ID: 961173779

View in Genome Browser
Species Human (GRCh38)
Location 3:124817564-124817586
Sequence CCTCAGTGGGAGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 590}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961173768_961173779 1 Left 961173768 3:124817540-124817562 CCTGAGCCCGCGGCAGCTGCAGG 0: 1
1: 1
2: 3
3: 31
4: 376
Right 961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 590
961173771_961173779 -5 Left 961173771 3:124817546-124817568 CCCGCGGCAGCTGCAGGGCCTCA 0: 1
1: 0
2: 3
3: 54
4: 359
Right 961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 590
961173764_961173779 30 Left 961173764 3:124817511-124817533 CCAAGAAGAGCAGCACGGAGAAC 0: 1
1: 0
2: 2
3: 8
4: 143
Right 961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 590
961173772_961173779 -6 Left 961173772 3:124817547-124817569 CCGCGGCAGCTGCAGGGCCTCAG 0: 1
1: 1
2: 5
3: 56
4: 399
Right 961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 590
961173766_961173779 5 Left 961173766 3:124817536-124817558 CCCACCTGAGCCCGCGGCAGCTG 0: 1
1: 0
2: 1
3: 19
4: 171
Right 961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 590
961173767_961173779 4 Left 961173767 3:124817537-124817559 CCACCTGAGCCCGCGGCAGCTGC 0: 1
1: 0
2: 1
3: 26
4: 328
Right 961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961173779 Original CRISPR CCTCAGTGGGAGAGGGTGGA AGG Intronic
900300378 1:1973951-1973973 CCCCTGGGGGAGAGGGCGGAGGG + Intronic
900347389 1:2216221-2216243 GTTCAGTGGGTGAGGGTGGCAGG + Intergenic
900502980 1:3015738-3015760 CCTCAGTGGCAGAGAGGGAAGGG - Intergenic
900790269 1:4675376-4675398 CCTCAATGGGAGAGGATGGCCGG - Intronic
900809029 1:4787218-4787240 CTACAGTGGGAGGAGGTGGATGG + Exonic
900975919 1:6016261-6016283 CCTCACTCGGAGATGTTGGAGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902391789 1:16111211-16111233 CCTGAGTGGGAGATGGAGGGAGG - Intergenic
902835387 1:19043768-19043790 ACTGGGTGGGAGGGGGTGGAGGG + Intergenic
902882404 1:19381290-19381312 CATCTGTGTGAGAGGGAGGAGGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903269163 1:22177053-22177075 CCTCATTGGAAGGGGGTGGGTGG + Intergenic
903600280 1:24533157-24533179 CCACCGGGGGAGAGGCTGGAGGG - Exonic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905082880 1:35340353-35340375 CGTCAGAGGGAGAGGCAGGATGG + Intronic
905401786 1:37708925-37708947 CATGAGTGCGAGAGGGTAGACGG - Exonic
905973440 1:42157629-42157651 CCCCAGTGAGTGAGGATGGAGGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907281029 1:53347110-53347132 CATCAGTGGGAATGGGTGAAGGG + Intergenic
907751755 1:57269657-57269679 TCTCAGGGTGAGAGGTTGGAGGG - Intronic
908326680 1:63029999-63030021 CCTCAATGGGAGAAGAGGGATGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908676547 1:66610975-66610997 ACTCGGTGGGAAAGGGTGGGAGG + Intronic
909009458 1:70318330-70318352 CTTCAGTCGGAGAAGGAGGAAGG - Intronic
909228080 1:73051227-73051249 ACTCAGGAGGGGAGGGTGGATGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910420623 1:87058035-87058057 CCTCGGGGTGAGTGGGTGGAGGG + Intronic
912481305 1:109984200-109984222 CCTCATTGGGATAGGGCTGATGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914845482 1:151281583-151281605 CCTCTGCGGGAGGGCGTGGACGG - Exonic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915835268 1:159171431-159171453 CTCCCGGGGGAGAGGGTGGAAGG + Intergenic
916889830 1:169104966-169104988 CCCCAGTGGGGGAGGCTGCAGGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918072223 1:181141466-181141488 CCACAGTGTGAGAGTGTGGGTGG + Intergenic
918399874 1:184152835-184152857 CCGCAGTGGGAGAGATTGCAGGG - Intergenic
918708341 1:187696387-187696409 TCTCAGTGGGAGAGGGTAGGAGG + Intergenic
919992788 1:202720466-202720488 TCCCTGTGGGTGAGGGTGGAAGG - Intergenic
920535250 1:206732883-206732905 CCAGAGTGGGAGAGGCTGGGAGG + Exonic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
