG + Intergenic
1049390947 8:142370590-142370612 CTGAGCTTTTTGTTGTTGTTGGG - Intronic
1049650314 8:143763841-143763863 TTGTGGATTTTGTTTCTGTTTGG - Intergenic
1050195428 9:3078131-3078153 CGAAGGATTTGGTTGTTGTGGGG + Intergenic
1050236467 9:3586329-3586351 TTAAGCATTTATTTGATGTTAGG + Intergenic
1050411223 9:5367768-5367790 TTGATAGTTTTGTTGTTGTTGGG - Intronic
1050706564 9:8405857-8405879 TTTAGTATTTTGATGCTGTTGGG - Intronic
1050890024 9:10812926-10812948 TTAAGGAATTTGAAGTTGTGAGG - Intergenic
1051487020 9:17619721-17619743 TTAAACATTCTTTTGTTGTTGGG + Intronic
1051768735 9:20552518-20552540 TTATCGTTGTTGTTGTTGTTGGG + Intronic
1052954405 9:34242160-34242182 TTATGTTTTTTCTTGTTGTTTGG + Intronic
1053115038 9:35492612-35492634 TGAGTTATTTTGTTGTTGTTAGG - Intronic
1054146880 9:61568739-61568761 TTGGCGATTTTGTTTTTGTTTGG - Intergenic
1054186731 9:61958265-61958287 TTGGCGATTTTGTTTTTGTTTGG + Intergenic
1054466618 9:65499794-65499816 TTGGCGATTTTGTTTTTGTTTGG - Intergenic
1054651774 9:67630255-67630277 TTGGCGATTTTGTTTTTGTTTGG - Intergenic
1055041489 9:71878479-71878501 TTAAGTAGTTTGTTGTTTTTTGG - Intronic
1055295657 9:74830561-74830583 TTTTTGTTTTTGTTGTTGTTTGG + Intronic
1055327684 9:75148971-75148993 TTGCACATTTTGTTGTTGTTGGG + Intergenic
1055402913 9:75943383-75943405 TTGAGTTTTTTGTTGTTGCTGGG - Intronic
1055634480 9:78261859-78261881 TTAAAGAATTTGTAGTTATTAGG + Intronic
1057000153 9:91501290-91501312 TTAATGATTTTGTGGTTAATTGG + Intergenic
1057720994 9:97531868-97531890 TTCAGGGTTTTGTTGATGCTTGG - Intronic
1058118588 9:101113709-101113731 TTTCTGTTTTTGTTGTTGTTTGG - Intronic
1058132002 9:101264165-101264187 TTAAGGATTTGGATGTTTTTTGG - Intronic
1058335902 9:103828709-103828731 TGAAAGTTTTTGTTGTTGTTGGG + Intergenic
1058392507 9:104511782-104511804 TTAATGATTTTTTTTTTTTTTGG - Intergenic
1058562975 9:106249381-106249403 TTGAGGATTTTCTTGCTGTGGGG - Intergenic
1059477989 9:114563434-114563456 TAAAGGATTTTTTTTTTTTTAGG + Intergenic
1060256524 9:122035613-122035635 GAAAGGATTTATTTGTTGTTTGG - Intronic
1061666701 9:132164192-132164214 TGGCAGATTTTGTTGTTGTTAGG + Intronic
1061697809 9:132390701-132390723 TTCAGGATTTTCTTGGAGTTTGG + Exonic
1185824761 X:3239598-3239620 TGCCTGATTTTGTTGTTGTTGGG + Intergenic
1186578942 X:10796436-10796458 TTAATGATTTTTTTTTTGATAGG + Intronic
1186672602 X:11782195-11782217 TTAAGGGTTTGGTTCCTGTTAGG + Intergenic
1186842425 X:13497356-13497378 TTAAGGATTTTGGTGATCATTGG + Intergenic
1187650528 X:21399281-21399303 TTAAAGATTTTGTTTTTTATAGG - Intronic
1187765095 X:22632644-22632666 TTAAGGTTTTTTTTGTTTTCTGG - Intergenic
