ID: 961154961

View in Genome Browser
Species Human (GRCh38)
Location 3:124671785-124671807
Sequence TTATAGCTGGAGCCCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961154961_961154974 25 Left 961154961 3:124671785-124671807 CCCCCAAAGGGCTCCAGCTATAA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 961154974 3:124671833-124671855 TCTACCTCCAATGGCAGTCCAGG 0: 1
1: 0
2: 1
3: 7
4: 99
961154961_961154975 26 Left 961154961 3:124671785-124671807 CCCCCAAAGGGCTCCAGCTATAA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 961154975 3:124671834-124671856 CTACCTCCAATGGCAGTCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 93
961154961_961154973 16 Left 961154961 3:124671785-124671807 CCCCCAAAGGGCTCCAGCTATAA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 961154973 3:124671824-124671846 CTGAAGATATCTACCTCCAATGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961154961 Original CRISPR TTATAGCTGGAGCCCTTTGG GGG (reversed) Intronic
903037207 1:20500611-20500633 TTTTATCTCGAGGCCTTTGGAGG - Exonic
905653320 1:39671066-39671088 ATCAAGCTGGAGCTCTTTGGAGG + Intronic
906077837 1:43065199-43065221 TTCTGCCTGGAGCCCTTTTGGGG - Intergenic
910732398 1:90412240-90412262 CTAGAGCTGTAGCCTTTTGGGGG + Intergenic
911497589 1:98650337-98650359 GAAGAGCTGCAGCCCTTTGGGGG - Intergenic
914952878 1:152132480-152132502 TTAATGCTGGAGTCCTCTGGTGG - Intergenic
917700056 1:177571419-177571441 CTATAGCTGGAGACATGTGGAGG - Intergenic
919295640 1:195696503-195696525 TTATCTCTGGAGGCTTTTGGGGG - Intergenic
920750572 1:208670872-208670894 GTCCAACTGGAGCCCTTTGGAGG + Intergenic
1063604193 10:7508304-7508326 ATGTAGCTGGAGGCCTGTGGAGG + Intergenic
1063604223 10:7508383-7508405 GTGTGGCTGGAGCCCTGTGGAGG + Intergenic
1063604251 10:7508461-7508483 GCATGGCTGGAGCCCTGTGGAGG + Intergenic
1065494222 10:26312386-26312408 TTGGAGCTGGAGCCTTTGGGAGG + Intergenic
1068060529 10:52063457-52063479 GAAGAGCTGCAGCCCTTTGGGGG - Intronic
1071485824 10:86102114-86102136 TTATAGCTGGAGTCCCTGTGTGG - Intronic
1071570240 10:86692692-86692714 TGTCAGCTGGAGCCCTTTGCAGG - Intronic
1072746363 10:97941829-97941851 TCATAGCTAAAACCCTTTGGTGG + Intronic
1073475768 10:103752112-103752134 TTTCAGCAGGAGCCCTTTGCAGG + Intronic
1076450914 10:130556402-130556424 TTATAGCGGTAGCTATTTGGGGG + Intergenic
1079743035 11:24087456-24087478 CTGGGGCTGGAGCCCTTTGGAGG - Intergenic
1081135811 11:39439040-39439062 TTGGAGATGGAGCCTTTTGGAGG - Intergenic
1086898517 11:92340275-92340297 TTGTAGCAGGAGTCCTATGGAGG + Intergenic
1088146296 11:106683978-106684000 TTATTGCTGGAACTCTTTGGAGG + Intronic
1090349495 11:126098451-126098473 TTGGAACTGGTGCCCTTTGGAGG - Intergenic
1092130645 12:6110543-6110565 TTCTAGATACAGCCCTTTGGAGG + Exonic
1092587262 12:9912222-9912244 ATAAAGCTGAAGCCCTTGGGTGG + Intronic
1092965363 12:13636248-13636270 GTATAGCTGGAGAACCTTGGGGG + Intronic
1093205683 12:16246092-16246114 TTACAGCTGTGGCTCTTTGGTGG + Intronic
1093429919 12:19072707-19072729 TTAGAGGTGGAGCCTTTGGGAGG - Intergenic
1096464495 12:51840905-51840927 TTAAAGCTTAAGCCTTTTGGAGG - Intergenic
1096713619 12:53477005-53477027 TTAAAACTGAGGCCCTTTGGAGG - Intronic
1097380407 12:58888839-58888861 TTATGGATGGAGCTTTTTGGGGG - Exonic
1097441490 12:59613414-59613436 TTGGAGATGGAGCCCTTGGGAGG - Intronic
1100121699 12:91375934-91375956 TTGTAGCTGGGGCCTTTGGGAGG - Intergenic
