ID: 961161211

View in Genome Browser
Species Human (GRCh38)
Location 3:124727957-124727979
Sequence CTAATATTCCATAACTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961161211 Original CRISPR CTAATATTCCATAACTATAT TGG (reversed) Intergenic
902319122 1:15647633-15647655 CTAATATTCCTTAACAGTATAGG - Intronic
905162886 1:36052472-36052494 CTAATATTCTATAGCACTATAGG + Intronic
906559562 1:46746255-46746277 CTATTATTCCATAGCATTATAGG - Intergenic
908635513 1:66159734-66159756 CTAATATTCCCTGTCTTTATAGG + Intronic
909242044 1:73225842-73225864 CTAATATTCCATTGCTAGAAGGG + Intergenic
909736411 1:78968099-78968121 CATATATTCCAAAATTATATGGG + Intronic
910535001 1:88287681-88287703 CTAATATGACATAATAATATTGG - Intergenic
910850860 1:91648736-91648758 TTAATATTCCAAAAACATATTGG + Intergenic
911212580 1:95158089-95158111 CTAGCATTCCCTAACTACATTGG - Intronic
915185271 1:154099535-154099557 CTTAAAATCCATAAGTATATAGG + Intronic
917203026 1:172537218-172537240 CTAATATACTATTACTATATTGG - Intronic
917481719 1:175417803-175417825 ATTATATAGCATAACTATATTGG + Intronic
917739683 1:177950481-177950503 CTCATATTACATAACTTTAAAGG - Intronic
918117966 1:181512881-181512903 ATAGTATTACAGAACTATATTGG + Intronic
919147003 1:193648529-193648551 CTAGACTTCCATTACTATATTGG + Intergenic
921845896 1:219881642-219881664 ATAATATTCCAAAATAATATTGG + Intronic
924503714 1:244660928-244660950 CTATTATTCCAAAGCTTTATTGG + Intronic
1065107937 10:22409296-22409318 GTAATATTCTATAAATATATTGG - Intronic
1065629037 10:27659049-27659071 CTCATATTTAGTAACTATATTGG + Intergenic
1066093679 10:32052265-32052287 CTAACATTCCACAACTGTAAAGG + Intronic
1066476791 10:35755120-35755142 TTAATATTCTATAGATATATTGG - Intergenic
1068426520 10:56872478-56872500 CTAATATTACATCACAATTTTGG - Intergenic
1068658610 10:59600464-59600486 CTAATATTCTTCAACTAAATAGG + Intergenic
1068998889 10:63241419-63241441 TTACTATTCTATAACTACATAGG + Intronic
1069227798 10:65965950-65965972 ATAATATTTGATATCTATATTGG - Intronic
1071053271 10:81477091-81477113 ATAATACACCATAACTGTATTGG + Intergenic
1072527311 10:96284647-96284669 CAAATAATCTATAACCATATAGG + Intergenic
1072603002 10:96948780-96948802 ATAATATTCAATTATTATATGGG + Intronic
1075695401 10:124431103-124431125 CTATTTTTCCATAACTTTTTTGG - Intergenic
1076035044 10:127193078-127193100 TTAATATTTCATAACATTATGGG - Intronic
1076089949 10:127675763-127675785 CAAATATTCTATATCTTTATTGG - Intergenic
1077693655 11:4373188-4373210 CTGATATTTCAAAAATATATCGG - Intergenic
1079809223 11:24974661-24974683 CTGATAAGCCATATCTATATGGG - Intronic
1083093651 11:60226428-60226450 ATTATATACCATAACCATATGGG + Intronic
1085869473 11:80332458-80332480 CTAATTATCCATAACTATTTAGG + Intergenic
1087579246 11:100030856-100030878 CTTAGATTCTATCACTATATAGG - Intronic
1088076232 11:105851931-105851953 CTACTGTTCCATTTCTATATCGG + Intronic
1088108698 11:106235613-106235635 CTCATTTTCCATAAATATTTTGG + Intergenic
