ID: 961167980

View in Genome Browser
Species Human (GRCh38)
Location 3:124776774-124776796
Sequence TTTCCTACTCTAATTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961167979_961167980 -4 Left 961167979 3:124776755-124776777 CCAGGCGGGTGTTGTTTTCTTTC 0: 1
1: 1
2: 1
3: 21
4: 255
Right 961167980 3:124776774-124776796 TTTCCTACTCTAATTGTTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961167980 Original CRISPR TTTCCTACTCTAATTGTTGC TGG Intronic
901587666 1:10311532-10311554 TTTCCTATCCTCATTCTTGCTGG + Intronic
903740510 1:25556035-25556057 CTTCCTGCTCTAAATGTTACTGG - Intronic
904342062 1:29842650-29842672 GTTCTTACTCTTATTGTTGCTGG - Intergenic
908641847 1:66232585-66232607 TTTCCAATTCTAAATGTTGGAGG - Intronic
910607889 1:89107139-89107161 TATCCTACTACAATTGTTTCAGG - Intronic
911491699 1:98577444-98577466 TTTCTTGCTCAAATTGTTCCAGG - Intergenic
912994708 1:114521311-114521333 TTTGATACTCAAATTGTTCCAGG - Intergenic
913273321 1:117115411-117115433 TTTGCTACTCTTATTCTTCCTGG - Intronic
914622052 1:149419453-149419475 TTTGCTCATCTAGTTGTTGCTGG - Intergenic
914887057 1:151594049-151594071 TCTACTTCTCTAACTGTTGCAGG + Intergenic
917308144 1:173648580-173648602 ATTCCTAAGCTAAGTGTTGCAGG - Intronic
918243217 1:182638064-182638086 TTGCCTCATATAATTGTTGCAGG + Intergenic
918932885 1:190879222-190879244 TTTCTTGCTCAAATTGTTTCAGG - Intergenic
918965817 1:191346386-191346408 TTTCCTAATCAAATTATTGCTGG - Intergenic
921466651 1:215496246-215496268 TTTCCAACTCTTATTCTTGAAGG + Intergenic
921722769 1:218491862-218491884 TTTCCTTAACTAATTTTTGCGGG + Intergenic
922588624 1:226755114-226755136 GTTCCTACTGTAATTGTTTTGGG + Intergenic
924879305 1:248141901-248141923 TTTGCAACTCTAATTTGTGCAGG - Intergenic
1063156225 10:3381702-3381724 TTTCCTTATGTTATTGTTGCTGG + Intergenic
1063928861 10:11009046-11009068 ATTGCTTCTCTAATTGTTCCTGG + Intronic
1065231888 10:23606865-23606887 TTTCCTTCTCAAATTGGTGGTGG - Intergenic
1066011662 10:31200201-31200223 CTTCCTACTATAATTCTTGGTGG + Intergenic
1068650508 10:59517605-59517627 TTTCTGACTCTCATTGTTTCAGG + Intergenic
1071792450 10:88969596-88969618 ACTCCTACTCAAATTGTTTCTGG + Intronic
1074233044 10:111556628-111556650 TTTCTTCCTCTAATTTTTCCTGG - Intergenic
1076393066 10:130118392-130118414 TTTATTATTCCAATTGTTGCGGG - Intergenic
1081104168 11:39044120-39044142 TTCACTTCTCTAATTTTTGCAGG + Intergenic
1081590534 11:44419798-44419820 TTTCCAATTCTAGTTGTTCCTGG - Intergenic
1083088703 11:60177506-60177528 CTTCCAACTCTAGTTTTTGCTGG + Intronic
1084537975 11:69768989-69769011 TTTCCTTCGCTAATTGTGCCTGG + Intergenic
1086108254 11:83169954-83169976 TTTCCTACTGTCATTGGAGCAGG - Exonic
1088227725 11:107639931-107639953 TTCCCTACTCTTATTTTTTCAGG + Intronic
1092470007 12:8769579-8769601 TTTTCTTTTCTAATTTTTGCTGG + Intronic
