ID: 961172558

View in Genome Browser
Species Human (GRCh38)
Location 3:124808352-124808374
Sequence CAGGACCTCCAGAAGATGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961172555_961172558 27 Left 961172555 3:124808302-124808324 CCTGTCAACAAAGCAAGTCAGGA 0: 1
1: 0
2: 0
3: 12
4: 208
Right 961172558 3:124808352-124808374 CAGGACCTCCAGAAGATGTGTGG 0: 1
1: 0
2: 0
3: 13
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961172558 Original CRISPR CAGGACCTCCAGAAGATGTG TGG Intronic
900638999 1:3679358-3679380 CTGGACCTCCAGTAGGGGTGCGG + Intronic
901816110 1:11794440-11794462 GAGGAGCTGCTGAAGATGTGGGG - Exonic
902456469 1:16536929-16536951 GAGGACCTCCAGAGGAGGTTAGG - Intergenic
902495694 1:16870982-16871004 GAGGACCTCCAGAGGAGGTTAGG + Intronic
904334884 1:29790335-29790357 AAGGACCTGGAGCAGATGTGGGG - Intergenic
904588195 1:31591876-31591898 CAAGATCCCAAGAAGATGTGAGG - Intergenic
905324244 1:37139261-37139283 CAGGGAAACCAGAAGATGTGGGG + Intergenic
905344658 1:37303024-37303046 CAGGACCTCCAGAAGAATCTGGG + Intergenic
906028800 1:42700125-42700147 CATGAGTTCCAAAAGATGTGGGG + Intronic
906208775 1:44000828-44000850 CAGGACATCCAGATGATGCTGGG - Exonic
906294765 1:44642806-44642828 CAGGCCGAGCAGAAGATGTGAGG + Intronic
906318895 1:44804765-44804787 CAGCACCTCATGAAGGTGTGAGG + Exonic
906913969 1:49987498-49987520 CAAGACATCTAGAAAATGTGAGG + Intronic
910813548 1:91263849-91263871 AGGGACCAACAGAAGATGTGTGG - Intronic
911091769 1:94022872-94022894 CTGCACCTCCAGAACAGGTGCGG - Intronic
911608824 1:99938460-99938482 CAGGAACTTCAGAATATTTGGGG - Intergenic
912623330 1:111187809-111187831 CTGGATCTCCAGAACCTGTGAGG - Intronic
913661797 1:121011178-121011200 GAGGACCTCCAGAGGAGGTTAGG - Intergenic
913996486 1:143654912-143654934 GAGGACCTCCAGACGAGGTTAGG - Intergenic
914013170 1:143794358-143794380 GAGGACCTCCAGAGGAGGTTAGG - Intergenic
914164656 1:145166827-145166849 GAGGACCTCCAGAGGAGGTTAGG + Intergenic
914376324 1:147077005-147077027 GAGGACCTTCAGAGGAGGTGAGG + Intergenic
914505772 1:148287899-148287921 GAGGACCTCCAGACGAGGTTAGG + Intergenic
914506782 1:148296267-148296289 GAGGACCTCCAGACGAGGTTAGG - Intergenic
914651794 1:149702967-149702989 GAGGACCTCCAGAGGAGGTTAGG - Exonic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
921220994 1:212973938-212973960 CAGGATCTGAAGGAGATGTGAGG - Exonic
921269244 1:213452549-213452571 CTGGACCTAGAGAAAATGTGGGG - Intergenic
922240120 1:223750067-223750089 CTGGACATGCAGAAGATCTGCGG - Intronic
923546992 1:234930329-234930351 CAGGACAGCCAGGAGAGGTGTGG - Intergenic
1069724963 10:70571583-70571605 CAGGACCCCCAGAAGATTGAGGG - Intergenic
