ID: 961154315

View in Genome Browser
Species Human (GRCh38)
Location 3:124666017-124666039
Sequence TTCCTTTGCAGTATGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961154315_961154323 12 Left 961154315 3:124666017-124666039 CCTTGGCCCATACTGCAAAGGAA 0: 1
1: 0
2: 0
3: 10
4: 172
Right 961154323 3:124666052-124666074 CGTTCTCAGAGCTCTGAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 218
961154315_961154321 8 Left 961154315 3:124666017-124666039 CCTTGGCCCATACTGCAAAGGAA 0: 1
1: 0
2: 0
3: 10
4: 172
Right 961154321 3:124666048-124666070 GCACCGTTCTCAGAGCTCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 138
961154315_961154324 17 Left 961154315 3:124666017-124666039 CCTTGGCCCATACTGCAAAGGAA 0: 1
1: 0
2: 0
3: 10
4: 172
Right 961154324 3:124666057-124666079 TCAGAGCTCTGAGGATGGAAAGG 0: 1
1: 0
2: 5
3: 55
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961154315 Original CRISPR TTCCTTTGCAGTATGGGCCA AGG (reversed) Intronic
900081775 1:863971-863993 TTTCTTTGCAGCCTGGGCCTTGG + Intergenic
900366292 1:2313226-2313248 CTCCTTTGCAGGAGGAGCCATGG - Intergenic
902110437 1:14074074-14074096 TTCCTTTGTACTATTGTCCAGGG - Intergenic
902711693 1:18244340-18244362 TCCCTTTCCAGCATGGACCATGG + Intronic
903202930 1:21757767-21757789 TTCCTTTGCAGTTTCGTCTAAGG + Exonic
906685461 1:47760446-47760468 TGCCTTTGCTGTGAGGGCCAAGG - Intergenic
906941001 1:50255296-50255318 CTCCTTTGCAGTCTGGGGCTGGG + Intergenic
909951339 1:81723485-81723507 TTCCTTTGAATTATTGGGCAGGG + Intronic
912503811 1:110141881-110141903 TGCCTTTGGAGTTTGGGCAAGGG + Intergenic
912565510 1:110584721-110584743 TTCCTTTCCATTTTGGGCCTCGG + Intergenic
912631772 1:111252597-111252619 CTCCTTTGCAGTCTGGGGCAGGG - Intergenic
913682647 1:121201403-121201425 TTCTTTTGCTGTTTTGGCCAGGG + Intronic
914034490 1:143989030-143989052 TTCTTTTGCTGTTTTGGCCAGGG + Intergenic
914154962 1:145078938-145078960 TTCTTTTGCTGTTTTGGCCAGGG - Intronic
916433349 1:164753799-164753821 TTCCTTTTCAATTTGGGCCCCGG + Intronic
917597332 1:176542628-176542650 ATCCTGTCCAGTAGGGGCCAGGG - Intronic
917730658 1:177871712-177871734 TTCCTTAGCAGTTTGGTTCAAGG + Intergenic
920343059 1:205287699-205287721 TTGGTTTGCAGCCTGGGCCAGGG + Intergenic
920469959 1:206219921-206219943 TTCTTTTGCTGTTTTGGCCAGGG + Intronic
922403195 1:225282419-225282441 TTCCTTTCCAGCATTGGACAGGG - Intronic
923446714 1:234078018-234078040 TTCCTCTGCAGTAGGAGTCAAGG - Intronic
1066780180 10:38936817-38936839 TTCCTTTGGACCATGGACCAGGG - Intergenic
1066928541 10:41728141-41728163 TTCCTTTGCAGAATCAGCAAAGG + Intergenic
1067099616 10:43325136-43325158 TTCCCATGCAGTGTGAGCCATGG + Intergenic
1068548496 10:58379854-58379876 GGCCTTTGGAGTATGAGCCATGG + Intergenic
1069738916 10:70675074-70675096 ATGTTTTGCAGTCTGGGCCAAGG + Intronic