921116804 1:212099528-212099550 CCAAAGTGTGAGAGGGTGGCTGG - Intronic
921899368 1:220434394-220434416 CCACAGTGGAAGAGTGTAGAAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922866441 1:228864961-228864983 CTTCTGTGGGAGAAGATGGAAGG + Intergenic
923035863 1:230284837-230284859 CCACGGTGGGAGGGGATGGAGGG - Intergenic
923994053 1:239471635-239471657 CCTCAGTGGGAGAGGAGAGAAGG - Intronic
924659107 1:246000425-246000447 CCCCAGTGGGAGAGAAGGGAAGG - Intronic
1062979208 10:1707890-1707912 GGTCAGTGGGAGAGGTTGCAGGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064052376 10:12069371-12069393 CCTCAGTTACAGAGGATGGACGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064670013 10:17703706-17703728 CCTATTTGGGAGAGGCTGGAAGG - Intronic
1065045384 10:21743642-21743664 TCTCATTTGGAGAGGATGGAGGG + Intergenic
1066202861 10:33158873-33158895 ACTCGGGGGGAGAGGGTGGGAGG + Intergenic
1066511174 10:36098363-36098385 CTTAAGTGGGACAGGGTGGCTGG - Intergenic
1067089788 10:43260660-43260682 CCGCAGTGGGAAAGGTGGGAGGG - Intronic
1067767053 10:49094771-49094793 TCTCAGTGGCAGGGGGTGGGGGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069739999 10:70681411-70681433 TCTCCGTGGGAGAGGGAGAATGG + Intronic
1069755147 10:70769948-70769970 CCCCAGTGGAAGAGGGGCGAGGG + Intergenic
1069853426 10:71425162-71425184 CTGGAGTGGGTGAGGGTGGAAGG + Intronic
1070460122 10:76658067-76658089 CCTAGATGGGGGAGGGTGGAAGG + Intergenic
1070580739 10:77717225-77717247 CCTCCCTGGGGGATGGTGGAGGG + Intergenic
1070602256 10:77873979-77874001 CCTCAGTGTGAGCTGGAGGAGGG - Intronic
1070846337 10:79525109-79525131 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1070927460 10:80235197-80235219 CCTGTGTGGGAGACTGTGGAGGG + Intergenic
1071561313 10:86648843-86648865 CCTGAGTGGGAGTGAGGGGAGGG + Intergenic
1072001711 10:91201588-91201610 CCTCAGGGGCTGTGGGTGGAGGG - Intronic
1072407913 10:95171657-95171679 CCTGTGTGGGAGACTGTGGAGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072897139 10:99376764-99376786 CCTCACTGGGAGAGGTTGTGGGG + Intronic
1073083605 10:100874734-100874756 CCTTAGTAGTAGAGGGTGTAGGG - Intergenic
1073481560 10:103789161-103789183 CGTCAGTGGGGGAGGATGGGGGG + Intronic
1074458651 10:113616911-113616933 CCTCTGTGGGAAAGGTTGGCTGG - Intronic
1074873333 10:117595009-117595031 CCTCAGAGGGAGAGGTTCGGGGG + Intergenic
1075099704 10:119497482-119497504 CCTAAGTGGGGGCGGGCGGAAGG + Intergenic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1076890089 10:133279151-133279173 CCTCCGTGGGAGTGGGTCGAGGG - Exonic
1077060855 11:617323-617345 CGGCTGGGGGAGAGGGTGGAGGG + Exonic
1077107314 11:847859-847881 CCTCTGTGGCTGGGGGTGGAAGG - Intronic
1077494847 11:2881996-2882018 CCCCTGTGGGAGAGGTTGGAAGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079446544 11:20561894-20561916 ACTCAAAGGGTGAGGGTGGAAGG + Intergenic
1080660353 11:34291286-34291308 TCCCAGTGGGAGAGGCTGGCTGG - Intronic
1081824913 11:46040253-46040275 CCTCAGTGGAAAAGAGAGGAAGG + Intronic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083768429 11:64853358-64853380 CCACAGTGGGAGGTGGTGGTGGG - Exonic
1084289476 11:68152552-68152574 CCTCAGTGAGGGTGGGTGCAGGG + Intergenic
1084518811 11:69650559-69650581 CCTGAGCGGGAGAGGATGGAGGG + Intronic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1085242305 11:75068196-75068218 GCTCAGGGAGAGAGGGTGGGTGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1085625116 11:78065908-78065930 CCTCAACGGGAGAGGGAAGAAGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088063063 11:105680712-105680734 CCTCACTGGGGAAGGGAGGAGGG - Intronic
1088098592 11:106129407-106129429 GAGCAGTTGGAGAGGGTGGAGGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1089144674 11:116317123-116317145 CCTCAGTGGGAGATTGGGCATGG - Intergenic
1089256882 11:117198918-117198940 CCCCAGGAGGAGAGGGTGGCTGG + Intergenic
