ID: 961166509

View in Genome Browser
Species Human (GRCh38)
Location 3:124767169-124767191
Sequence GGCAATGGCAATGGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961166509 Original CRISPR GGCAATGGCAATGGGTCCTG GGG Intronic
900132351 1:1092453-1092475 GGCCATGGTAACAGGTCCTGTGG - Intronic
900469545 1:2846850-2846872 GGGAATGACACGGGGTCCTGGGG + Intergenic
900740426 1:4327671-4327693 GGCAAGGGCAGTGGGTGATGGGG - Intergenic
900998164 1:6134015-6134037 GGGAACGGCACTGGGCCCTGAGG + Intronic
902479737 1:16705160-16705182 GGCAACAGCAGTGGGTGCTGAGG + Intergenic
903051274 1:20602995-20603017 GGCAATGGGAATCAGCCCTGTGG - Intronic
903227360 1:21901489-21901511 GGCAATAGAATTGGGTCCTATGG + Intronic
903627916 1:24744898-24744920 GGAAAGGGCGATGAGTCCTGGGG + Intergenic
906025276 1:42668320-42668342 GGCAATGGAAATGGGTGAGGAGG - Intronic
906885814 1:49647412-49647434 TGCACTGGCACTGGTTCCTGTGG - Intronic
912566413 1:110590745-110590767 GGCAATCTCGATGGGACCTGTGG + Intergenic
916276704 1:163001705-163001727 AGCAATGGGACTGTGTCCTGAGG - Intergenic
917456507 1:175190680-175190702 GACAATGGCAGTGGGAACTGAGG - Intronic
919764197 1:201115650-201115672 GGCCATGCCCATGGGTGCTGCGG - Exonic
919824861 1:201496160-201496182 GGCAACAGCAATAGGGCCTGGGG + Intronic
920451867 1:206065505-206065527 GGCAGTGGGAAAGGTTCCTGGGG + Intronic
920600231 1:207317690-207317712 GGCAATGGCAATGGAACAAGAGG - Intergenic
922535526 1:226377737-226377759 GGCAGTGGCAATGGCTCCTCAGG + Intronic
923133524 1:231097714-231097736 GGCACTGGAAATGGGGCCTTAGG - Intergenic
924475829 1:244381100-244381122 GGCTATGGCAATGGAAGCTGGGG + Intronic
1064545975 10:16450235-16450257 GGTATTGGGAGTGGGTCCTGAGG + Intronic
1065459207 10:25938267-25938289 GGCAAAGACAACAGGTCCTGGGG + Intronic
1065781064 10:29168303-29168325 GGCAAAGGCAATGGGTGATTGGG - Intergenic
1066442896 10:35455510-35455532 TGCAATGGCCTTGGGACCTGGGG + Intronic
1067405862 10:46023183-46023205 GGCGAGGGCAAGGGCTCCTGAGG - Intronic
1069598325 10:69687013-69687035 GGCATTGGAATGGGGTCCTGGGG + Intronic
1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG + Intronic
1071566929 10:86676045-86676067 GGCTATGGCAATGAGTCTGGGGG + Intronic
1074719284 10:116250762-116250784 AGCTATGGCCAGGGGTCCTGAGG - Intronic
1076850463 10:133089956-133089978 GGCAACAGCGATGGTTCCTGAGG - Intronic
1077610442 11:3640417-3640439 AGCACTGGACATGGGTCCTGGGG + Intronic
1078384843 11:10880500-10880522 AGCAATGGGGATGGGTCTTGAGG - Intergenic
1081879215 11:46433612-46433634 CGAAATGGCATTGGGACCTGAGG + Exonic
1084214214 11:67638896-67638918 GTCCATGGCAATGGGTCCCAAGG + Intronic
1084487889 11:69461679-69461701 GGAAAAGGGAATGGGTCCTCAGG + Intergenic
1085157721 11:74311599-74311621 AGCGCTGGCTATGGGTCCTGGGG - Exonic
1087171189 11:95051294-95051316 TTCAATGGCCATGGGTCCAGAGG - Intergenic
1088161709 11:106879683-106879705 GGCAATGGCAATGGAAACAGAGG - Intronic
1090642751 11:128743445-128743467 GGCTTTGACAATGGATCCTGAGG + Intronic
1094528250 12:31247687-31247709 TACAATGGCAATGGCTACTGAGG - Intergenic
