ID: 961168554

View in Genome Browser
Species Human (GRCh38)
Location 3:124780085-124780107
Sequence TGCCTCAGAGGCCTCGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 221}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961168554_961168569 14 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168569 3:124780122-124780144 TCAGGGAGGCCTCTGAGGCAGGG 0: 1
1: 1
2: 5
3: 65
4: 489
961168554_961168570 20 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168570 3:124780128-124780150 AGGCCTCTGAGGCAGGGCACAGG 0: 2
1: 1
2: 3
3: 44
4: 430
961168554_961168573 28 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168573 3:124780136-124780158 GAGGCAGGGCACAGGGACCATGG 0: 1
1: 1
2: 1
3: 75
4: 620
961168554_961168568 13 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168568 3:124780121-124780143 CTCAGGGAGGCCTCTGAGGCAGG 0: 1
1: 1
2: 11
3: 80
4: 519
961168554_961168575 30 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168575 3:124780138-124780160 GGCAGGGCACAGGGACCATGGGG 0: 1
1: 0
2: 3
3: 54
4: 443
961168554_961168563 -3 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168563 3:124780105-124780127 GCAGGGCACGGGGACCCTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 235
961168554_961168565 9 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168565 3:124780117-124780139 GACCCTCAGGGAGGCCTCTGAGG 0: 1
1: 0
2: 9
3: 79
4: 462
961168554_961168562 -4 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168562 3:124780104-124780126 GGCAGGGCACGGGGACCCTCAGG 0: 1
1: 0
2: 3
3: 25
4: 308
961168554_961168564 0 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168564 3:124780108-124780130 GGGCACGGGGACCCTCAGGGAGG 0: 1
1: 0
2: 1
3: 42
4: 276
961168554_961168571 21 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168571 3:124780129-124780151 GGCCTCTGAGGCAGGGCACAGGG 0: 1
1: 2
2: 4
3: 34
4: 364
961168554_961168574 29 Left 961168554 3:124780085-124780107 CCCTCAGCGAGGCCTCTGAGGCA 0: 1
1: 1
2: 3
3: 19
4: 221
Right 961168574 3:124780137-124780159 AGGCAGGGCACAGGGACCATGGG 0: 1
1: 0
2: 2
3: 32
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961168554 Original CRISPR TGCCTCAGAGGCCTCGCTGA GGG (reversed) Intronic