1090231340 11:125107643-125107665 CCTCAGTGAGAGGAGGTGAAGGG + Intronic
1090423341 11:126590664-126590686 CCTCAGTGGGAGAGTGATGGAGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090939344 11:131373653-131373675 TCTCAGTGGCAGAAGGTGGGCGG - Intronic
1091006905 11:131961790-131961812 TCTCAGTGGGAAAGGTTGCATGG - Intronic
1091230933 11:133987534-133987556 CCTCATCGGGAGAGGCTGGGTGG + Intergenic
1091713376 12:2758848-2758870 GCTCAGGGGGAAAGGGTGGGAGG + Intergenic
1091776720 12:3189469-3189491 CTACAGAGGGAGAGGGTGCAGGG + Intronic
1091789043 12:3260777-3260799 GCTGAGTGGTGGAGGGTGGAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092708831 12:11312479-11312501 TCTCTGTGGGTGAGGGTGGGTGG + Intergenic
1092756182 12:11765695-11765717 CCTCAGTGGGAAAGCGTGCATGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093079404 12:14791974-14791996 ACTCAGTGGGGAAGGGTGGGAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096798421 12:54093065-54093087 CTTTAGTGGTAGAGGGTGGTAGG + Intergenic
1097451010 12:59736853-59736875 GCTCAGTGGGAGGGATTGGAAGG - Intronic
1097553343 12:61104343-61104365 CCTCAGTGGAAGTGGGTGTTAGG - Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099644893 12:85340512-85340534 TCTCTGTGAGAGAGGGTGGCAGG - Intergenic
1099832120 12:87857470-87857492 CCACTGTGGGAGAGGGAGGAAGG - Intergenic
1100389903 12:94139279-94139301 GCTCAGTGGGCCAGGGTGGCTGG + Intergenic
1100712565 12:97274035-97274057 GGTCTGTGGGAGATGGTGGAAGG - Intergenic
1101041588 12:100761182-100761204 CCTCAGTGGTGGAGGAAGGAAGG + Intronic
1101397629 12:104362474-104362496 CCGCAGTGGGGGAGGTTGGAAGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101990450 12:109479907-109479929 CCTCAATGGCAGAGGGTCCATGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1104415475 12:128594037-128594059 CCTCAGTGGGTGGTGGGGGAGGG - Intronic
1104577864 12:129984355-129984377 GCTCTGTGGGAGATGGTAGAAGG + Intergenic
1105923814 13:24988420-24988442 CCTGAGTGGGAGAGAGTCCAGGG - Intergenic
1107664494 13:42674895-42674917 CCTCAGTGAGAGCAGGTGGAAGG - Intergenic
1107816761 13:44251332-44251354 CCTCAGTGGCTGGGGGTGGGGGG - Intergenic
1108167662 13:47709955-47709977 CCACAGAGGCAGAGGGTGGGTGG - Intergenic
1110439967 13:75516880-75516902 CCATAGTGGCAGAAGGTGGAAGG - Intergenic
1110755771 13:79172116-79172138 ACTCAGGGGGAAAGGGTGGGAGG - Intergenic
1111330324 13:86757558-86757580 GGTCAGTGGGAGAGGGGGTAGGG + Intergenic
1111354571 13:87080738-87080760 CCGCGGTGGGAGAGGCTGGCCGG - Intergenic
1112116683 13:96363247-96363269 CATCAATGGGAGTGGGTGAAGGG + Intronic
1112137368 13:96596093-96596115 TCACAAGGGGAGAGGGTGGAAGG - Intronic
1112398881 13:99058640-99058662 CTCCACTGGGTGAGGGTGGATGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113741677 13:112715917-112715939 CCTTAGTGGGAGAAGGGGAAAGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114971609 14:28036686-28036708 TCTCAGTGGGAGCGGGTGGGAGG + Intergenic
1115059071 14:29168637-29168659 GCTCAGGGAGAGAGGGTGAAGGG + Intergenic
1115464737 14:33702702-33702724 CCTGAAGGGGAGAGGGTGGGAGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117404380 14:55387606-55387628 GCTCAGTGAAAGAGGGTGGGAGG - Intronic
1118620261 14:67608556-67608578 CTTCAGTGGGAATGTGTGGAAGG + Intergenic
1118982715 14:70729701-70729723 CCTCAGTGAGAACGGGGGGACGG - Exonic
1119199998 14:72745082-72745104 CCTCAGGGGGTGGGTGTGGAGGG + Intronic
1119577960 14:75745100-75745122 CATCACTGGCAGAGAGTGGACGG - Exonic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121562908 14:94887670-94887692 GCTCAGTGGGAGCTGGGGGAGGG + Intergenic
1122367176 14:101201067-101201089 CATGAGTGGAAGAGGCTGGAGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123425162 15:20164688-20164710 CCTCTGGGGGAGTGGGTGGTGGG + Intergenic
1123534387 15:21171221-21171243 CCTCTGGGGGAGTGGGTGGTGGG + Intergenic