1070364852 10:75726578-75726600 TTCCCTCCCAGTAGGGGCCATGG - Intronic
1070794025 10:79206622-79206644 TGCCTTTGCAGAAGGAGCCAGGG + Intronic
1072206019 10:93205801-93205823 TTCCTTTGCAGAGTGTGCCAGGG - Intergenic
1073173581 10:101534772-101534794 TTCCATTGCTGTATGGGATATGG + Exonic
1075442845 10:122493511-122493533 TTCCTGAGCAGTTTGGGGCAGGG + Intronic
1075535566 10:123269268-123269290 TTCCTTTTCAGTGCGGGCCAAGG + Intergenic
1076075879 10:127533529-127533551 TTCCTTTGCAGTGTCCACCATGG + Intergenic
1076851542 10:133095797-133095819 CTCCTGTGCAGGAAGGGCCATGG - Intronic
1083956157 11:65983981-65984003 TTCCTTTGCAGTAGGGCCGAGGG + Intergenic
1084476037 11:69390388-69390410 TTCCTCTTCAGTGTGGGCAACGG + Intergenic
1086449942 11:86906121-86906143 TTGCCTTGCAGGAAGGGCCAGGG + Intronic
1086598255 11:88600903-88600925 TTGCTTTGTTGTATGGACCAGGG - Intronic
1087097608 11:94334619-94334641 TTTCCTTTCAGTATGGCCCAGGG - Intergenic
1087303949 11:96467481-96467503 TTCCTTTGCAGTTTTGTTCAAGG + Intronic
1090717736 11:129444962-129444984 TTGCTCTCCAGTCTGGGCCACGG + Intronic
1092081530 12:5720444-5720466 GTCTTTTGCTGTCTGGGCCAAGG - Intronic
1093050403 12:14497977-14497999 CTACTTTGCAGTACGAGCCAAGG + Exonic
1098812358 12:75110871-75110893 TTCCTGTGCAGTATGGCAGAGGG - Intronic
1100136741 12:91562273-91562295 TCACTTTGAAGTATGGGGCAAGG + Intergenic
1101545960 12:105713093-105713115 TTCCTTTGGAGGAAGTGCCATGG + Intergenic
1104808646 12:131606055-131606077 TTTCTTTCCAATCTGGGCCAAGG + Intergenic
1110559978 13:76900554-76900576 CTCCTTTGGAGAATGGCCCAAGG - Intergenic
1112417960 13:99219653-99219675 TTCTTTTCCAGTGTGGCCCAGGG + Intronic
1112731531 13:102368046-102368068 TTCCTTGGCAGTCGAGGCCAAGG - Intronic
1114269630 14:21092786-21092808 TGCCTTTGCAGTAGGGGCAACGG + Exonic
1114730984 14:24992334-24992356 TGCCTTTGCAGCATTGGTCATGG - Intronic
1120415617 14:84215227-84215249 TGCCTTTGCAATAAGGCCCAGGG - Intergenic
1120564004 14:86032225-86032247 TTCCTTGGCAGCATGGGAGATGG - Intergenic
1121739510 14:96241554-96241576 TTGCTTTTCAGCATGGGCCCAGG + Exonic
1202937066 14_KI270725v1_random:99285-99307 TTCCTTTGGATCATGGACCAGGG + Intergenic
1123937901 15:25202857-25202879 TTCCCTAGCAGGAAGGGCCAAGG + Intergenic
1126230461 15:46317257-46317279 TCCCATTGATGTATGGGCCAAGG - Intergenic
1128550332 15:68594260-68594282 GTCCCCTGCAGTATGGTCCAGGG + Intronic
1131382853 15:91978477-91978499 CCTCTTTGCAGTATGGACCAGGG - Intronic
1131618960 15:94046815-94046837 TATCTTTCCAGTATGGGCCCTGG - Intergenic
1135860992 16:26055871-26055893 AAGCTTTGCAGTTTGGGCCAAGG + Intronic
1136901597 16:34045105-34045127 TTCCTTTGGACAATGGACCAGGG - Intergenic
1139760854 16:69183860-69183882 TTCCTATGGACTTTGGGCCATGG + Intronic
1141151102 16:81565245-81565267 TTCCTTTGGAAGGTGGGCCATGG - Intronic
