ID: 961154287

View in Genome Browser
Species Human (GRCh38)
Location 3:124665829-124665851
Sequence AAGTTGGGGGTACTATAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961154287 Original CRISPR AAGTTGGGGGTACTATAGAT AGG (reversed) Intronic
904994542 1:34621068-34621090 GAGTTGGGGGTAGGATGGATAGG - Intergenic
907092032 1:51733831-51733853 ATGTTAGAGGTCCTATAGATTGG - Intronic
907097438 1:51794447-51794469 CAGTTGGGTGTACTAAAGACTGG - Intronic
907214735 1:52852490-52852512 GAGTAGGTGGGACTATAGATAGG + Intronic
907632393 1:56095723-56095745 GAGTTAGGGGTACTATATAAGGG - Intergenic
910134028 1:83944918-83944940 AAGTTGGTAGTAATATAGACTGG + Intronic
917168000 1:172134778-172134800 AGGTAGGGGGTACTTTACATTGG + Intronic
1068398708 10:56499763-56499785 AAGTTTGAGGTATTTTAGATTGG + Intergenic
1068839701 10:61596817-61596839 AATTTGGGGGTACATTAGAAGGG + Intergenic
1074248770 10:111722586-111722608 GCGTTGGGGGTAATAAAGATGGG + Intergenic
1076279944 10:129237886-129237908 AATTTGGGGCTTCTATGGATGGG + Intergenic
1088416858 11:109598803-109598825 AATTTGGAGCTACAATAGATGGG + Intergenic
1088475625 11:110235819-110235841 ATTTTGGGGGTACAAAAGATTGG - Intronic
1096788881 12:54033188-54033210 AACTTGTGGGAACTATGGATCGG + Exonic
1098669833 12:73212763-73212785 ATGTTGGTGGGACTATAAATTGG - Intergenic
1100789546 12:98115493-98115515 CAGTTGGGGCTACTATGGAGGGG - Intergenic
1100794099 12:98162195-98162217 AAGTTGGGGCTACTTTATTTAGG - Intergenic
1104352998 12:128060765-128060787 AAGTTGCTGGGACTACAGATGGG + Intergenic
1105342592 13:19541400-19541422 TACTTGGGGTTACTATAGAGTGG + Intergenic
1105703144 13:22948717-22948739 AAGTTAGGGGTACCATTGACGGG + Intergenic
1105855841 13:24371199-24371221 AAGTTAGGGGTACTATTGACAGG + Intergenic
1108670272 13:52680235-52680257 AAATTGCGTGTACTATAGCTGGG + Intronic
1113497208 13:110740666-110740688 ATGTTGGGGGGAATATAGGTTGG + Intergenic
1115322145 14:32093727-32093749 CAGTTTGGGGTACTATGAATAGG - Exonic
1117229248 14:53698563-53698585 AGTTTGGGGGTAATATAGTTTGG + Intergenic
1118915147 14:70096498-70096520 AAGTAGGAGGCAATATAGATTGG + Intronic
1120200956 14:81537870-81537892 AAGTTGGGTTTGCTCTAGATTGG + Intergenic
1127936432 15:63644071-63644093 GAGGTGGGAGTACTACAGATAGG - Intronic
1143528466 17:7485858-7485880 GAGGTGGGGCTACTTTAGATGGG + Intronic
1144225590 17:13142035-13142057 AAGTAGGGGTAACTCTAGATAGG + Intergenic
1144620275 17:16814444-16814466 AAGTCGGTGGTGCTATGGATGGG + Intergenic
1149235539 17:54586290-54586312 AATTTGGGGCTATTATAAATGGG - Intergenic
1149536144 17:57435142-57435164 AACTTGGGGCTACTTTTGATGGG + Intronic
1150389611 17:64782619-64782641 AAGTGGGTGTTACTATTGATAGG - Intergenic
1159104378 18:63988973-63988995 AATTTGGGAGTATGATAGATAGG - Exonic
1159989525 18:74887352-74887374 TTGTTTGGGGTACTATAGATGGG + Intronic
1167838418 19:52094625-52094647 AAATTGGGGGTGCTAGAGAGTGG - Intronic
1167843137 19:52138770-52138792 AAGTTGGGGGTGCTAGAGAGTGG - Intronic