1088466171 11:110141309-110141331 CTTGTATTTCATAAATATATGGG - Intronic
1095698966 12:45171362-45171384 CTAATGTTGCAAAACAATATTGG - Intergenic
1106970242 13:35131582-35131604 CTAACATTTCATTACTAAATAGG - Intronic
1109585203 13:64392073-64392095 CTAATATTGTAAAACAATATTGG + Intergenic
1109882385 13:68496478-68496500 AAAATATTTCTTAACTATATTGG + Intergenic
1109883751 13:68515007-68515029 CTGATATTCCAAAATTATTTGGG - Intergenic
1111353553 13:87065364-87065386 CCAATGTTCCATAACTATGTTGG + Intergenic
1111836605 13:93395996-93396018 CTACTTTTCCCAAACTATATAGG - Intronic
1112493955 13:99890984-99891006 ATAATATTTCAAAAATATATAGG + Intronic
1113584016 13:111450273-111450295 CAAATATTCCATAAATATCCAGG - Intergenic
1114809850 14:25885434-25885456 ATAATATTTAATATCTATATAGG + Intergenic
1114814003 14:25934664-25934686 GAAATATTCAATAACTATTTTGG + Intergenic
1114962233 14:27907933-27907955 CTAATATTCCAAAACCATTTTGG - Intergenic
1116117511 14:40675366-40675388 CTTATATTTCATGACAATATTGG + Intergenic
1120395450 14:83962005-83962027 CTTATATTTCTAAACTATATTGG + Intergenic
1121053576 14:90835619-90835641 CCAATTTACCATAACTGTATGGG + Intergenic
1123218350 14:106832846-106832868 CTAATATAACATATGTATATAGG + Intergenic
1127469002 15:59273741-59273763 CAAATATTACATGACAATATTGG + Intronic
1130565460 15:84990814-84990836 GTAATATTGGATAACTATTTTGG - Intronic
1130788511 15:87126434-87126456 CTAATATTGCATTAATATTTTGG - Intergenic
1137307333 16:47216020-47216042 CTAATGTTCCATTACTGTTTTGG + Intronic
1137558182 16:49486069-49486091 CTCATATTCCATAGCCATCTTGG - Intergenic
1140333767 16:74083663-74083685 CTTATAACCCATAACTCTATGGG - Intergenic
1140574283 16:76147285-76147307 CTAATATTCCATATTTACAAAGG - Intergenic
1140866086 16:79063403-79063425 CTAATATTCCATATCCAGACTGG - Intronic
1146773496 17:35590560-35590582 AAAATATTCCCTAACCATATTGG - Intronic
1148918640 17:51007663-51007685 CTAATATTCCAACACTACATAGG + Intronic
1153849487 18:9079769-9079791 GTAATATTCTATAACTTAATAGG - Intergenic
1156147669 18:34205395-34205417 ATAATTTTCCAAAACTATTTGGG - Intronic
1156947240 18:42849563-42849585 ATAATAATCAATGACTATATTGG - Intronic
1158373665 18:56837957-56837979 CTACTATTCCATAACTAAGATGG + Intronic
1159748549 18:72270874-72270896 ATAATAGTACATAAATATATAGG - Intergenic
1160347756 18:78148310-78148332 ATAATATTCCATAAATTTAGTGG - Intergenic
1164110677 19:22154972-22154994 CATATGTTCCAAAACTATATGGG + Intergenic
1165602627 19:37069311-37069333 ATTATATTTCTTAACTATATAGG - Intronic
925983560 2:9196639-9196661 ATAATATTCCATTATTTTATGGG + Intergenic
928208057 2:29301462-29301484 ATAAAATTGCATATCTATATAGG + Intronic
931215920 2:60244561-60244583 ATATTTTTCCAAAACTATATAGG - Intergenic
933078478 2:77958507-77958529 CTAGTATTTCATAACAAAATAGG + Intergenic
933986941 2:87600107-87600129 CGAATATTGCAAAACTATAATGG + Intergenic
936306902 2:111350701-111350723 CGAATATTGCAAAACTATAATGG - Intergenic