1070832938 10:79431371-79431393 CAGGACCCACTGGAGATGTGGGG + Intronic
1072782592 10:98260676-98260698 CAGGACATCCAGCAGGTGTTGGG - Intronic
1073228239 10:101943153-101943175 CAAGACATCTAGAGGATGTGGGG + Intronic
1074116547 10:110460871-110460893 CAGGACCTCGAGAACAGGTGGGG - Intergenic
1074249972 10:111735268-111735290 CAGAACCTCCAGAAGAAGCATGG - Intergenic
1075265977 10:120999807-120999829 CAGGACGTCCGGGAGTTGTGAGG + Intergenic
1075630656 10:123998848-123998870 CAGAACCTCCAGCAGAGGAGAGG - Intergenic
1076858390 10:133128321-133128343 CAGGCCATCCAGCAGCTGTGGGG - Exonic
1077809363 11:5621964-5621986 CAGGACCTCCTGAGGCTGTCAGG + Intronic
1077998791 11:7476293-7476315 CAGGGCCTCCCCAAGCTGTGTGG + Intergenic
1081607137 11:44534416-44534438 CAGGACTGCCAGCAGATCTGAGG + Intergenic
1081706001 11:45182139-45182161 CAGGAGACCGAGAAGATGTGGGG - Intronic
1081995582 11:47361526-47361548 CAGGAAGTCCCGCAGATGTGTGG - Intronic
1082833993 11:57639034-57639056 CTGCACCTCCAGAAGTTGTAGGG + Intergenic
1083795262 11:65013399-65013421 CAAGAAGTCCAGAAGAAGTGAGG - Intergenic
1083902505 11:65650465-65650487 GAGGACCTGCAGAAGGTGAGGGG + Exonic
1084942411 11:72620069-72620091 CAGGAGCTCCAGCAGAGGTGGGG - Intronic
1086055315 11:82639876-82639898 CATGAAGACCAGAAGATGTGGGG + Intergenic
1087944502 11:104141814-104141836 TACGCCCTCCAGAAGGTGTGTGG + Intronic
1088820499 11:113452558-113452580 GAAGAATTCCAGAAGATGTGTGG - Intronic
1090598304 11:128342975-128342997 CATCTCCTCCAGAACATGTGTGG - Intergenic
1090921928 11:131214474-131214496 CAGGACCCAGAGCAGATGTGAGG + Intergenic
1096562982 12:52450400-52450422 GAGGACCTCAAGAACAAGTGAGG - Exonic
1096565134 12:52472060-52472082 GAGGACCTCAAGAACAAGTGAGG - Exonic
1102274606 12:111571549-111571571 CTGGACCTCCACAAGCAGTGAGG + Intronic
1102900385 12:116632071-116632093 CAGGACACCCAGATGACGTGTGG - Intergenic
1103263977 12:119613505-119613527 CAGGACCTACTTAAGATGTCGGG + Intronic
1104256779 12:127146330-127146352 CAGCACCTCCAGGAGACGCGCGG + Intergenic
1105695247 13:22882001-22882023 CAGGACTTCCTGAGGCTGTGTGG + Intergenic
1106932496 13:34682047-34682069 GAGGACTTCCAGAAAGTGTGTGG + Intergenic
1107988203 13:45794062-45794084 TAGCACCTTCAGAAGCTGTGTGG + Intronic
1113778010 13:112959955-112959977 CAGCACCTCCTGCAGGTGTGGGG + Intronic
1115066920 14:29274408-29274430 CACTACCTACAGGAGATGTGTGG + Intergenic
1115163355 14:30420363-30420385 CAGGACCTCCAGAAGTAGGCAGG + Intergenic
1123187261 14:106531613-106531635 CAGGACCTGCAGGAGAAGAGGGG + Intergenic
1125332039 15:38591929-38591951 CAGGACAACCAGAAGTTGGGGGG - Intergenic