1097291368 12:57918533-57918555 ATTACTACTGTAATTGTTGCAGG - Intergenic
1099171996 12:79376121-79376143 TTTCTTAATCTAAATGTTACAGG + Intronic
1100161300 12:91864202-91864224 TCTCCTACCCTAATATTTGCTGG + Intergenic
1100777030 12:97986336-97986358 CTTGCTACTCTCATTGTTGCAGG - Intergenic
1100792512 12:98146156-98146178 TTTCCTACTGTTGTTGATGCTGG - Intergenic
1100973087 12:100092268-100092290 TGTCCTAATCTGATTGTTTCAGG - Intronic
1101886948 12:108672830-108672852 GTTACTACTGTAATTGTTTCGGG + Intronic
1102453165 12:113056353-113056375 TTTCCTCCTCTAACTATTCCTGG - Intergenic
1103448383 12:121009969-121009991 TCTCTTACTCTCATGGTTGCAGG + Intronic
1104097647 12:125572736-125572758 TTTATTACTATAATTGTTTCAGG - Intronic
1108866818 13:54933852-54933874 TTTCCTTCTCAAAGTGTTACAGG - Intergenic
1113850285 13:113413870-113413892 TTTCCTAATTTAGTTGTTGGTGG + Intergenic
1115280515 14:31656686-31656708 GTTACTACTGTAATTGTTGTGGG - Intronic
1115834476 14:37383566-37383588 TTTCATACTGTAATAGTTGCTGG + Intronic
1116270565 14:42759876-42759898 TATCATACTCTAATAGTTACAGG + Intergenic
1116302404 14:43200974-43200996 TTTCATTTTCTAATTATTGCTGG - Intergenic
1117528861 14:56639445-56639467 TTTGTTACTTTAATTTTTGCAGG - Intronic
1118974702 14:70666596-70666618 CTTCCTAATCTAGTTGTTGGAGG - Intronic
1120260019 14:82171984-82172006 TTACCTCCTCTAATTGTGTCTGG + Intergenic
1123822989 15:24049988-24050010 TTTGCTGCTCAAATTGTTTCAGG - Intergenic
1124178414 15:27449146-27449168 TTTCCTTCACTTATTGGTGCAGG - Intronic
1126287403 15:47028754-47028776 TTTCTTACTCTCATTGTCTCTGG - Intergenic
1126413095 15:48392468-48392490 TTTCCTCCTCTTGTTGTTTCAGG + Intergenic
1131377831 15:91940086-91940108 TTTCCTTCTCTCCTTGTTCCTGG + Intronic
1131501329 15:92969773-92969795 TTTACTATTCTTATTGTTGGTGG - Intronic
1133759671 16:8788384-8788406 TCTCCAACTCAAAGTGTTGCTGG + Intronic
1141351542 16:83302772-83302794 ATTCCCACTCTTATTGTGGCTGG - Intronic
1142912677 17:3109226-3109248 TTTAAAATTCTAATTGTTGCAGG + Intergenic
1143902480 17:10184549-10184571 CTTGCTACTCAAATTGTGGCCGG + Intronic
1147777044 17:42909385-42909407 TTTCCTCATCAAGTTGTTGCTGG + Exonic
1148567698 17:48643220-48643242 GTTCCTCCTTAAATTGTTGCCGG - Intergenic
1150461093 17:65353449-65353471 TTTCATTTTCTAATTGTTGCTGG - Intergenic
1151952326 17:77362013-77362035 TTTCCTACCCTCAGTGTTGGGGG + Intronic
1158264260 18:55642716-55642738 TTTCCAACTATAATTTTTGTTGG - Intronic
1158656152 18:59336410-59336432 TTTGCTGCTCAAATTGTTTCAGG - Intronic
1158737352 18:60098434-60098456 TTTCCTATTCTACTGCTTGCAGG + Intergenic
1159430327 18:68343981-68344003 TTTACCACTTTAATTGTTTCAGG - Intergenic
1164947353 19:32307631-32307653 TGTCCCACTCTCATTGTTGGTGG - Intergenic
929116425 2:38448247-38448269 TTTCCTACTCTGATTTTAGAAGG + Intergenic