1123789889 15:23709983-23710005 CCTGAGTTGGAAAGGATGGAGGG + Intergenic
1124252473 15:28115919-28115941 CCTCAGTGGGACAGGAAGGAGGG + Intronic
1124529894 15:30496559-30496581 GCTCAATAGTAGAGGGTGGAGGG + Intergenic
1124768765 15:32511129-32511151 GCTCAATAGTAGAGGGTGGAGGG - Intergenic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125637697 15:41203259-41203281 CCTCAGTGGGAGAGGAATGGGGG - Intronic
1125638939 15:41213596-41213618 GCTGAGTGGGAGGAGGTGGAGGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126847073 15:52770163-52770185 CTGCAGTGGGAGAGACTGGAAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127638227 15:60891324-60891346 GTGCAGTGGGAGAGGGTGAAAGG + Intronic
1127797004 15:62447340-62447362 GCACAGTGGGAGAGGCTGGGAGG + Intronic
1127974899 15:63990064-63990086 CCACAGAGGGTGAGGGTGGGTGG - Intronic
1128634243 15:69293020-69293042 ACTCACTGGGAGAGGGGGCATGG + Intergenic
1128757891 15:70195770-70195792 TCTCAGGGGGAAAGGCTGGAGGG + Intergenic
1130063252 15:80584475-80584497 GCACAGTGGGAAAGGGTGCAGGG + Intronic
1130181115 15:81629490-81629512 ACTCAGGGGGAAAGGGTGGGAGG + Intergenic
1131059535 15:89396038-89396060 CCACAGGGGGACTGGGTGGAGGG - Intergenic
1131071653 15:89470073-89470095 CCGCAGCGTGAGAGGGTGCAGGG - Intergenic
1131232597 15:90670564-90670586 GCTCAATGGGAGGGGCTGGAGGG + Intergenic
1131272020 15:90953323-90953345 TCTCAGTGGGGGAGGAGGGACGG + Intronic
1131855781 15:96592334-96592356 CCTCAGTGTGTGGGGGTAGAGGG + Intergenic
1132238545 15:100239901-100239923 CTTCACTGGCTGAGGGTGGAGGG - Intronic
1132603330 16:783500-783522 CCTCACTGGGACAGGGTGCTGGG + Intergenic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1133094634 16:3434291-3434313 CCTCAGTGGGAGAAACTGGCAGG - Exonic
1133164438 16:3936454-3936476 CCTAACTCAGAGAGGGTGGAAGG - Intergenic
1133224915 16:4336480-4336502 CCTCTGTAGCAGAGGGTGCAGGG + Intronic
1133235197 16:4384416-4384438 CCTCAGTGGGATGGAGGGGAGGG + Intronic
1133264458 16:4575054-4575076 CCTCAGTGAGTGAGGAAGGAAGG + Exonic
1133663203 16:7939100-7939122 CTTCAGTAGCAGAGGATGGAAGG + Intergenic
1135207265 16:20493907-20493929 CCACCTTGGGAGAGGCTGGAAGG + Intergenic
1135211620 16:20529725-20529747 CCACCTTGGGAGAGGCTGGAAGG - Intergenic
1135400627 16:22164045-22164067 CCTCAGGTGGAGAGGGAGGTCGG + Intergenic
1136172807 16:28498574-28498596 CCACAGTGGCAGAGGGAGCAGGG - Exonic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137469731 16:48743564-48743586 CCTCAGTGACAGAAGGTGGTTGG - Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139966108 16:70746350-70746372 CATGAGTGGGAGAGGGATGAAGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141173815 16:81706552-81706574 CGTCTCTGGGAGTGGGTGGAGGG + Intronic
1141683070 16:85555334-85555356 ACTCAGAGAGAGGGGGTGGAAGG - Intergenic
1142491827 17:284574-284596 CCCCACTGGGAGAGCATGGAGGG - Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142885974 17:2912270-2912292 CCCCAGGGAGAGAGGGTGGCCGG - Intronic
1143020906 17:3916804-3916826 CCCTGGTGGGGGAGGGTGGAGGG - Intergenic
1143692948 17:8586166-8586188 CTTCAGTGGGAAAGTATGGAGGG - Intronic
1143852087 17:9820610-9820632 CCACTGGGAGAGAGGGTGGAAGG + Intronic
1143940539 17:10536590-10536612 CTTCAGAGGGAGCTGGTGGAGGG - Exonic
1144751782 17:17653754-17653776 CCTCTGTGGGGCAGTGTGGAGGG - Intergenic
1145005961 17:19337897-19337919 CCTTAGTGGTGGAGGGTGGGAGG + Intronic
1146015921 17:29233494-29233516 ACTCAGGAGGGGAGGGTGGAAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147142143 17:38466007-38466029 CATAAGTGGGTGGGGGTGGAAGG - Intronic
1147218943 17:38917012-38917034 CTAGAGTGGGAGAGGGTGGGAGG + Intronic
1147469757 17:40648178-40648200 CCGCGGTGGGAGACGGCGGATGG + Exonic
1147744563 17:42687376-42687398 CCAGAGTCGGAGAGGGTTGAGGG - Intronic
1147924135 17:43936200-43936222 CCTCAGAGGGAAAGGGGGCAGGG + Intergenic
1148076203 17:44936435-44936457 AGTCATTGGGAGTGGGTGGAGGG - Intronic