936650310 2:114418533-114418555 TTAATATATCCTAACTATATTGG - Intergenic
936858725 2:116990891-116990913 CTAAGATTCCATAAAAACATTGG + Intergenic
941452616 2:165677908-165677930 TCAATATTCCAAAACTATTTTGG - Intronic
942856966 2:180561038-180561060 ATAATAAACCATAACTATAGGGG + Intergenic
942927545 2:181451812-181451834 CTAATATCAAATAACTGTATTGG - Intergenic
943199882 2:184808047-184808069 GTAATATTCCTTAACTTTATGGG + Intronic
944803067 2:203255274-203255296 TTAATATTTTGTAACTATATTGG - Intronic
946953317 2:224901079-224901101 CCAAAATGCCATAACTATGTAGG - Intronic
1169630874 20:7629856-7629878 CTAATATTTCACAATTATATAGG + Intergenic
1170376511 20:15706457-15706479 CAAAAATTCCATGACTCTATAGG + Intronic
1172347205 20:34210899-34210921 CTAATACTCCATGACCAAATAGG - Intronic
1176728018 21:10459697-10459719 GTAATATTCAACAACTAAATGGG + Intergenic
1176864528 21:14038121-14038143 ATAATATTGCATAAATATAATGG + Intergenic
1177952418 21:27554953-27554975 CAAATATTTCATAAGTATAAAGG - Intergenic
951089383 3:18554515-18554537 CTAATATTTAATAACTCAATAGG - Intergenic
953514198 3:43573827-43573849 GTAATATTCCATCACTAAACAGG + Intronic
954402144 3:50324557-50324579 CAGATATTCCAGAACTATCTTGG + Intronic
955943077 3:64165053-64165075 CTAATGTTCCATAACGACAATGG - Intronic
956250156 3:67227169-67227191 CAGATGTTGCATAACTATATTGG - Intergenic
957549907 3:81690561-81690583 CAAATGTTTCATAAATATATTGG - Intronic
957651999 3:83019600-83019622 CTAATATTCAACAAATACATTGG + Intergenic
958461407 3:94401824-94401846 CTAAAATTCTATAATTATAGTGG - Intergenic
960402007 3:117211638-117211660 TTAATATTCCTCAAGTATATTGG - Intergenic
961161211 3:124727957-124727979 CTAATATTCCATAACTATATTGG - Intergenic
961630194 3:128292169-128292191 ATAATATTTCATAACAAAATAGG - Intronic
964856883 3:161155758-161155780 CTAATATTTCAAAACTAGCTAGG + Intronic
965289050 3:166853125-166853147 TTGATACTCCATAACTATGTTGG + Intergenic
966627176 3:182030467-182030489 GTAATATTAAATAAATATATTGG + Intergenic
967010816 3:185431819-185431841 CCTGTTTTCCATAACTATATTGG + Intronic
967362552 3:188648105-188648127 CTCATATTCCATTAATATGTTGG + Intronic
970849677 4:20586169-20586191 TTAATTTTCCTTAATTATATTGG - Intronic
972432188 4:38993678-38993700 TTAATTTTACATATCTATATCGG + Intronic
973130511 4:46642419-46642441 CAAATATTGAATAAATATATGGG - Intergenic
973969179 4:56194090-56194112 CTAGTATTCCATTATTAGATGGG + Intronic
974203847 4:58673846-58673868 TTAAAATCCCATAACAATATTGG - Intergenic
975314923 4:72940511-72940533 AAAATATTACTTAACTATATAGG - Intergenic
975802874 4:78080750-78080772 TAAATATTCCAAAACTATAAAGG - Intronic
976335969 4:83886947-83886969 CTAAAATTCAATATCTATTTTGG - Intergenic
976998824 4:91469099-91469121 CTAATATACCAAATCTACATTGG + Intronic
977562183 4:98543845-98543867 CTAATATTCTATAACTGTATAGG - Intronic
978720839 4:111907149-111907171 GTAATGTTGCATATCTATATCGG + Intergenic