929407190 2:41656304-41656326 TTGAATACTCAAATTGTTGCAGG - Intergenic
930031158 2:47058847-47058869 TTTCCTACTCCTCTGGTTGCAGG + Intronic
930311302 2:49743626-49743648 TTTCCTACTCTAACAGTCCCTGG + Intergenic
930559403 2:52941888-52941910 TTTCCTACTTTCAGTGCTGCAGG + Intergenic
931352570 2:61505180-61505202 TTTCCTGGTCTCATTGTTGCTGG + Intronic
932117936 2:69070082-69070104 TTTCTTACTCTGATTGTTCAAGG - Intronic
932279050 2:70473606-70473628 TTTCCTACTGTAAATGTGACAGG - Intronic
938129214 2:128696280-128696302 TTTCCTTCTCTTCTTGTTGCTGG + Intergenic
939290859 2:140193160-140193182 TTTACTACTCATATTGCTGCTGG + Intergenic
940579728 2:155562849-155562871 TTTCTTTCTTTAAATGTTGCAGG + Intergenic
941150635 2:161909942-161909964 TTTTCTACTTTAGATGTTGCTGG + Intronic
942953081 2:181744054-181744076 TTTCCTTTTCTAATTGTTTAAGG - Intergenic
943516018 2:188887558-188887580 GTTGCTACTGTAATTGTAGCGGG - Intergenic
943954018 2:194162838-194162860 TTACCTACTCTAATTGCCCCGGG - Intergenic
947387862 2:229609996-229610018 ATTCCTATTATAATTTTTGCAGG - Intronic
947511756 2:230761614-230761636 ATTCCTACTCTAAATGGTCCTGG + Intronic
1169960796 20:11157726-11157748 CTTCCTACTCTGTTTGTTGATGG - Intergenic
1174388466 20:50201041-50201063 TTTCCTGCTTTTATTCTTGCAGG + Intergenic
1174935077 20:54858539-54858561 TTTCCTGAGCTAATTGTTGCTGG + Intergenic
1178042757 21:28658325-28658347 TTTCCCACTCTATTGGTTTCGGG - Intergenic
1182940067 22:34268428-34268450 TTTCCTAAGCTAAGTGTTGAAGG + Intergenic
1183623440 22:38987761-38987783 TTTCCTACACTCCATGTTGCAGG - Intronic
1183627744 22:39014959-39014981 TTTCCTACACTCCATGTTGCAGG - Intronic
1183630250 22:39028218-39028240 TTTCCTACACTCCATGTTGCAGG - Intronic
1183633676 22:39048087-39048109 TTTCCTACACTCCATGTTGCAGG - Intronic
949510311 3:4761376-4761398 TTTCCTAAGCAAATTGATGCAGG - Intronic
949795333 3:7843745-7843767 TTTATTAATCTAATTGTTTCAGG + Intergenic
950351788 3:12362103-12362125 TTTCATTTTCTACTTGTTGCTGG + Intronic
950817830 3:15725704-15725726 ATTCCTACTGTAATTGTTTTGGG + Intronic
951096807 3:18641832-18641854 GTTACTACTGTAATTGTTTCAGG - Intergenic
952127961 3:30324316-30324338 TTTCCCAATCTAATTGTCTCTGG + Intergenic
952853170 3:37745534-37745556 TTTCCTACTCTTATAGTTTTGGG + Intronic
955611413 3:60761175-60761197 TTTGCAATTCTAATTCTTGCTGG - Intronic
955825127 3:62938015-62938037 TTTCCTACTCTCTTTCTTACTGG + Intergenic
956193344 3:66628035-66628057 GTTCCTACTCAAATTCTTCCTGG + Intergenic
957767379 3:84643467-84643489 TTGCCTACAATACTTGTTGCTGG + Intergenic
959908532 3:111737111-111737133 TTTCCTCCTGTAACTGTAGCTGG - Intronic
960190359 3:114697271-114697293 TTTCATACTTTAAATGTTGTTGG + Intronic
960504790 3:118479434-118479456 TTTTCTGGTCTAATTGTTACTGG - Intergenic
961167980 3:124776774-124776796 TTTCCTACTCTAATTGTTGCTGG + Intronic