1148152063 17:45402816-45402838 CCTCTGTGGGAGAGGGAGGAAGG + Exonic
1148338145 17:46855219-46855241 CCGAAGGGGGTGAGGGTGGAGGG + Intronic
1149144487 17:53473812-53473834 CCTCAGTGGGAAAGGAAGTACGG + Intergenic
1150410442 17:64937124-64937146 CCTCTGTGGGAGAGGGAGGAAGG - Intergenic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152048345 17:77953632-77953654 TCTCAGTGAGAAAGGATGGATGG - Intergenic
1152105511 17:78326340-78326362 CAACAATGGGAGAGGGTGGCAGG + Intergenic
1152245153 17:79181625-79181647 CGGCAGTGGCAGAGGGTGGCCGG - Intronic
1152245159 17:79181645-79181667 CAGCAGTGGCAGAGGGTGGCCGG - Intronic
1152260631 17:79264950-79264972 CCTCAGTGCGAGAGGAGGGGGGG + Intronic
1152730291 17:81966739-81966761 GCGCAGTCGGAGAGGGAGGAAGG + Intergenic
1152802813 17:82339789-82339811 CCTCATGGGGAGAGGAGGGAGGG + Intergenic
1152861017 17:82697346-82697368 ACTTAGCGGGAGAGGGTGGGAGG - Intronic
1153774044 18:8437338-8437360 CCCTGCTGGGAGAGGGTGGAGGG - Intergenic
1154111114 18:11569318-11569340 TACCAGTGGGAGATGGTGGAAGG - Intergenic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1155162032 18:23203913-23203935 CCTCAGTGGCAGAAGGCGGCAGG + Intronic
1155361754 18:25010143-25010165 ACTCAGAGGGAAAGGGTGGGAGG + Intergenic
1155733979 18:29198378-29198400 ACTCAGGGGGAAAGGGTGGGAGG + Intergenic
1156474788 18:37398606-37398628 CCTCTGTGGGCCAGGGAGGAGGG - Intronic
1157110839 18:44818825-44818847 TCACAGAGGGAGATGGTGGAAGG - Intronic
1157502735 18:48202627-48202649 CCTCAGTGGGGATGGGTGTACGG + Intronic
1157518691 18:48329812-48329834 CCTCAGTGGCAGAGTAGGGAGGG + Intronic
1157593113 18:48847998-48848020 CCGCAGAGGCACAGGGTGGATGG + Intronic
1158896189 18:61915934-61915956 CCTCTGGGGGAGAAGGTGGGTGG - Intergenic
1158966704 18:62628421-62628443 CCTTAGTGGGAGGGTGTGTAAGG - Intergenic
1159887150 18:73919706-73919728 CCCCAGTGGGAGCTGCTGGAAGG + Intergenic
1160321434 18:77900004-77900026 GCTCAGCTGGAGAGGGTAGAGGG - Intergenic
1161337901 19:3724147-3724169 CCAGAGTGGGAGAGGGGCGAGGG - Intronic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1161520768 19:4722606-4722628 CCTGAGTGGGGGAGGCTGAACGG - Intronic
1161623843 19:5314026-5314048 ACTCAGTGGGCTAAGGTGGAAGG + Intronic
1162017131 19:7851905-7851927 CCTCAGGGGAACAGAGTGGATGG - Intronic
1162158304 19:8694705-8694727 ACACAGTGGGACAGGGTGGGTGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163127735 19:15253397-15253419 CCTCAGTGGGAGGTGGAGGCAGG - Intronic
1163448823 19:17363552-17363574 CCAAAATGGGAAAGGGTGGAAGG - Intronic
1163490977 19:17617031-17617053 ACTTGGTGGGGGAGGGTGGACGG - Intronic
1163492135 19:17623320-17623342 CTTCAGTGGGACAGGGAGGGTGG + Intronic
1163627418 19:18398128-18398150 ACTCAGTGGGAGAGGCTTGGAGG - Intergenic
1164305511 19:24002070-24002092 GCACAGTGGGCGAGAGTGGACGG + Intergenic
1164521634 19:28984133-28984155 TCCCAGGGGGAGAGTGTGGATGG + Intergenic
1164827766 19:31297012-31297034 CCTCAGTGGGAGCGGGAGGTGGG + Intronic
1164835333 19:31351877-31351899 CCGCAGTGGGAGGGGGCCGAAGG - Intergenic
1165040068 19:33062852-33062874 CCGCACTGGGAAAGAGTGGATGG - Intronic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1166137341 19:40785808-40785830 GTTCAGTGGGTGAGGGTGGAAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166422728 19:42651390-42651412 CCTCAGTGTCAGAGCCTGGATGG + Intronic
1166499660 19:43331311-43331333 ACTCCCTGGGAGAGGGTGGGAGG - Intergenic
1167353664 19:48991220-48991242 CCACAGACGGAGAGGGTGCAGGG - Intronic
1167671798 19:50857840-50857862 CAGCAGTGTGAGAGGGTGAAGGG - Intronic
1167791911 19:51688539-51688561 CCCCAGTGGGTGGGGGTGGGGGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168281039 19:55305441-55305463 CCTGAGTGGGAGGGGGTGGTTGG - Exonic
1202683870 1_KI270712v1_random:31367-31389 CCACAGTGGCAGAGGGGGGGAGG - Intergenic
925063926 2:914720-914742 AGTCATTGGGAGAGCGTGGAAGG - Intergenic