1167846600 19:52170380-52170402 GAGTTGGGGGTGCTAGAGAGTGG - Intronic
927305866 2:21572123-21572145 AAGTGGGGGCTACTTTAGATTGG - Intergenic
929719077 2:44348150-44348172 AAGTAGATGGGACTATAGATAGG + Intronic
935243243 2:101195956-101195978 AAGATGGGGATAAGATAGATGGG + Intronic
936709488 2:115115610-115115632 AAGTTGCATGTACTAAAGATTGG - Intronic
943094252 2:183409735-183409757 AGGTTGGGGGGATTATAGCTGGG - Intergenic
943788435 2:191904602-191904624 AAGTTTGGGGTACTGTTGAAAGG + Intergenic
948132194 2:235608919-235608941 TAGTTGGGGGTATTAGGGATGGG - Intronic
1170887456 20:20353865-20353887 CTGTTGGTGGTAATATAGATTGG + Intronic
1172440904 20:34965879-34965901 AGGGTGGGGCTACTGTAGATGGG + Intergenic
1178135477 21:29622353-29622375 AAGTTGGGAGTACTCTACGTTGG + Intronic
1178235477 21:30836369-30836391 AAGTTGGGGGCAATAAAAATGGG + Intergenic
1180717477 22:17881580-17881602 AAGTTGGGGATACAAGAAATAGG + Intronic
1181548134 22:23616578-23616600 ATGTTGGTGGTTCTAAAGATTGG - Intronic
1183002612 22:34874303-34874325 AAGTAGTGGCTACTTTAGATTGG + Intergenic
1183776068 22:39966567-39966589 GAGTTGGGGGTGCTACAGACAGG + Intronic
1184015008 22:41779324-41779346 AAGTTGCTGGGACTATATATAGG - Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
957019174 3:75105294-75105316 AAGGGGGAGGTACTATATATTGG + Intergenic
958841991 3:99217317-99217339 GAGATGGTGGTACTGTAGATAGG - Intergenic
961154287 3:124665829-124665851 AAGTTGGGGGTACTATAGATAGG - Intronic
961195823 3:125000563-125000585 AAGTTGAAGTTACTATTGATGGG - Intronic
965895083 3:173565724-173565746 CATTTGGGGGTAGTATAAATTGG - Intronic
967953376 3:194858031-194858053 AAGTTGGAGCTAAAATAGATGGG + Intergenic
970657159 4:18243915-18243937 AAGTTGTTGGTAATAGAGATGGG + Intergenic
975919622 4:79369690-79369712 AAATAGGGGGTACTAGATATTGG + Intergenic
976229115 4:82822321-82822343 GAGTTGGGGGTAATAAAGAAAGG + Intronic
986763348 5:10899806-10899828 ATGTAGGGGGTACTAGAGTTGGG + Intergenic
992099880 5:73396744-73396766 AAATTGGGGTTACTATACAATGG + Intergenic
994456491 5:100014590-100014612 AAATTAAGGGTACTTTAGATCGG + Intergenic
996629349 5:125608705-125608727 AAGTAGGTGGGACTATAGGTTGG + Intergenic
1002628828 5:180554288-180554310 AAGTAGGTGGTACTACAGGTGGG - Intronic
1008207438 6:48679971-48679993 AAGTTGTGGTAACAATAGATTGG - Intergenic
1017052441 6:150406198-150406220 TGGTTGGGGGTACTGGAGATTGG - Intergenic
1021812130 7:24412951-24412973 AAATTGGGGGTAGGATATATGGG + Intergenic
1032951474 7:136919648-136919670 ACATTGGGGGAACTATACATGGG - Intronic
1045936629 8:107687024-107687046 AAATTGGGGGTACTGTGGAATGG - Intergenic
1047847153 8:128818918-128818940 AGGTTGGGGGTGTTCTAGATGGG + Intergenic
1050002378 9:1091739-1091761 CAGTTCAGGGTACTATAGAGGGG - Intergenic
1056952587 9:91055318-91055340 AAGTTGGCAGTAATATATATGGG - Intergenic
1060270716 9:122139077-122139099 AAGGTGGAAGTATTATAGATAGG + Intergenic
1202589743 Y:26470267-26470289 TACTTGGGGTTACTATAGAGTGG - Intergenic