961268598 3:125670488-125670510 TCTCCTACTCTTTTTGTTTCTGG + Intergenic
963310970 3:143709475-143709497 TTTCATACTCAAAGTGTGGCTGG - Intronic
964942162 3:162171946-162171968 TCTACTACTCTAATTGTTTTGGG + Intergenic
964966554 3:162501256-162501278 TTTATTATTTTAATTGTTGCTGG + Intergenic
971012927 4:22458952-22458974 TTTCCTACCATAGTTTTTGCTGG - Intronic
971857994 4:32067919-32067941 TATCCTAATCTAATTAATGCAGG - Intergenic
975416016 4:74105528-74105550 GTTCCAAGTGTAATTGTTGCAGG - Intergenic
976165964 4:82254904-82254926 CTTCCTACTCAAATTGTGCCGGG - Intergenic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
978859777 4:113434568-113434590 TTTCCTAGTCAAAATTTTGCTGG + Intergenic
980447931 4:132936189-132936211 TTTTATACTTTAATTATTGCTGG + Intergenic
981890004 4:149725113-149725135 TTTGATACTATAATTGTTACAGG + Intergenic
983658501 4:170107704-170107726 TTTACTACTGTAATTGTTTGGGG - Intergenic
989604400 5:43230078-43230100 TTTCTTACTCCATTTGTTTCTGG - Intronic
990800661 5:59599070-59599092 TTTCTTACTCTAATATTTGAGGG - Intronic
991993338 5:72363028-72363050 TTGCCTACCCAAATTGTAGCAGG - Intergenic
992153598 5:73931445-73931467 TTTCTTACTGTAACTGTTGCTGG + Intronic
995787038 5:115841500-115841522 CTTCCTACTTCAATTGCTGCTGG - Exonic
1000695570 5:164377190-164377212 TTTCCTGATCCAATTTTTGCTGG - Intergenic
1000698573 5:164420155-164420177 TTTTCTTCTCTAATCTTTGCTGG + Intergenic
1001548512 5:172585571-172585593 TTTCCTACCCAAGTTGTTGTGGG - Intergenic
1004098840 6:12587341-12587363 TTTCCCTCTCTAAATGTTACCGG - Intergenic
1004919809 6:20366065-20366087 TTTCCTCGTCTGATTGCTGCTGG - Intergenic
1007056059 6:38886141-38886163 TTTCCTCTTCTCATTGTTCCAGG - Intronic
1008210176 6:48712477-48712499 TTTCCTAGTTTAATTATTGTGGG - Intergenic
1008426929 6:51369698-51369720 TTTTCTATTCTAATTGATGAGGG - Intergenic
1008869439 6:56255136-56255158 TTTCCAGCTCTAATTGCTGTGGG + Intronic
1011028829 6:82898959-82898981 TCTCCTACTCTCATTTTAGCAGG - Intronic
1011908522 6:92404759-92404781 GTTCCTACTGTAATTGTTTTTGG - Intergenic
1013097125 6:106955602-106955624 CTGCCTAGTCTCATTGTTGCAGG + Intergenic
1013300837 6:108803666-108803688 TCTCCTGCTCTAAATGTTGGGGG - Intergenic
1013923936 6:115445591-115445613 TTTCCTAGTCTCTTTGTTCCTGG - Intergenic
1014876123 6:126662267-126662289 ATTCATAGTCCAATTGTTGCAGG - Intergenic
1015501015 6:133933229-133933251 TTTCCTACTATTATTGTTTGGGG - Intergenic
1017709956 6:157158571-157158593 TTACCTACTCTGAGTATTGCTGG + Intronic
1017802144 6:157906886-157906908 GTTCCCAATCTAATTGTTACAGG - Intronic
1018491393 6:164297302-164297324 TTACAAACTCAAATTGTTGCAGG - Intergenic
1019166573 6:170101402-170101424 TTTCCTACTCACAGTGTTGTTGG - Intergenic
1020173942 7:5867481-5867503 TTTCCTCCTCTTATTTTTTCTGG + Intergenic
1024723116 7:52160416-52160438 TTTTTTATTCTAAGTGTTGCTGG + Intergenic