1188052760 X:25507973-25507995 TTAACGATTTTGTTGCTGATGGG + Intergenic
1188666341 X:32825948-32825970 TTAAGTATATTTCTGTTGTTGGG - Intronic
1188739601 X:33762134-33762156 TTATTGATATTGTTGTAGTTTGG + Intergenic
1188809271 X:34632717-34632739 AAAAGGTTTTGGTTGTTGTTAGG + Intronic
1189570233 X:42287227-42287249 ATATGTATTTTATTGTTGTTGGG + Intergenic
1190488465 X:50956016-50956038 TTAAGTATTCAGCTGTTGTTTGG - Intergenic
1191642316 X:63440178-63440200 GTATGGATTTTTTTGTTTTTGGG - Intergenic
1191709003 X:64128319-64128341 GTATGGATTCTGCTGTTGTTAGG - Intergenic
1192467937 X:71370872-71370894 TTAAGGATATTGTTATCTTTTGG + Intronic
1192633535 X:72795584-72795606 TTATGAATTTTGCTATTGTTTGG + Intronic
1192648175 X:72925217-72925239 TTATGAATTTTGCTATTGTTTGG - Intronic
1193129922 X:77908820-77908842 ATATATATTTTGTTGTTGTTTGG - Intergenic
1193449526 X:81648440-81648462 TTAACGATTTTGTTGTTCATTGG - Intergenic
1193602782 X:83528456-83528478 TTAAGAATTTTATAGATGTTTGG + Intergenic
1193767817 X:85552617-85552639 TTAAGGATTTTGATTTTGTTAGG + Intergenic
1194029410 X:88793175-88793197 TGTAGGATTTTGTGGTTGGTAGG - Intergenic
1194106129 X:89769249-89769271 ATTAGGATTTTGATGTGGTTTGG + Intergenic
1194806418 X:98334047-98334069 TTTAGGGTTTTGTTTTGGTTTGG - Intergenic
1194870152 X:99119932-99119954 CTAAGTATTTTGATCTTGTTTGG - Intergenic
1195578772 X:106478750-106478772 TTCAGGTTTTTGTTGTGGTTAGG + Intergenic
1195876194 X:109544049-109544071 TTAAGCATTTTGTTCTTTTGAGG - Exonic
1196312168 X:114181958-114181980 TTCAGCTTTTTCTTGTTGTTAGG - Intergenic
1196412049 X:115430689-115430711 TTAAGGATTGTGTGGTTCATGGG - Intergenic
1197925445 X:131642504-131642526 TTAAGACTTTTGGGGTTGTTGGG - Intergenic
1198604225 X:138319054-138319076 TCCAGGATTTTTTTTTTGTTGGG + Intergenic
1199402988 X:147422005-147422027 TGAAGGACTGTGATGTTGTTAGG - Intergenic
1199940674 X:152624272-152624294 TTTAGGATTTTTTTTTTGTGGGG - Intergenic
1200458085 Y:3417108-3417130 ATTAGGATTTTGATGTGGTTTGG + Intergenic
1201564364 Y:15350189-15350211 ATGTGGATTTTGCTGTTGTTGGG - Intergenic
1201683022 Y:16669971-16669993 TTAAGGATTTTGAGGTGGATGGG + Intergenic
1201693474 Y:16795976-16795998 TTCATTTTTTTGTTGTTGTTTGG + Intergenic
1202063612 Y:20914159-20914181 ATAAGGATTTTATTATTATTAGG + Intergenic
1202267180 Y:23032279-23032301 TTATGTATTATGCTGTTGTTGGG - Intergenic
1202328332 Y:23717863-23717885 TTTTGGGTTTTGTTTTTGTTGGG - Intergenic
1202420172 Y:24666023-24666045 TTATGTATTATGCTGTTGTTGGG - Intergenic
1202450614 Y:25004059-25004081 TTATGTATTATGCTGTTGTTGGG + Intergenic
1202542439 Y:25952190-25952212 TTTTGGGTTTTGTTTTTGTTGGG + Intergenic