925064025 2:915151-915173 AGTCATTGGGAGAGCGTGGATGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926234994 2:11034372-11034394 ACTCAGAGGGGGAGGGTGGTTGG - Intergenic
926403107 2:12520368-12520390 TGTCAGTGGGAGAGGGAGGGAGG + Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
927935218 2:27072262-27072284 CCTCCGGGGGGTAGGGTGGAGGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928201269 2:29249205-29249227 CCTCTGTGGGACAGGGAGCAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929446838 2:42008795-42008817 CCTCAGTGGGGGATGGAGAAGGG + Intergenic
929565059 2:42978860-42978882 CCTCAGAAGGACAGGGAGGAGGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930018581 2:46987137-46987159 CCTCGGTGGGTGGGGGTGGAGGG + Intronic
930089599 2:47521856-47521878 CCTCACTGGGCGAGGGTGGGGGG + Intronic
931294304 2:60906586-60906608 ACTCAGTGGTAGAGGAAGGAGGG - Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932221135 2:69999890-69999912 CTTGGGTGGGAGAGGGAGGAAGG - Intergenic
932794494 2:74682702-74682724 CCTCTTTGGGGGAGGGAGGAAGG + Intronic
935023122 2:99250722-99250744 CCTCTGTGGGAGAGGTTGTGAGG + Intronic
935488026 2:103682166-103682188 CCTCAGTGCTAGACTGTGGAAGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935789261 2:106576052-106576074 CCACAGTGGCAGATGGAGGATGG - Intergenic
936504505 2:113094712-113094734 ACTCAGGGGGAAAGGGTGGGAGG - Intergenic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937262359 2:120594723-120594745 TCTCTGTTGCAGAGGGTGGAGGG + Intergenic
937318206 2:120945401-120945423 CCACAGTGGCCGAGGCTGGAGGG - Intronic
938087362 2:128410210-128410232 CCTCTGAGGGAAAGGGTGGTGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940025999 2:149209080-149209102 GCTTAGTGGGAGATGGAGGAAGG + Intronic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940599743 2:155843975-155843997 CATGAGTGGGAGAGTGAGGAAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941263695 2:163331900-163331922 CCTAAGGAGGAGAGTGTGGACGG + Intergenic
941310809 2:163928530-163928552 CCTCAGTGGCAGAGAGTGAGAGG - Intergenic
942167993 2:173261513-173261535 ACCCGGTGGGAGTGGGTGGAAGG + Intronic
942377997 2:175356592-175356614 CCTCTGTGGGCAAGGGTGGATGG + Intergenic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
943648835 2:190435062-190435084 CCTCAGATGGAGAGGGGGGTTGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943795677 2:191989942-191989964 CCACTTTGTGAGAGGGTGGAAGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946416498 2:219542806-219542828 CCTCAGGGTGAGATGGGGGAGGG - Intronic
947519137 2:230830315-230830337 CCTCACTGTGTGAGGGTGGAAGG - Intergenic
947603252 2:231467677-231467699 CTTCAGTGGAAGAGCCTGGAAGG - Intronic
947705444 2:232271720-232271742 CCTCCGTGGAAGAGAGTGGGAGG + Intronic
947837368 2:233185274-233185296 CCTCAGTTGGAGAAGGAGGCAGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169871784 20:10255389-10255411 ACTAGGTGGGAGAGGGTGAATGG + Intronic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1171797990 20:29581275-29581297 CTTTAGTGGTAGAGGGTGGTAGG - Intergenic
1171850250 20:30302885-30302907 CTTTAGTGGTAGAGGGTGGTAGG + Intergenic
1172033554 20:31997177-31997199 CCTCGGCGGGAGAGCGTGCAGGG + Exonic
1172046562 20:32084565-32084587 CCACAGGGCCAGAGGGTGGAGGG + Intronic
1172245468 20:33442929-33442951 CACCAGTGGGACAGGGAGGAGGG - Intronic
1172274477 20:33672352-33672374 CCACAGTGGGGCAGGGTGGGAGG - Intronic
1173222028 20:41138409-41138431 CCTCTGGGGGAGAGGGAGGAAGG + Intronic
1174123497 20:48285628-48285650 CCACAGTGGGAGAGGAAGCAAGG + Intergenic
1174311604 20:49660035-49660057 CCTGAGTGGGAGAGGGTGTCTGG - Intronic
1174461072 20:50683228-50683250 CCACAGTGAGAGAGGGAGGGAGG + Intronic
1174761573 20:53211883-53211905 CCAAAGAGGGAGAGGGTGGGAGG - Intronic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175191930 20:57217182-57217204 CGGAAGTGGGAGAGGGTGGGTGG - Intronic