1025766553 7:64459858-64459880 TTTCATACTATTACTGTTGCGGG + Intergenic
1026483631 7:70799342-70799364 TTGGCTACTATCATTGTTGCTGG - Intergenic
1027386996 7:77668699-77668721 TTTACTAATAAAATTGTTGCAGG - Intergenic
1028496994 7:91472953-91472975 TTTCCTACTACCATTTTTGCTGG - Intergenic
1029084805 7:98002924-98002946 TTTCCTCCTCTTATTTTTTCTGG - Intergenic
1030663517 7:112248726-112248748 TTTCCTAGTCTGATTGTTTTAGG + Intronic
1031448650 7:121886516-121886538 TTTCCTACTCTGATAGTAGATGG - Intronic
1032730251 7:134634644-134634666 TTTGCTGCTCTGATTGTTCCAGG - Intergenic
1034758831 7:153651348-153651370 TTTCTTTCTCTGATTGTTCCTGG - Intergenic
1037753191 8:21695928-21695950 CTTCCTACTCTCATTGTTTCAGG + Intronic
1041241722 8:55854053-55854075 TTGCCTTGTCTAACTGTTGCAGG - Intergenic
1041394866 8:57379781-57379803 TTTCCTTCTGTAATTATTGGTGG + Intergenic
1043043260 8:75288855-75288877 TTTCCTGGACTAATTATTGCAGG - Intergenic
1044337614 8:91005941-91005963 TTTCTTACTCGAATGGTAGCTGG - Intronic
1044806789 8:96016652-96016674 TTTCTTACTCTACTAGTTCCTGG - Intergenic
1045264669 8:100609068-100609090 TTTCAGACTCTCATTGTTCCTGG + Intronic
1050088358 9:1990696-1990718 TTTCTTATTGTTATTGTTGCTGG + Intergenic
1051660456 9:19421336-19421358 ATTCATACATTAATTGTTGCTGG - Intronic
1053172496 9:35899486-35899508 GTTACTACTGTAATTGTTTCGGG - Intergenic
1053296467 9:36917924-36917946 ATTCCTATTCTAATTGTTTCAGG + Intronic
1057164619 9:92915967-92915989 TTTCTTACTCTGATTCTTCCAGG - Intergenic
1059141630 9:111858307-111858329 TTTCCCAAGATAATTGTTGCTGG + Intergenic
1060381490 9:123178443-123178465 TATGCTACTATAATTGTTGAGGG + Intronic
1188204540 X:27338606-27338628 TTTAATCTTCTAATTGTTGCAGG - Intergenic
1190689480 X:52901473-52901495 AATGCTACTCTAGTTGTTGCTGG - Intronic
1190696503 X:52954319-52954341 AATGCTACTCTAGTTGTTGCTGG + Intronic
1192331497 X:70178876-70178898 TTTCATATTATAGTTGTTGCAGG + Intronic
1192447856 X:71223998-71224020 TTTTCTTCTCTATGTGTTGCTGG - Exonic
1194916070 X:99710618-99710640 TTTTCTAATCTATTTGTTACAGG + Intergenic
1194940026 X:99998253-99998275 TTTCTTCCTCTAATGGATGCAGG + Intergenic
1195762303 X:108259719-108259741 TTTCCCTCTCTAATCTTTGCAGG - Intronic
1195987984 X:110652544-110652566 TTTCCAACACCAATTGTTGAAGG - Intergenic
1196518693 X:116646374-116646396 ATGCTTAATCTAATTGTTGCTGG + Intergenic
1196942643 X:120792560-120792582 ATTACTATTCTACTTGTTGCCGG + Intergenic
1199470922 X:148194952-148194974 TTTCCTATTCTAAATGATTCAGG - Intergenic
1202169694 Y:22029989-22030011 TTTCCTACTGTACTTGTTCGGGG + Intergenic
1202221672 Y:22556384-22556406 TTTCCTACTGTACTTGTTCGGGG - Intergenic
1202321447 Y:23639290-23639312 TTTCCTACTGTACTTGTTCGGGG + Intergenic
1202549320 Y:26030766-26030788 TTTCCTACTGTACTTGTTCGGGG - Intergenic