1125684777 15:41557949-41557971 CAGGACCTCTGGAAGGGGTGTGG + Intronic
1126903206 15:53336184-53336206 CAGGACATCCTGTAAATGTGTGG + Intergenic
1128672621 15:69585963-69585985 CAGGACTTCCAGAACATGGAGGG - Intergenic
1129114629 15:73358332-73358354 CAGTATCTTCAGAGGATGTGAGG - Intronic
1129125453 15:73436751-73436773 CTGCACCTCCAGCAGATGTTAGG - Intergenic
1129607424 15:77031677-77031699 CAGGACACCCTGGAGATGTGGGG - Intronic
1129706080 15:77795331-77795353 CAGGACCCCCAGAATGTGGGAGG - Intronic
1132462716 16:63325-63347 CAGGACCTCTAGGTGCTGTGGGG - Intronic
1133364101 16:5197357-5197379 CAGGACCTTCAAAAGATGGAAGG + Intergenic
1135784136 16:25333019-25333041 CATGACCACCAGAAGATTAGTGG - Intergenic
1136064421 16:27749310-27749332 CAGGACAGTCAGAAGCTGTGTGG + Intronic
1138505410 16:57475941-57475963 CAGCACCTCCGGTAGATCTGTGG + Exonic
1142590754 17:1004759-1004781 TGGGAACTCCAGAAGTTGTGGGG - Exonic
1143022290 17:3923097-3923119 TAGGACCTACAGAAGAGCTGGGG + Intergenic
1147341074 17:39753736-39753758 AAGTTCCTCCAGTAGATGTGTGG - Intergenic
1147444657 17:40467479-40467501 CAGGACCTCCAGCTCATGTTGGG - Intergenic
1147664567 17:42138409-42138431 CTGGACCTCCTGAAGGTGGGAGG - Intronic
1147679022 17:42227622-42227644 CAGGCCCTCCAGGAGCTGGGTGG + Exonic
1147686640 17:42289907-42289929 CAGGCCCTCCAGGAGCTGGGTGG - Exonic
1148578510 17:48727747-48727769 CAGGGCCTCCTGGAGAAGTGAGG + Intronic
1151121518 17:71798191-71798213 CAGGACTTGCAGAAGATGCTAGG + Intergenic
1152253386 17:79223495-79223517 CAAGACCTCCAGGGCATGTGTGG - Intronic
1152350121 17:79779411-79779433 CTGGCCTTCCAGAAGAAGTGAGG + Exonic
1152832209 17:82504334-82504356 CAGGAGCTCCTGAAGGTCTGCGG + Intergenic
1155055278 18:22176949-22176971 CAGGTCCTCCAGCAGGTCTGCGG - Exonic
1155509938 18:26566427-26566449 CAGGACAGCCAGAAGGTGTTCGG - Intronic
1156832651 18:41513396-41513418 GACTACCTCCTGAAGATGTGTGG + Intergenic
1157477165 18:48030816-48030838 CAAGACCACCAGGAGGTGTGTGG - Intronic
1162790101 19:13058258-13058280 CAGGGCCTACAGGAGAGGTGAGG - Intronic
1163471731 19:17501114-17501136 CAGGAGCTCCACAAAATGTGTGG + Intronic
1164715145 19:30385460-30385482 CAGGAACTCCAGGAGAAGAGAGG - Intronic
1167732379 19:51267963-51267985 CAAGCCCTGCTGAAGATGTGGGG - Intronic
1168724127 19:58571336-58571358 GAGCACCCCCAGAAGATGAGGGG - Exonic
1202707361 1_KI270713v1_random:33284-33306 GAGGACCTCCAGAGGAGGTTAGG - Intergenic
925565158 2:5244545-5244567 CAGGACCTCCTCATGATTTGGGG - Intergenic
925785160 2:7424764-7424786 CAGGTCCTTCAGCAGATCTGAGG - Intergenic
927528561 2:23771960-23771982 GAGGACCTCCAGAATATGCCTGG + Intronic