1143768082 17:9150670-9150692 TTCTTTTGCAGCAAGGGCCTGGG + Intronic
1145709495 17:26957510-26957532 TTCCTTTGAACCATGGACCAGGG - Intergenic
1151116920 17:71746793-71746815 TTCCTTTGTAGAATGGGTCCAGG - Intergenic
1151636881 17:75355530-75355552 TTTTTTTCCAGTATGGCCCAGGG - Intronic
1153938529 18:9954284-9954306 TTCATTGGTAGTATGGCCCACGG + Exonic
1154518767 18:15203247-15203269 TTCCTTTGGACCATGGACCAGGG + Intergenic
1156318978 18:36000138-36000160 TTCCTTTGCAGTCTGTCCCCTGG - Intronic
1157907173 18:51579668-51579690 TTCCTTTGCAGTCACTGCCACGG + Intergenic
1160258878 18:77272379-77272401 TTCCTTTTCAGTCATGGCCATGG + Exonic
1160753075 19:743944-743966 CTCCTTGGCAGCCTGGGCCACGG - Intronic
1164369024 19:27625022-27625044 TTCCTTTGCAGAATCTGCAAAGG + Intergenic
1166979838 19:46625816-46625838 TACCTTTCCATCATGGGCCATGG - Intergenic
925487777 2:4354954-4354976 TTGCTTTGCAGTAAGTTCCAAGG + Intergenic
925590157 2:5501494-5501516 TTAGTTTGCAGTATTGGACATGG - Intergenic
927282106 2:21317951-21317973 TTCTTTTGCAAGATGGCCCACGG - Intergenic
928060515 2:28107959-28107981 TGCCTATGCAGCATGGGCAATGG - Intronic
929107785 2:38380915-38380937 TTCCTTTGGGGGAGGGGCCAGGG + Intergenic
930148676 2:48034608-48034630 TTGCTTTACAGTATGGGAAAAGG + Intergenic
932267134 2:70377522-70377544 TTCCTTTGGAGTAAGAGGCATGG + Intergenic
934070158 2:88376623-88376645 TCCCTCTGCAGTATGGGTGATGG + Intergenic
937213910 2:120298260-120298282 TCCCTTTGCAGTGGGGGCCCTGG + Intergenic
938207928 2:129439585-129439607 TTCCTCCTCAGTGTGGGCCATGG + Intergenic
940087279 2:149874201-149874223 TTCATCTGCAGTATGGGGGAAGG - Intergenic
940589433 2:155702437-155702459 TTCCATTGCAGTGTAAGCCAGGG + Intergenic
940894065 2:159063526-159063548 TTCCTTTCCAGTCTGGGGGAGGG + Intronic
942986794 2:182152778-182152800 TTACTTTGCAGTATGCGTGAAGG + Intronic
946159960 2:217830097-217830119 GTCCTTTGCAGGGTGGGCCTCGG - Intronic
948019219 2:234716308-234716330 TTCCTGTGCAGCAAGGGCCCAGG + Intergenic
1169042738 20:2509103-2509125 TTTTTTTGCAGAATGGGCCAAGG - Exonic
1171052219 20:21870678-21870700 TTGCTTTGCAGTCAGGGGCAGGG + Intergenic
1172927817 20:38555266-38555288 TTCCTAGGCAGTAAGGGCAAGGG - Intronic
1173364940 20:42376589-42376611 TTCCCTTTCAGAAGGGGCCATGG - Intronic
1173638540 20:44582408-44582430 TTCCTTTGGACAATGAGCCAGGG - Intronic
1176586247 21:8589691-8589713 TTCCTTTGGATCATGGACCAGGG - Intergenic
1178559115 21:33621227-33621249 TTCTCTTCCAGTATGGCCCAGGG - Intronic
1180269053 22:10566595-10566617 TTCCTTTGGATCATGGACCAGGG - Intergenic
1180280884 22:10693822-10693844 TTCCTTTGGACCATGGACCAGGG - Intergenic
1182239589 22:28904686-28904708 TTCCTTTGCAGCTTTGGCGAAGG + Intronic
1203237981 22_KI270732v1_random:25323-25345 TTCCTTTGGATCATGGACCAGGG - Intergenic