978750867 4:112246117-112246139 GTAATATTTCATTATTATATAGG - Intronic
979800312 4:124899917-124899939 ATTATATTCCATTATTATATGGG - Intergenic
981549686 4:145931400-145931422 ATCAGATTTCATAACTATATTGG - Intronic
981805454 4:148710176-148710198 CAAATAATACAGAACTATATAGG - Intergenic
982620609 4:157699152-157699174 CTAATATTCCATGACCAAACTGG + Intergenic
983866404 4:172772469-172772491 CAAATATTCCCTAACATTATAGG + Intronic
986690658 5:10311088-10311110 CTAATACACCATCACTATGTTGG - Intergenic
987026900 5:13936529-13936551 CTTATAATCCTCAACTATATGGG + Intronic
988317716 5:29652186-29652208 CTTATAATCCATAAAAATATGGG + Intergenic
989340896 5:40374500-40374522 CTATAATTCCATAGCTCTATAGG - Intergenic
990083125 5:51941270-51941292 CCATTATTCCTTAACTCTATTGG - Intergenic
990445751 5:55892319-55892341 CTAATTTTCTATTACAATATGGG - Intronic
990707880 5:58550140-58550162 CTAATATTAAATATCTAAATGGG + Intronic
993041357 5:82818200-82818222 ATATTAGTCCTTAACTATATGGG + Intergenic
993211481 5:84957984-84958006 ATAATATTTAATAACTATTTAGG + Intergenic
993958120 5:94262568-94262590 CTAATATTCCAGAATGATATGGG - Intronic
993982723 5:94562341-94562363 CTAAAAATCCATCACTATACTGG + Intronic
994149314 5:96430598-96430620 CTAATTTAGCATTACTATATTGG - Intronic
995202386 5:109441066-109441088 CTAATATTCTAAAACTTTTTTGG + Intergenic
995692319 5:114841351-114841373 ATAATATCCTATAACTATTTGGG + Intergenic
996539483 5:124614306-124614328 CTAATGTTGCATATCTAAATAGG + Intergenic
997076278 5:130681912-130681934 TTAATAATATATAACTATATAGG + Intergenic
997270602 5:132534050-132534072 CTAAAATTCCATAATTAGCTGGG - Intergenic
1000916836 5:167092982-167093004 TTAATATTCCATGACTTTATCGG + Intergenic
1004246439 6:13981960-13981982 CTAGTATTCCATAACACTGTAGG - Intergenic
1008206994 6:48672672-48672694 CTAATATTTTACAATTATATTGG - Intergenic
1010608771 6:77926861-77926883 CTAATATTGAAAAAATATATAGG + Exonic
1012136367 6:95561862-95561884 TTAATATTCCTTAATTTTATGGG - Intergenic
1015135456 6:129863982-129864004 CTAATACTCCAGCACTCTATTGG + Intergenic
1015135458 6:129864023-129864045 CTAATTTTCTATAATTACATTGG + Intergenic
1015671758 6:135698812-135698834 CTAATATTCCCTTATTATCTGGG - Intergenic
1015810605 6:137158783-137158805 ATTATATTCCATCACTATTTGGG - Intronic
1016994514 6:149952276-149952298 CTAAAATGCCATAACTTTTTGGG + Intergenic
1017288018 6:152700992-152701014 GTATTATTCCACAACTATATAGG - Intronic
1017993171 6:159507525-159507547 CTAATATTCCATAGCACTGTAGG + Intergenic
1020612421 7:10415915-10415937 CTAATAGTCACTAACTTTATGGG + Intergenic
1022150823 7:27603522-27603544 GTAATTTTCTATAAATATATAGG - Intronic
1023172419 7:37402563-37402585 CTACTCTTCCATAAGTATGTTGG - Intronic
1025779718 7:64589991-64590013 CAAATATTGCATAACTACTTTGG - Intergenic
1026390159 7:69892954-69892976 TTAAAATTGCATCACTATATTGG - Intronic
1027529657 7:79314512-79314534 ATAATATTCCATGACTCTACAGG - Intronic
1027917674 7:84346921-84346943 CTCATTTGCCATTACTATATGGG - Intronic