1095889255 12:47220617-47220639 GGCACAGGCACTGGGCCCTGAGG + Intronic
1096534726 12:52264024-52264046 GGCTTTGGCACTGGTTCCTGTGG + Intronic
1096810561 12:54167024-54167046 GGCATTGGCAATATGTCCTAGGG + Intronic
1096970090 12:55658603-55658625 GGCAGAGGCACTGGGTGCTGTGG - Intergenic
1100550257 12:95640382-95640404 GGCAATGGCGATGGCTCAAGAGG - Intergenic
1102238061 12:111307103-111307125 GGCCATAGAAGTGGGTCCTGGGG + Exonic
1104963633 12:132499476-132499498 CTCACTGGCAATGGGGCCTGTGG - Intronic
1108642734 13:52397542-52397564 GGCCAGGTCAATGGGTCCTGTGG + Exonic
1110024018 13:70511932-70511954 GTCGATGGGACTGGGTCCTGTGG + Intergenic
1113879958 13:113619527-113619549 GGCAGTGGCAGTGGCTTCTGGGG - Intronic
1115471090 14:33769464-33769486 GAAATTGGCAATGGGACCTGAGG - Intronic
1117401891 14:55365793-55365815 GACCATGGCAATAGCTCCTGAGG + Intergenic
1120763768 14:88309640-88309662 GGCAATGCCAACGGGTGTTGGGG - Intronic
1121511584 14:94516727-94516749 TGCAAAGGCAATAGGTCTTGGGG - Intronic
1122999562 14:105286047-105286069 AGCAATGGCTGTGGATCCTGTGG + Intronic
1123215965 14:106809714-106809736 GGCTCTGGCTATGGCTCCTGTGG - Intergenic
1125006088 15:34819721-34819743 GACAATTGCAATGGCACCTGTGG - Intergenic
1125357304 15:38829944-38829966 GGCACTGGCAGTGAGTGCTGGGG + Intergenic
1126289661 15:47059251-47059273 GGCACTGGCAATGGGTCAGATGG - Intergenic
1126639242 15:50808008-50808030 GGCAATGGCTATGGTTCCCTTGG + Intergenic
1128019957 15:64381538-64381560 GGCATTGGCAATTGGTTCAGGGG - Intronic
1128525107 15:68407106-68407128 GGCAGAGGCAATGGGACCTAGGG - Intronic
1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG + Intronic
1129510431 15:76117722-76117744 GGGAATGGCAGTGGGTCCACAGG + Intronic
1129686881 15:77691384-77691406 GGGAAGGGCAATGGGTACTATGG - Intronic
1130086674 15:80783528-80783550 GGAAGTGGCAGTGGGTACTGGGG + Intronic
1130275693 15:82475264-82475286 AGCAGTGGCACTGAGTCCTGTGG - Intergenic
1130468052 15:84202656-84202678 AGCAGTGGCACTGAGTCCTGTGG - Intergenic
1130496214 15:84470886-84470908 AGCAGTGGCACTGAGTCCTGTGG + Intergenic
1130590344 15:85207254-85207276 AGCAGTGGCACTGAGTCCTGTGG - Intergenic
1130620225 15:85454102-85454124 TGCCATGGAAGTGGGTCCTGTGG + Intronic
1132098822 15:99008297-99008319 GTCGATGGGACTGGGTCCTGTGG + Intergenic
1132466315 16:78850-78872 GGCAAAGGCAAGGTCTCCTGAGG - Intronic
1134568813 16:15274141-15274163 GGCAATGACAATGGGGCAGGGGG + Intergenic
1134733622 16:16482221-16482243 GGCAATGACAATGGGGCAGGGGG - Intergenic
1134933879 16:18230061-18230083 GGCAATGACAATGGGGCAGGGGG + Intergenic
1135677064 16:24424826-24424848 GGCAATGGCAATGGCTCTCAGGG + Intergenic
1135857327 16:26023935-26023957 GACAATGTCAATGGGTGCGGTGG + Intronic
1137396915 16:48122608-48122630 GGCAGTGGCAGTGGGTCCAGGGG + Intronic
1138235283 16:55377129-55377151 GACAATGGGACTGAGTCCTGAGG + Intergenic
1138298892 16:55910134-55910156 AGCAATGGCGATGTGCCCTGTGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1144365405 17:14539833-14539855 GGCACTTCAAATGGGTCCTGTGG - Intergenic
1147644714 17:42026906-42026928 GGCAAGGACGATAGGTCCTGTGG + Intronic