1203289676 22_KI270735v1_random:23040-23062 TTCCTTTGGACCATGGACCAGGG + Intergenic
950179806 3:10903370-10903392 TTCAGTGGCAGTAGGGGCCAGGG - Intronic
952722934 3:36552172-36552194 TTCCTTTACAGTTTGCTCCAGGG - Intergenic
954629309 3:52039616-52039638 TTCCTGTCCACCATGGGCCAGGG + Intergenic
955350343 3:58188971-58188993 CTCCTTTGAAATATGGCCCATGG + Intergenic
957036832 3:75301390-75301412 TTCCTGTGCAGTATGGACTGAGG + Intergenic
959276417 3:104282557-104282579 TTGCATTGCAGAATAGGCCAAGG - Intergenic
961080581 3:124023861-124023883 TTCCTGTGCAGTATGGACTGAGG + Intergenic
961154315 3:124666017-124666039 TTCCTTTGCAGTATGGGCCAAGG - Intronic
963067570 3:141275446-141275468 CTCCCTTGGAGTCTGGGCCAGGG - Intronic
964002605 3:151794663-151794685 TTCCTTTATGGTGTGGGCCAGGG + Intergenic
966432672 3:179848778-179848800 TTCCCTTGCAGTTTGGGGTAGGG + Intronic
971526814 4:27630221-27630243 TTCCTTTGATATATGGGACACGG - Intergenic
974988991 4:69061895-69061917 TACCTTTTCAGGATGGGTCATGG + Intronic
975469372 4:74747486-74747508 TTCCTCTACAGGAAGGGCCAAGG - Intronic
975696886 4:77022533-77022555 TTCATTTACAGTATGGTCTATGG - Intronic
976343239 4:83968235-83968257 TTCACTTGCAGTATGTGTCAAGG + Intergenic
980270782 4:130581335-130581357 TTCCTTTTTGGTATGGGGCATGG - Intergenic
981339255 4:143601734-143601756 TGTCTTGGCAGTGTGGGCCAGGG + Intronic
984101640 4:175494631-175494653 TTCCTTTCCTGTTTGGGGCATGG - Intergenic
985192668 4:187393181-187393203 TTCCTGTTCAGCGTGGGCCAGGG - Intergenic
985270722 4:188192268-188192290 TTCCTTTTCAGTATCTCCCAGGG - Intergenic
985533515 5:448085-448107 CTCCTTTTAAGCATGGGCCACGG - Intronic
989466493 5:41762108-41762130 TACCTTTGCAGAATGCTCCATGG + Exonic
989833895 5:45959081-45959103 TTCCTTTTCACCATAGGCCATGG - Intergenic
992486453 5:77201715-77201737 TTCGTTTTCAGTAAGGTCCATGG + Intergenic
995081531 5:108056149-108056171 TTCCTTTGGGGTAAAGGCCATGG + Intronic
995657586 5:114444269-114444291 ATCCCTTGCTGTATGGTCCATGG - Intronic
998230919 5:140360983-140361005 ATCCTTTGCAGGAAGGGCCTGGG + Intronic
998970575 5:147586966-147586988 TTCCATTTCAGAATGGGGCAGGG - Intronic
1001140013 5:169136705-169136727 TCCCATTGGAGAATGGGCCAGGG + Intronic
1001904915 5:175463747-175463769 TTCCTTTGCAGTGTGGGTACAGG + Intergenic
1004170940 6:13295144-13295166 TTCCTCTGCAGTGTTGCCCATGG - Intronic
1004822299 6:19380817-19380839 TTTATTTTCAGTATGGGCCGAGG + Intergenic
1006611876 6:35298909-35298931 CTCCTTTGGAGGATGGGGCAGGG - Intronic
1007382120 6:41497155-41497177 GTCCTCTGCGGTAGGGGCCAGGG + Intergenic
1011837243 6:91448064-91448086 TCCCTTTGCAGCATGGGACATGG + Intergenic
1013072402 6:106741029-106741051 TTCCCCTGCTGTATTGGCCAAGG + Intergenic
1015359970 6:132328878-132328900 TTGCTCTGCAGAATGGGCAAAGG - Intronic