927939475 2:27094715-27094737 CTGGACCTCCAAAAGGAGTGGGG - Intronic
928122841 2:28595860-28595882 CAGGACCTGCAGAAGAGGCTCGG + Intronic
928469189 2:31556665-31556687 CAGAGCTTCCAGAAGAAGTGTGG + Intronic
928982204 2:37147687-37147709 CAGGACCTCCACATGATAGGAGG - Exonic
929386754 2:41416979-41417001 CAGAGCCAACAGAAGATGTGGGG + Intergenic
929570492 2:43019798-43019820 CAGGACCCCCAGCAGATGAGAGG + Intergenic
932331885 2:70902359-70902381 CAGGAATTCCAGCAGGTGTGTGG + Intronic
932421134 2:71602112-71602134 CAAGACCTCCAGAAGAAGGAAGG - Intronic
934692034 2:96369047-96369069 AAGGACCTGCAGAGGAGGTGCGG + Exonic
936945922 2:117930652-117930674 AGGGACCTCAAGAAGCTGTGTGG - Intronic
937256769 2:120561231-120561253 CAGGACCTCCTGACGATGGAGGG + Intergenic
937487987 2:122335680-122335702 CAGGCTCTCCAGATGCTGTGTGG - Intergenic
938319476 2:130353577-130353599 CAGGGCCTCTGGAAGATGTGGGG + Intergenic
938763770 2:134446931-134446953 CAGAAGCCCCAGCAGATGTGCGG + Intronic
940875130 2:158890814-158890836 CAGGAACTCCAGGGGCTGTGAGG + Intergenic
944634626 2:201663244-201663266 CAGGACATTCAGAAGATACGTGG + Intronic
948833589 2:240613140-240613162 CAAGAGCTCCAGAAGATACGCGG + Intronic
1169280341 20:4261941-4261963 CAGGACCGCCAGGAAATCTGTGG + Intergenic
1169773698 20:9229172-9229194 AAGGATCTCCAGAGGAAGTGTGG + Intronic
1172325892 20:34034201-34034223 CATGGCCTCCATAAAATGTGAGG - Intronic
1172479718 20:35263931-35263953 CAGGGCATCCAGAAGATCTATGG + Exonic
1172778715 20:37423197-37423219 CAGGACCTCAGGGAGATGTTTGG - Intergenic
1173049746 20:39547809-39547831 CAGGACCTCCAAGATATGTAAGG - Intergenic
1173665035 20:44757231-44757253 GAGGACCACCAGAGGAGGTGGGG - Intronic
1173921622 20:46750479-46750501 CAGGACTGCCTGAAAATGTGAGG - Intergenic
1177876924 21:26645159-26645181 CAGAACCTCCAGCAGTTGTAAGG + Intergenic
1178020424 21:28402001-28402023 CAGAACCTGCAGAAAAGGTGGGG - Intergenic
1184133669 22:42533237-42533259 TAGGCCCTCCACAAGAGGTGTGG - Intergenic
1184136312 22:42552029-42552051 CAGGCCCTCCACAAGAGGTGTGG + Intergenic
949433703 3:4005557-4005579 CTGGAAATCCACAAGATGTGTGG + Intronic
950542814 3:13622268-13622290 CAGGACCCCCAGAAGCTCCGTGG + Intronic
952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG + Exonic
953848693 3:46449115-46449137 CAGGAGCTACAGTACATGTGTGG + Intronic
954365436 3:50143645-50143667 CAGGACCTCTCCAAGGTGTGGGG + Intergenic
954444117 3:50537443-50537465 CAGGAACTGGAGAAGAGGTGGGG + Intergenic
955043080 3:55335586-55335608 CAGCACTTCCAGAAGAGATGAGG + Intergenic
955936391 3:64106876-64106898 CAGATCCTCCAGAGGATGTAGGG - Intronic
959179734 3:102963121-102963143 CCAGACCCCCAGATGATGTGTGG + Intergenic