1151546329 17:74795528-74795550 GCCACTGGCAATGACTCCTGCGG + Exonic
1158714598 18:59866782-59866804 ATCAATGGCAATGGGTACAGTGG + Intergenic
1160553506 18:79711404-79711426 GGGAATGGCCAGGGCTCCTGGGG + Intronic
1160978740 19:1806851-1806873 GCCAATAGCAGTGGGTCCAGTGG - Intronic
1163046580 19:14647349-14647371 GGCAATGGCACTGGGACCTGAGG + Exonic
1167340227 19:48911252-48911274 GGTAATGGGAGTGGGTCCGGAGG + Exonic
1168062214 19:53899181-53899203 GGCCAGGTGAATGGGTCCTGCGG + Intronic
1202713773 1_KI270714v1_random:31066-31088 GGCAACAGCAGTGGGTGCTGAGG + Intergenic
925232161 2:2243056-2243078 GGCAATGTCAATGGGAGCAGGGG + Intronic
927190487 2:20513736-20513758 GGTATGGGCAAAGGGTCCTGAGG - Intergenic
931036967 2:58254617-58254639 GGCAATGTCAATCAGTCCTGAGG - Intergenic
931139962 2:59446505-59446527 GGCAATGTCAGTGGGAACTGAGG + Intergenic
932633793 2:73370287-73370309 GGCAATTGGAATGGCTCCCGTGG - Intergenic
932749453 2:74362079-74362101 GGCAAAGTCAGTGGGTACTGTGG + Exonic
934706739 2:96486453-96486475 GGCAAAGGCAAGGTGTGCTGGGG - Intergenic
935356557 2:102207005-102207027 GGCACTGGCTATGGATGCTGAGG - Intronic
935878314 2:107536111-107536133 GTCAATGGGATTGGGTTCTGGGG + Intergenic
937130620 2:119509745-119509767 GGTAATGGAAATGGATACTGGGG - Intronic
937170858 2:119866974-119866996 GGGAATGGCAAAGAGACCTGGGG + Intronic
937572155 2:123377483-123377505 GGCATTGGCAATAGCTACTGTGG - Intergenic
938319757 2:130355351-130355373 GGCACTGGAAGTGGGTTCTGGGG - Intergenic
938735069 2:134178404-134178426 GGAAAGGGCATTGGGTCCTTTGG + Intronic
940382677 2:153033478-153033500 GGCCAGGCCAATGGGTCCTTGGG - Intergenic
942987982 2:182164568-182164590 GGCAATGACAATGGTAGCTGAGG - Intronic
946903642 2:224395782-224395804 TGCAATGGCAAGAGGTCATGTGG + Intronic
947038397 2:225886447-225886469 GGCACTAGCAATGATTCCTGTGG - Intergenic
948373675 2:237506099-237506121 GGAAATGTGAAGGGGTCCTGAGG - Intronic
948668679 2:239552446-239552468 GGAATTGGCGATGGGTTCTGGGG + Intergenic
948670189 2:239563647-239563669 AGGAATGACAATGGGTCCAGAGG + Intergenic
1168772554 20:424676-424698 GCAAATGGCTATGGGTGCTGGGG - Intronic
1169885879 20:10397288-10397310 GGCAGTGGCAATAGGTAATGAGG + Intergenic
1170152258 20:13237908-13237930 AACAATGGCACTGGGACCTGAGG - Intronic
1172190540 20:33059642-33059664 GGCAATGGCATAGGATCCAGGGG - Intronic
1172332283 20:34083547-34083569 GGCAAGTGAAATGAGTCCTGAGG - Intronic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175679609 20:60976473-60976495 AGGGATGGCAATGGGTTCTGGGG + Intergenic
1175805217 20:61824190-61824212 GACAATGGGAATGGCTTCTGAGG - Intronic
1175861215 20:62151381-62151403 GGCCATGGCAATGGACCATGTGG - Intronic
1178215444 21:30592500-30592522 GGCCATGGCTATGGGTGCTGTGG + Exonic
1178215457 21:30592551-30592573 GGCTGTGGCTATGGGTGCTGTGG + Exonic
1178215986 21:30598819-30598841 GACCATGGCTATGGGTGCTGTGG - Exonic
1179234751 21:39535851-39535873 GGCATTGGCACAGGGTCCAGAGG - Intergenic
1181625236 22:24118598-24118620 GATAAAGGCAAGGGGTCCTGTGG - Intronic
1181645997 22:24232152-24232174 GGCCATGGGAGTGGGTCCTGAGG + Exonic