1019186682 6:170224602-170224624 CTTCTTTAGAGTATGGGCCAGGG - Intergenic
1021438015 7:20643728-20643750 TCCCTTTGTAGTTTGGGACATGG - Intronic
1022559772 7:31336349-31336371 GTCCTTTGCAGAATGGGGCGCGG + Intergenic
1023185482 7:37528804-37528826 TTCCATGGCAGAATGGGCCAGGG + Intergenic
1023774431 7:43590745-43590767 TTCCCTGACATTATGGGCCATGG - Intronic
1023931618 7:44709634-44709656 TCGCTTTGCAGCATGGCCCAAGG + Intergenic
1025823660 7:64994039-64994061 CACCTTTTCAGGATGGGCCAAGG - Intronic
1032261480 7:130340869-130340891 TCCCTATGGTGTATGGGCCATGG + Intergenic
1034299504 7:150002842-150002864 TTCCTTTCATGTTTGGGCCAAGG - Intergenic
1034806499 7:154093931-154093953 TTCCTTTCATGTTTGGGCCAAGG + Intronic
1035523496 8:293582-293604 TTTCTTTGCAGCCTGGGCCTTGG - Intergenic
1036912089 8:12766005-12766027 TTCCGTTGCATTGTGGGGCAGGG + Intergenic
1037522011 8:19689121-19689143 GTCCTCTGCAATCTGGGCCAAGG + Intronic
1037733000 8:21544962-21544984 TGCCTTTGGAGTATAGACCAGGG - Intergenic
1037849930 8:22319087-22319109 TTCCTTTGATGTACTGGCCAAGG - Intronic
1038563318 8:28599065-28599087 TTCCTTTGAATTATTGGGCAGGG - Intergenic
1039799557 8:40942362-40942384 TGACTCTGCAGTAAGGGCCAAGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042955908 8:74250486-74250508 TTCCTTTCCAGGAAGGGGCAGGG + Intronic
1045875358 8:106975292-106975314 TTCCTTCTGAGTATGGGGCAGGG + Intergenic
1046187391 8:110739654-110739676 TTCCGTAGCAGCATGGGTCACGG + Intergenic
1046877277 8:119269569-119269591 TTCCTTCGCTCTATGGCCCAGGG + Intergenic
1046916841 8:119687157-119687179 TTGCTCTGCAGTATGGAACAGGG + Intergenic
1047944091 8:129857626-129857648 TTCATTTGCAGTGTGGAGCATGG + Intronic
1051080568 9:13288898-13288920 TTTCTATGCACAATGGGCCAGGG + Intergenic
1052715188 9:32107614-32107636 TTCTTTTGAAGTTTGGGTCAGGG + Intergenic
1053150108 9:35737858-35737880 GGCCTTTGCAGGAGGGGCCATGG - Exonic
1054971220 9:71089881-71089903 TTCTTTTCCAGTATGGTCCAGGG - Intronic
1057035849 9:91811265-91811287 TTCCCGTGCAGTCTGGGCCTGGG - Intronic
1059256671 9:112937308-112937330 ATCCTTTGCAGGCTGGGTCAGGG + Intergenic
1062028237 9:134350362-134350384 TTCCTTTTCTGTAAGGGGCATGG + Intronic
1062718247 9:138022030-138022052 TTCCTGTGCACTCTGGGCTATGG + Intronic
1203616155 Un_KI270749v1:67206-67228 TTCCTTTGGATCATGGACCAGGG - Intergenic
1186726396 X:12363607-12363629 AGCCCTGGCAGTATGGGCCATGG - Intronic
1187127062 X:16463708-16463730 TTTCTTTGCATGATGTGCCATGG - Intergenic
1191600566 X:63000881-63000903 TTCCCTTGCAGTATAAGCCATGG - Intergenic
1193753589 X:85378869-85378891 CTGCTTTGCAGTAGGGGCAAAGG + Intronic
1195964850 X:110420628-110420650 ATCCTTTGCAGAATGAGGCAGGG + Intronic
1196456497 X:115895030-115895052 TTCCTTTGCAGTAAGGGATCTGG - Intergenic
1197770934 X:130088911-130088933 TTCCTGGGCAGCAGGGGCCATGG + Intronic