1028604542 7:92641700-92641722 CTAATATTCCTGAACCATGTAGG - Intronic
1029943710 7:104509066-104509088 TTAATGTCCTATAACTATATAGG + Intronic
1030483539 7:110135877-110135899 TGAATATTCCACAACTATTTCGG - Intergenic
1030942699 7:115674295-115674317 ATAATTTTACATAACTATCTTGG + Intergenic
1031176971 7:118364877-118364899 CTAAAATTCAAAAATTATATTGG + Intergenic
1031288564 7:119903274-119903296 CTGATATTCAAGAACTTTATGGG + Intergenic
1032648314 7:133850534-133850556 CTAATATTCCATTTCTCTTTGGG + Intronic
1034186378 7:149180472-149180494 AGAATATTCCTTAACTATACTGG + Intronic
1037114577 8:15208272-15208294 ATAATATGCCATACCTATATTGG - Intronic
1037114599 8:15208786-15208808 CTAATAATCCATATATATACAGG + Intronic
1038713250 8:29968801-29968823 AAAATATTCAATAAGTATATTGG - Intergenic
1040757538 8:50797603-50797625 CAAATATTCTATAACCATCTTGG + Intergenic
1041172099 8:55154117-55154139 CTAATCTTCCCTATGTATATAGG - Intronic
1043962320 8:86431365-86431387 ATAATATTTAATAACTATTTAGG - Intronic
1045682186 8:104674115-104674137 CTAATATTACATAGCTAGAATGG - Intronic
1046017658 8:108624784-108624806 TTATTATTCCTTAACTGTATAGG + Intronic
1046228401 8:111317406-111317428 CTAATCTCCCATAAATACATGGG - Intergenic
1047317361 8:123746816-123746838 CAAATATTCCATAAATAAGTGGG + Intergenic
1048526043 8:135203764-135203786 CTAATATTCCGAATCTATAAGGG + Intergenic
1051760032 9:20452539-20452561 CTAATATGCCATTACTATAATGG + Intronic
1053783576 9:41634596-41634618 CCATTATTCAATAACTCTATTGG - Intergenic
1054171532 9:61844738-61844760 CCATTATTCAATAACTCTATTGG - Intergenic
1054666002 9:67736074-67736096 CCATTATTCAATAACTCTATTGG + Intergenic
1055329099 9:75163416-75163438 CTAATTTGCCATACATATATGGG + Intergenic
1056504320 9:87242818-87242840 TTCATATTCCATAAAGATATTGG + Intergenic
1056653008 9:88484849-88484871 CTATTATTCCATAAATTCATAGG + Intergenic
1058622167 9:106895132-106895154 ATAATATTCCATACCTTTATTGG + Intronic
1058972358 9:110095329-110095351 GAAATATTCAATAACTAAATAGG - Intronic
1059546551 9:115181058-115181080 CTAATGTTCCATCATTATAGAGG + Intronic
1062067992 9:134539128-134539150 CTAAGATTCCATATTTATAGTGG + Intergenic
1186698642 X:12065706-12065728 CTAATATTCCAGAAGTAGATGGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1192428596 X:71097651-71097673 CTAATATTCCTTAACAGTAAAGG - Intronic
1193670521 X:84379223-84379245 ATAATATTTCAGATCTATATGGG - Intronic
1193730705 X:85099465-85099487 CCAATATTCCTTAATAATATAGG + Intronic
1194658880 X:96606182-96606204 ATAATCTATCATAACTATATTGG - Intergenic
1195528691 X:105925519-105925541 CTAATATTCTATAGCACTATAGG - Intronic
1195666024 X:107432014-107432036 ACAATATTCCATAACTCTATTGG + Intergenic
1196522038 X:116685756-116685778 CTAATATTCAATGATTACATAGG + Intergenic
1197069127 X:122272222-122272244 TCAATATTCCATAATTAGATTGG + Intergenic
1199210040 X:145197279-145197301 TTAAAATTGCATAACTATCTTGG - Intergenic