960185894 3:114638393-114638415 CAGGAAGTCCAGAAGTTGAGAGG - Intronic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
961172558 3:124808352-124808374 CAGGACCTCCAGAAGATGTGTGG + Intronic
961373841 3:126449524-126449546 CAGGACCGCCAGGTGAGGTGTGG - Intronic
961664204 3:128486195-128486217 CAGGGCCTCCAGCAGCTGAGGGG + Exonic
962065528 3:131975568-131975590 CAGGGCCTGCAGAAGCAGTGTGG - Intronic
963840940 3:150105810-150105832 CAGGATGTCCAAAAGTTGTGGGG + Intergenic
966039408 3:175463072-175463094 GAAGACCTTCAGGAGATGTGGGG - Intronic
966962970 3:184959122-184959144 CAGGAACTTCAGAATATTTGGGG - Intronic
967890569 3:194361543-194361565 CAGCACATTCAGATGATGTGAGG - Intronic
967992230 3:195139886-195139908 CAGAATCTCCAGAAGCTGGGAGG - Intronic
969161279 4:5261101-5261123 CAGTACCTCCAGCAGCTGGGGGG + Intronic
970645169 4:18111588-18111610 CAGGCCCTCCAGTAGCTGAGTGG + Intergenic
971388640 4:26164832-26164854 CAGCAATTCCAGAAGGTGTGGGG + Intronic
972034906 4:34507527-34507549 CAGGAACTCAACAAGAGGTGAGG - Intergenic
972110813 4:35556922-35556944 CAGGAGCTCCAAAAGGTGAGTGG + Intergenic
973142090 4:46781825-46781847 CAGCAGCTGCAGAGGATGTGCGG + Intronic
977886260 4:102255487-102255509 CATGACCACCAGAAGCTCTGGGG + Intronic
979700355 4:123659583-123659605 CAGTACCTCCAGAGCAAGTGTGG + Intergenic
984447514 4:179855509-179855531 CAGGAACTCCAGAGGATGGGAGG - Intergenic
985753093 5:1694068-1694090 CAGATCCTCCAGAAGGTCTGAGG - Intergenic
985876186 5:2598575-2598597 CATGAACTGGAGAAGATGTGAGG + Intergenic
985987809 5:3532096-3532118 CCGGACCCCCAGCAGGTGTGTGG + Intergenic
986238746 5:5937811-5937833 CAGAACCCCCAGAAGGTGTCGGG - Intergenic
990341695 5:54829651-54829673 CAGCACCTCCAGAACATTTTGGG - Intergenic
991361325 5:65823871-65823893 CAGAAACTCCAGAAGAGGAGTGG + Exonic
995262030 5:110115391-110115413 CAGGACCACCATCATATGTGTGG - Intergenic
997964820 5:138348584-138348606 CAGGAGATCCAGAAAATGTCAGG - Exonic
999109896 5:149109989-149110011 CTGGATCTCCAGAAGATATTAGG + Intergenic
1000366945 5:160500551-160500573 CCGGACCTACAGAAATTGTGGGG + Intergenic
1002944442 6:1747701-1747723 CAGGACCTCCAGTAGTTTTGTGG + Intronic
1006096412 6:31659378-31659400 CAGCAGCTCCAGAAGATGCAGGG + Exonic
1006669938 6:35723843-35723865 CAGGATGTCCTGATGATGTGTGG - Intronic
1007304660 6:40894521-40894543 GAGGCCCTCCAGGAGATGGGGGG + Intergenic
1008210989 6:48726074-48726096 ATGGACCTGCAGAAGATTTGGGG + Intergenic
1008789582 6:55214090-55214112 CAGCAGCTCCAGAAGAACTGTGG + Intronic
1013635070 6:112021353-112021375 CAGGGCCTCCAGAAGAGGTCTGG - Intergenic
1014252538 6:119129258-119129280 CAGGACCTCCTGAGGATCTGTGG + Intronic