1182967500 22:34535815-34535837 GGCAATGCCAATGGGAAATGTGG - Intergenic
949843281 3:8343328-8343350 TGAAATGATAATGGGTCCTGAGG + Intergenic
952709019 3:36410526-36410548 ATCAATGGCAGTGGGCCCTGGGG - Intronic
952955358 3:38553946-38553968 GGGAATGGGAGTGGGTGCTGTGG - Intronic
954817475 3:53294171-53294193 GGCAATGGCAACATGTCCAGGGG + Intronic
959766721 3:110039726-110039748 GGCAGTGGCATTAGTTCCTGGGG - Intergenic
959964200 3:112335087-112335109 GGCACTGGCAATGGAGCCTGAGG + Intronic
960592498 3:119379272-119379294 TGTAATGGCAGTGAGTCCTGTGG + Intronic
961166509 3:124767169-124767191 GGCAATGGCAATGGGTCCTGGGG + Intronic
961379360 3:126487178-126487200 AGCAATGATAATGGATCCTGGGG + Intronic
961438021 3:126932673-126932695 GGCACTGGCACTGGCTCCTCAGG + Intronic
963824497 3:149937210-149937232 GGCACTAGCAATGCTTCCTGTGG + Intronic
965538873 3:169852615-169852637 GGTAACGGCACTGGGTCCTGAGG + Intronic
965608509 3:170520443-170520465 CCCAATAGCAATGGGTCCTTTGG + Intronic
969286267 4:6204306-6204328 GGCACTGGCAATGTGTGCTATGG - Intergenic
969612022 4:8232701-8232723 AGCAATGTCACTGGGCCCTGTGG - Intronic
971870741 4:32235319-32235341 GAGAAAGGCAATGGATCCTGGGG + Intergenic
972754973 4:42036853-42036875 GGCAATGGCAATAGCCCTTGAGG - Intronic
974089836 4:57300191-57300213 GTCAATGGGAATGGGAGCTGTGG + Intergenic
974457292 4:62144701-62144723 GGCAATGGCATTTGCTTCTGGGG - Intergenic
976565577 4:86547595-86547617 GTCAATGGGACTGGGTGCTGTGG - Intronic
978460892 4:108950678-108950700 GGCAATGGCAAAGGGTTATAAGG + Intronic
978918387 4:114151988-114152010 GGTAATGGGGGTGGGTCCTGGGG - Intergenic
978983311 4:114979160-114979182 GGAAATGGCATTGGGAGCTGGGG - Intronic
985616267 5:923561-923583 GGCAAGGGAAAGGGGTCCTGCGG - Intergenic
987029760 5:13964861-13964883 AGAAATGACAAAGGGTCCTGGGG - Intergenic
987255781 5:16149512-16149534 GTCAATGACAATGGGTCTTAGGG - Intronic
988349944 5:30089450-30089472 GGCAATGGAAATGCTACCTGAGG - Intergenic
995989130 5:118214360-118214382 GGCAATGGCAATTGGTCTAATGG - Intergenic
997005225 5:129808652-129808674 GGTAGTGGGAATAGGTCCTGAGG - Intergenic
997405134 5:133639668-133639690 GGGAAGGGCAATGGGTGCAGAGG + Intergenic
997463804 5:134073120-134073142 GGCACTGGTGATGGGTCCAGAGG - Intergenic
997467205 5:134096213-134096235 GGCAGTGTCAGTGGGGCCTGGGG - Intergenic
1001316088 5:170642129-170642151 TGAAATGTCAAAGGGTCCTGAGG + Intronic
1004329812 6:14711041-14711063 GGCAATGGCAGTCAGTGCTGTGG + Intergenic
1005280896 6:24272403-24272425 CTCAATGGCAATGTGTACTGTGG - Intronic
1005498449 6:26409503-26409525 GGCAACGGCTGTGGGTCATGGGG - Intronic
1007262699 6:40575021-40575043 AGCCATGGCAATGGGTCCTTAGG + Intronic
1008844887 6:55950648-55950670 GTCAATGGGACTGGGTGCTGTGG - Intergenic
1008889553 6:56471989-56472011 GGCAATGGCAATGTGTTATGAGG + Intronic
1010261725 6:73824606-73824628 GGCATTGGCCAGGGATCCTGTGG + Exonic
1013306927 6:108856732-108856754 AGCCATGGCAATGGGTTATGAGG + Intronic
1015684921 6:135849143-135849165 GGATATGGCAATGGGTGCAGAGG - Intergenic