1102854452 12:116280887-116280909 TTGAAGGTGGAGCCCTTGGGAGG + Intergenic
1118608206 14:67518660-67518682 TTATGGCTGGTTTCCTTTGGGGG - Intronic
1121178546 14:91909525-91909547 TTACAGCTGGAGCTTTTGGGAGG + Intronic
1122988088 14:105221800-105221822 TTATACCGGGAGCTCCTTGGTGG - Exonic
1126336137 15:47588172-47588194 TCATGGCTGGAGTCCTTTGTGGG - Intronic
1127139462 15:55960129-55960151 TTATTTCTGCAGTCCTTTGGGGG - Intronic
1127838981 15:62813601-62813623 TTGGAGCTGGAGAACTTTGGAGG - Intronic
1130921156 15:88345780-88345802 TAAGAGCTGGAGCCTTTTGGGGG - Intergenic
1131944758 15:97607935-97607957 TTATAGCTGTATACCTTTTGGGG + Intergenic
1133211346 16:4264818-4264840 TTAAAGCTGGGGCTCTTTGGAGG + Intronic
1135740608 16:24972113-24972135 TATCAGATGGAGCCCTTTGGAGG - Intronic
1140103572 16:71938986-71939008 GAATAGCTGTGGCCCTTTGGGGG + Intronic
1145839797 17:27984855-27984877 ATATTGCTGTAGCCCTTGGGAGG - Intergenic
1148046272 17:44747030-44747052 TTACTGCTGGGGCCCTTGGGGGG - Intronic
1151123476 17:71819266-71819288 TTAAAGCTGGAGTCTTATGGTGG - Intergenic
1152507802 17:80762759-80762781 TTCTAGCTCCATCCCTTTGGTGG - Intronic
1153573446 18:6496379-6496401 TTAAAGCTGGACCCTTCTGGAGG - Intergenic
1158611858 18:58947980-58948002 TTATAGCTGAAGAACTTGGGAGG - Intronic
1158863556 18:61616350-61616372 TTATCTGAGGAGCCCTTTGGGGG - Intergenic
1161721862 19:5907294-5907316 TTAGAGATGGAGCTTTTTGGAGG - Intronic
1163962526 19:20710474-20710496 TTATAGTTGAAGGCCATTGGAGG - Intronic
1165166823 19:33862992-33863014 TCCTTGCTGGAGCCCTTTGAAGG + Intergenic
925600326 2:5602425-5602447 TTATAGCTGGAGCCAACTGCAGG + Intergenic
929368502 2:41192053-41192075 TTATAGAGGGAGCCCCTTGATGG - Intergenic
932904163 2:75731857-75731879 TAACAGCAAGAGCCCTTTGGTGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933312322 2:80676199-80676221 ATGAAGCTGGAGCCCTTTGGAGG - Intergenic
934925753 2:98380753-98380775 TTATAGCAGGAGCCTTGGGGGGG + Intronic
936278181 2:111118148-111118170 TAACAGCAGGAGACCTTTGGCGG - Exonic
939297629 2:140290296-140290318 TTATAGCAGATGCACTTTGGAGG + Intronic
941647852 2:168060322-168060344 TTAGAGATGGAGCCTTTGGGAGG + Intronic
945453493 2:210020897-210020919 TTACAAATGGAGCCCTTGGGAGG + Exonic
1171821733 20:29852815-29852837 GGATATTTGGAGCCCTTTGGGGG + Intergenic
1174009646 20:47439234-47439256 TTATTCCTGGAGCCCATGGGTGG - Intergenic
1174040644 20:47697279-47697301 TGACATCTGGACCCCTTTGGTGG + Intronic
1174821626 20:53731410-53731432 TAAGAGCTGGGGCCCTTGGGAGG + Intergenic
1177023875 21:15896892-15896914 TTGTAGATGTAGCACTTTGGTGG - Intergenic
1179725921 21:43341194-43341216 AATTAGCTGGAGTCCTTTGGTGG + Intergenic
1183521303 22:38297647-38297669 TCATAGCTAGACCCCGTTGGCGG - Intronic
949268468 3:2187490-2187512 CTATGGCTGGAGTCCCTTGGGGG + Intronic
951310158 3:21116262-21116284 TTATAGATGTATCCCTTTGTGGG + Intergenic
952016161 3:28959324-28959346 TGATAGCTGGAGACATTGGGAGG + Intergenic
953299500 3:41758014-41758036 TAAGAGGTGGAGCCTTTTGGAGG + Intronic
954845002 3:53547697-53547719 TTATGGCAGTGGCCCTTTGGAGG + Intronic
957527238 3:81392801-81392823 CTATATCTGGCTCCCTTTGGGGG + Intergenic
958216416 3:90585926-90585948 TTAAAGTTGGAGCACTTTGAGGG - Intergenic
961154961 3:124671785-124671807 TTATAGCTGGAGCCCTTTGGGGG - Intronic
961237898 3:125384202-125384224 TTATATCTGTGGCTCTTTGGAGG - Intergenic
962373701 3:134842056-134842078 TAATAGCTGGGGCCTTTGGGAGG + Intronic