1015004632 6:128264133-128264155 CTGGACCTACATCAGATGTGGGG - Intronic
1016439394 6:144067816-144067838 AAAGACCTACAGAAGATGTGAGG + Intergenic
1016826334 6:148391841-148391863 CAGGACCTCCTCAAGAAGTGGGG + Intronic
1019693897 7:2433749-2433771 CAGGACCGCCAGCAGCTGGGAGG + Exonic
1020488379 7:8747889-8747911 CAGTACCTTCAGAAAATGAGTGG + Intronic
1021936473 7:25636855-25636877 CAGGACTTCCAGAACAGGGGTGG + Intergenic
1024147660 7:46533788-46533810 CAGGACATCCAGAAATTCTGGGG - Intergenic
1025110708 7:56213808-56213830 CAGTAGCTCCAGAGGCTGTGTGG + Intergenic
1025232213 7:57210399-57210421 CAGGATCTACGGAAGATGGGTGG - Intergenic
1028703597 7:93812712-93812734 CAGAAACTCCAAAAGATATGAGG - Intronic
1030122674 7:106125462-106125484 CAGGACCTCAAAAGGATGTAAGG - Intergenic
1032948470 7:136879475-136879497 CATGATTTCCAGAAGATATGGGG - Intronic
1034104844 7:148481610-148481632 CAGCCCATCCAGAAGTTGTGGGG - Intergenic
1037096916 8:14996709-14996731 AAGGAGATCCAGAAGATGTCTGG - Intronic
1040874090 8:52132100-52132122 GAGGACAGCCAGAAGCTGTGCGG + Exonic
1041886660 8:62816912-62816934 CAGGACCTGCAAGAGTTGTGGGG + Intronic
1041908031 8:63054818-63054840 CATGTACTCGAGAAGATGTGGGG - Intronic
1044099654 8:88118699-88118721 CAGGGCATCCAGAAGATATATGG - Exonic
1046651079 8:116837267-116837289 CAGGACCTACAGAAGTTGCATGG + Intronic
1047003864 8:120599350-120599372 GATTACCTCCAGAAAATGTGAGG + Intronic
1048233027 8:132662484-132662506 CACATCCTACAGAAGATGTGAGG - Intronic
1048450401 8:134528455-134528477 CAGGAAATCCAGAAACTGTGAGG - Intronic
1048968897 8:139633414-139633436 GAGGACCTCCTGGAGCTGTGAGG + Intronic
1049717336 8:144099166-144099188 CAGCACCCCCAGAAGATGGACGG - Exonic
1050664791 9:7923435-7923457 ATGGACCACCATAAGATGTGTGG - Intergenic
1051068929 9:13138724-13138746 CATCACCTCTTGAAGATGTGGGG - Intronic
1056932662 9:90891820-90891842 GAGGCCCTCCAGAAGATGCAGGG + Intronic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1059064800 9:111072036-111072058 CAGGCTCTCCTGAAGTTGTGAGG - Intergenic
1060471628 9:123952699-123952721 CAGGACCACCAGAAGACCAGAGG + Intergenic
1061239533 9:129361549-129361571 CAGGATCTCCAGGAGCTCTGAGG + Intergenic
1188565633 X:31523213-31523235 CATGACCTCCAGAAGATTAAGGG - Intronic
1200927426 Y:8666964-8666986 CAGCAGCTCCTGAAAATGTGTGG - Intergenic
1200983766 Y:9285667-9285689 CAGCACCTCCAGAAGGTGGTGGG + Intergenic
1201669199 Y:16497594-16497616 CAGTACCTCCAGCAGGCGTGGGG + Intergenic
1202180082 Y:22132406-22132428 CAGGAGCTCCTGAGGCTGTGTGG + Intergenic
1202211278 Y:22453993-22454015 CAGGAGCTCCTGAGGCTGTGTGG - Intergenic