1019613191 7:1947204-1947226 GGCAAAGGAAATGGCTTCTGAGG + Intronic
1020220376 7:6232119-6232141 GGGATTGGCAATGGGTCTAGTGG - Intronic
1022443294 7:30451107-30451129 GGCCATGGTCATGAGTCCTGGGG + Intronic
1023839875 7:44090684-44090706 GGCAATGGTGAAGGGTCCAGGGG + Intergenic
1023998540 7:45176755-45176777 AGCAATGGGAATGAGTCCTTTGG - Intronic
1024558599 7:50624590-50624612 GTCAACGGGAATGAGTCCTGGGG + Intronic
1027173488 7:75888987-75889009 GGCAGTGGCAATGTGTGGTGTGG + Intergenic
1028732533 7:94168557-94168579 GCCAGAGGCAATGGGTCCTGTGG - Intergenic
1033033877 7:137852366-137852388 GGCAATGGCAATGGTGGCTTGGG + Intergenic
1033637955 7:143229668-143229690 GGGAGTGGCAATGTGACCTGCGG + Intergenic
1034238035 7:149587858-149587880 GGCAATGGCAGTAGGGCCAGAGG - Intergenic
1034241103 7:149611553-149611575 GGCAATGGCAGTAGGGCCAGAGG - Intergenic
1034246077 7:149645420-149645442 GGCAATGGCAATAGGGCCAGAGG - Intergenic
1034383941 7:150722392-150722414 GGCTATGGTGAGGGGTCCTGAGG + Exonic
1035922184 8:3689531-3689553 GTCAATGGAAATGGCTCCTCCGG - Intronic
1036649234 8:10631794-10631816 ACCAAGGGCGATGGGTCCTGGGG + Intronic
1038245444 8:25850593-25850615 GGCAATGGAAATGGATTCAGAGG - Exonic
1038660306 8:29491449-29491471 GGAAATGGCATCAGGTCCTGGGG - Intergenic
1042053424 8:64735735-64735757 GGCAATGAGAATGGGATCTGTGG + Intronic
1045118057 8:99005063-99005085 GGGAATAGTAATGGGTTCTGGGG + Intergenic
1045538615 8:103059674-103059696 AGCAGTGGCAGTGGGTCTTGGGG - Intronic
1047229538 8:122984758-122984780 GGCCATGGAAATGGGTGATGAGG - Intergenic
1047608455 8:126497439-126497461 GGAAAGGGCATTGAGTCCTGGGG + Intergenic
1048128502 8:131664333-131664355 GGCAATAGCAACTGTTCCTGAGG + Intergenic
1048379323 8:133850614-133850636 GGCAATGGGAAAGAGCCCTGAGG - Intergenic
1048970748 8:139643766-139643788 GGCTTTGGCCAGGGGTCCTGGGG - Intronic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1051591461 9:18780014-18780036 GGCAATGGGAAGGGGTCATCAGG + Intronic
1058163968 9:101599738-101599760 GGAAATGGAAATGAGACCTGAGG + Intronic
1060434294 9:123580563-123580585 GGAAATGGCCAAGGGCCCTGGGG - Intronic
1061003601 9:127916312-127916334 AGAAGTGGCAGTGGGTCCTGGGG + Intronic
1061061583 9:128253323-128253345 GGCAGTGGCACTGAGTCCCGAGG - Intronic
1186025771 X:5309511-5309533 AGCAATTGCAAAGGGTCCTGGGG - Intergenic
1186299257 X:8181442-8181464 GCCAATGGGAATGGGGCTTGGGG + Intergenic
1186346313 X:8696823-8696845 GCCATTGGCAATTGTTCCTGGGG + Intronic
1188339365 X:28979781-28979803 GGCAATGGCAATGTATTCTGGGG + Intronic
1188907166 X:35802718-35802740 GGCCATAGCAATGGGTGGTGGGG - Exonic
1192229157 X:69252857-69252879 GGCCATGCCACTGGGTCTTGAGG - Intergenic
1193449443 X:81647429-81647451 AGCAGTGGCAATGTGGCCTGGGG + Intergenic
1194856257 X:98932990-98933012 GGCAATGACAAGGGGACATGTGG + Intergenic
1195544534 X:106100384-106100406 GACAATGGCAATGAGGCATGGGG + Intergenic
1197075822 X:122351128-122351150 GGCAAAGCCAATCGGGCCTGTGG - Intergenic
1197372337 X:125640310-125640332 GGTGATGGAGATGGGTCCTGAGG + Intergenic
1201062563 Y:10060086-10060108 TGAAATGGCAAAAGGTCCTGAGG + Intergenic