1175416372 20:58804017-58804039 CCCCAGTGGGGGAGAGTAGAGGG - Intergenic
1176097704 20:63351961-63351983 CTTCTGTGGGTGGGGGTGGAGGG - Intronic
1176119673 20:63448674-63448696 CCTCTGTGGGAGTGGGGAGAGGG - Intronic
1176277668 20:64282071-64282093 CTTCTGTGGGAGAGTATGGAAGG + Intronic
1176382655 21:6120915-6120937 CCTGGGTGGGTGAGGGTGGCGGG + Intronic
1178974271 21:37208427-37208449 CCCCAGTGGGGGAGGGAGGAGGG - Intergenic
1179017249 21:37604822-37604844 GCTGAGTGGGAGGGGTTGGATGG - Intergenic
1179041197 21:37803643-37803665 CCCCAGTGGGGCAGGGAGGAGGG - Intronic
1179740814 21:43417324-43417346 CCTGGGTGGGTGAGGGTGGCGGG - Intronic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179879478 21:44287426-44287448 CCGCGGTGGGAGGGCGTGGAGGG - Intronic
1179949702 21:44702837-44702859 CAGCAGTGGGAGAGGTTGGGGGG - Intronic
1181437929 22:22921192-22921214 CCCCAGAGGGAGAGGGGAGAGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181979339 22:26754902-26754924 ACTCAGCGGGAAAGGGTGGGAGG + Intergenic
1182310038 22:29397921-29397943 CCTCAGTGTGACAGGGTGGCTGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182662839 22:31937151-31937173 TCACAGTGGGAGTAGGTGGAAGG + Intronic
1183474521 22:38028694-38028716 CCTCTGTGGGATGGGGAGGAAGG + Intronic
1183590175 22:38775450-38775472 AGTCAGTGTGAGAAGGTGGAGGG - Intronic
1183653551 22:39172262-39172284 CTGCAGTGGGAGATGGTGGATGG + Intergenic
1183653564 22:39172317-39172339 CTGCAGTGGGAGATGGTGGGTGG + Intergenic
1183653577 22:39172372-39172394 CTGCAGTGGGAGATGGTGGGTGG + Intergenic
1183952117 22:41357835-41357857 CCCCAGGGGGAGGGGGTGGGAGG - Exonic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184266054 22:43346631-43346653 TCTCAGTGGAAGAGGAGGGAAGG + Intergenic
1184423370 22:44394900-44394922 CCTGAGTGGGGAAGGGTGGAGGG + Intergenic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185197702 22:49482750-49482772 CCCCAGTGTGAGAGGAAGGAGGG + Intronic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
1185417871 22:50720081-50720103 CCTCTGTGGGAGGGGGTTGCCGG + Intergenic
949341206 3:3032912-3032934 CATCGGTAGGAGAGGGTGGCAGG + Intronic
950107246 3:10396130-10396152 CCACAGTGGGAGCTGTTGGAGGG + Intronic
950283149 3:11723988-11724010 CCTCAGTGGGGGATGGGGGGGGG + Intergenic
950305570 3:11913347-11913369 CTTCAGTGGGAGAGGGATGGTGG - Intergenic
950419999 3:12892883-12892905 GCACAATGGGAGAGGGTGGAGGG - Intergenic
950645951 3:14376928-14376950 CAACAGTGGGAGGGGGTGGGTGG - Intergenic
950715062 3:14842135-14842157 CCTCAGAGGGAAATGGTAGAAGG - Intronic
951313999 3:21165821-21165843 CATCTGTGGGGGAGAGTGGAAGG + Intergenic
952817448 3:37457895-37457917 CCTGAGTGTGAGAGTGTGAAGGG + Intronic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
953735185 3:45488028-45488050 CCTCAGTGGCAGAGGGCAGTGGG - Intronic
953925932 3:46982432-46982454 CCCCAGGGGGAGGGGGTGGGTGG - Intronic
954317959 3:49811531-49811553 CTTCTGTGGAACAGGGTGGATGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
956416415 3:69034935-69034957 CCTCAGTGGGATAGTGTTCATGG - Intronic
957219641 3:77365193-77365215 CTTCAGTGGGAAAGTATGGAAGG + Intronic
958854437 3:99367637-99367659 ACTTGGTGGGGGAGGGTGGAAGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960157353 3:114309352-114309374 CCTCTGAGAGAGATGGTGGAAGG - Exonic
960333590 3:116391518-116391540 CCACAGTGGGGTTGGGTGGAGGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960987927 3:123292535-123292557 CCTCTGTGGGTGGTGGTGGAAGG - Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
962444616 3:135453398-135453420 AGTCAATGGGAGAGAGTGGAGGG - Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
965614616 3:170581284-170581306 CCTCAGTGTGAGGGGGTGAGAGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968051272 3:195656676-195656698 TCCCGGAGGGAGAGGGTGGAGGG + Intergenic