962443070 3:135440586-135440608 TTATAACTGGACTCATTTGGAGG + Intergenic
963346636 3:144103042-144103064 TTACAGCTCAAGCCCTTAGGGGG + Intergenic
964984261 3:162719600-162719622 TTGAAGATGGAGCCTTTTGGGGG + Intergenic
965766409 3:172135356-172135378 TTATAACTGGTGCACTTTGCAGG + Intronic
970207059 4:13665616-13665638 TTAAAGGTGGAGCCTTTGGGAGG - Intergenic
972242695 4:37210419-37210441 TTATAGCTGCCACCCATTGGGGG - Intergenic
974666192 4:64964873-64964895 ATATAGCTGGGGCCTTCTGGAGG - Intergenic
983527890 4:168778956-168778978 TTAGAGCAGGACCTCTTTGGCGG - Intronic
988065713 5:26227573-26227595 ATATAGCTGGAGACCTGGGGAGG - Intergenic
989278862 5:39619496-39619518 GAAGAGCTGCAGCCCTTTGGAGG + Intergenic
989986608 5:50706442-50706464 CCATAGCTGGAGCCTTTTGATGG + Intronic
990700752 5:58472632-58472654 TTATAGGTGGGGCCTTTAGGAGG - Intergenic
992393781 5:76353465-76353487 TTATAGCAGGAGCCATTAGTGGG + Intronic
994667564 5:102724370-102724392 TGATAGCTCAAGCCCTTTTGGGG - Intergenic
995375928 5:111474519-111474541 TTGGAGATGGAGCCCTTGGGAGG - Intronic
998106622 5:139473064-139473086 TTATAGAGAGAGCCCTGTGGTGG + Intergenic
999816786 5:155184866-155184888 CCATACCGGGAGCCCTTTGGAGG + Intergenic
1001446840 5:171791898-171791920 TAAGAGCTGGAGCCTTTCGGAGG + Intronic
1005879698 6:30046392-30046414 TTAGAGGTGGGGCCTTTTGGAGG - Intergenic
1010225443 6:73484512-73484534 TTAGAGGTGGGGCCCTTAGGAGG - Intronic
1013424637 6:109999600-109999622 ATGTAGTTGGAGCCTTTTGGGGG - Intergenic
1020147934 7:5659463-5659485 GTATGGCTGGAGCCCAGTGGGGG + Intronic
1020993786 7:15235689-15235711 TAATAGCTGTAGACCTTTGGGGG + Intronic
1025233724 7:57219759-57219781 CTCGAGCTGGAGCCCTGTGGGGG + Intergenic
1028759789 7:94483171-94483193 TTATAGTTGGATCTCTATGGAGG + Intergenic
1031814598 7:126417835-126417857 TTGAAGCTGGAACCCTTGGGAGG - Intergenic
1034372622 7:150613216-150613238 TTATAGTTGAAGGCCATTGGAGG - Intergenic
1037923771 8:22828913-22828935 TTGGAGGTGGAGCCGTTTGGGGG - Intronic
1038454796 8:27666219-27666241 TAATAGCTGCAGCCCTTTGTTGG + Intronic
1040808522 8:51423033-51423055 ATATAGCTGGAACCCTCTGCAGG - Intronic
1043364099 8:79511353-79511375 TTAGAACTGCAGCACTTTGGAGG + Intergenic
1043483260 8:80674042-80674064 TTACAGCTGAAGCTCTTTGAGGG + Intronic
1048684892 8:136893563-136893585 TAAGAGGTGGAGCCCTTGGGAGG + Intergenic
1050177348 9:2882194-2882216 TCATAGATGGACCTCTTTGGTGG - Intergenic
1050703040 9:8363085-8363107 TTATATCTGGAGACCATTCGTGG + Intronic
1051026555 9:12619887-12619909 TTGGAGGTGGAGCCTTTTGGAGG + Intergenic
1051951803 9:22644298-22644320 TTATAGGTGGAGCCTTTGGGAGG + Intergenic
1055738180 9:79355840-79355862 TTGCAGGTGGAGCCTTTTGGAGG + Intergenic
1055923460 9:81486365-81486387 ATATAGCTGGTTCCTTTTGGTGG - Intergenic
1057831685 9:98412067-98412089 TTATAGGTTAAGCCCTTTGTTGG + Intronic
1059009261 9:110439139-110439161 TTAGAGATGGAGCCTTTGGGAGG + Intronic
1187255861 X:17641442-17641464 TTGTGGCTGGAGCCCTCTGTAGG + Intronic
1187380096 X:18794132-18794154 TTAAAGTTGGACCCCTTTGCAGG + Intronic
1187674306 X:21700647-21700669 TTACTCCTAGAGCCCTTTGGTGG - Intergenic
1188023841 X:25187561-25187583 TTAGAGATGGAGCCTTTGGGAGG + Intergenic
1190476385 X:50832205-50832227 TAAAAGGTGGAGCCTTTTGGAGG + Intergenic
1190850822 X:54239765-54239787 TTATATCTGGGGCCCTTTTGCGG - Intronic
1200133579 X:153864090-153864112 TTAAAGTTGGGGCCCTCTGGGGG + Intronic
1200929228 Y:8682144-8682166 TTATACCTGGAGCCAATGGGAGG - Intergenic