968104552 3:195991663-195991685 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
968302843 3:197629246-197629268 TCCCGGAGGGAGAGGGTGGAGGG - Intergenic
968443484 4:636351-636373 CCTGACTGAGAGAGGGTGTAGGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968862831 4:3186080-3186102 CCTCTGTGGGTGAGGGGGCAAGG + Intronic
968888262 4:3348802-3348824 TCTCAAGGGGAGAGAGTGGAAGG + Intronic
969209617 4:5676866-5676888 CCTCAGTGTGAGGGTGGGGATGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970609494 4:17711775-17711797 CCTCATGGGGATAGGATGGAAGG + Intronic
971098632 4:23436819-23436841 TATCATTGGGAGAGGCTGGAAGG + Intergenic
971123686 4:23728698-23728720 TCTAAGTGGGAGATGGTAGAAGG + Intergenic
971468867 4:26997495-26997517 CCTGAGTGGGTGAGGGTGTCAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976745955 4:88403235-88403257 CTTCAGTGGGTCAGGGTAGAGGG - Intronic
977510961 4:97962199-97962221 ACTCAGGGGGAATGGGTGGAAGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980241171 4:130177473-130177495 ACTCAGTGGGTAAGGGTGGAAGG + Intergenic
981014207 4:139956604-139956626 TCAGAGTGGGAGAGGGAGGAAGG + Intronic
981032213 4:140136668-140136690 CCAAATTGGGAGAGGCTGGATGG + Intronic
981128102 4:141130721-141130743 CCTCAGTGGAGGAGGGGTGAAGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982213967 4:153064621-153064643 GCTCAGAGGGAGAGGGTCGTGGG - Intergenic
982455182 4:155601394-155601416 ACTCTGTGGGAAAGGGTGGGAGG - Intergenic
982691573 4:158553431-158553453 CCTGAGTAGGAGAGAGGGGATGG + Intronic
982944828 4:161606983-161607005 CCTCATTAGGAGAGGCTGCAAGG + Intronic
983766664 4:171492325-171492347 CCACACTGGGAGAGGGTTAAAGG + Intergenic
984321276 4:178199349-178199371 CATTAGTGGGACAGGCTGGAGGG - Intergenic
984474607 4:180220070-180220092 ACTCAGGGGGAAAGGGTGGGGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985507954 5:295308-295330 TCCCAGAGGGAGAGAGTGGAGGG + Intronic
985740081 5:1610360-1610382 TCCCAGAGGGAGAGAGTGGAGGG - Intergenic
985928526 5:3036148-3036170 ACTGAGTGGGAGCTGGTGGATGG + Intergenic
986333335 5:6734304-6734326 CCTCAGAGGGCGAGGGTTGGGGG - Intronic
986685234 5:10270577-10270599 CCTCAGTGGGGGAGGGGAGAGGG + Intergenic
986751881 5:10794816-10794838 CATCAGAGTGAGAGGGTGCAGGG - Intergenic
987604949 5:20122026-20122048 CTTCATTGTGAGAGGGGGGAGGG - Intronic
988907533 5:35804560-35804582 GCTCAGTGGGAGGGGAAGGAAGG - Intronic
989412025 5:41130919-41130941 ACTCAGGGGGAAAGGGTGGGAGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992583317 5:78204762-78204784 CCTCAGTGACAGGGGCTGGATGG - Intronic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
994963424 5:106635151-106635173 CCTCAGTGGGAGGGGCAGCAGGG + Intergenic
996586418 5:125092826-125092848 TGTCAGTGGGGGAGGGGGGAAGG + Intergenic
996684952 5:126269774-126269796 CCTCTGTGGGAGAGGAATGAAGG + Intergenic
997025109 5:130051146-130051168 CCTCTGTGGAAGGGAGTGGATGG + Intronic
997264435 5:132486901-132486923 CCTCAGGGAGGGAGGGTAGAAGG - Intronic
997511795 5:134459384-134459406 CCTCCGCGGGAGAGGGAGGCAGG + Intergenic
998216564 5:140242104-140242126 GCTCAGAGGGAGAGGATGAATGG - Intronic
998401880 5:141852621-141852643 CCTCAGGGGGCCAGGGTGTAAGG - Intergenic
999098649 5:149004365-149004387 CCTCATTGGGGGAGGAAGGAAGG + Intronic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1001210188 5:169803785-169803807 TCTCAGTGGGAGTAAGTGGAGGG + Intronic
1001249994 5:170139790-170139812 CCTTTGTGGGAGTGGGAGGAGGG - Intergenic
1002000863 5:176195675-176195697 CCTCATTGGGGGAGTGTGGGGGG + Intergenic
1002001830 5:176200407-176200429 CCTCATGGGGGGAGTGTGGAGGG + Intergenic
1002170967 5:177374004-177374026 CCATAGTGGGACAGGGTGGCTGG - Intergenic
1002197468 5:177509223-177509245 CAGGAGTGGGAGAGGGTCGAAGG - Intronic
1002306843 5:178288529-178288551 CCTCAGAGGGCCAGGCTGGAGGG + Intronic
1002461501 5:179376016-179376038 TCTCAGTGGGGGAGGGGGAAGGG + Intergenic
1002702785 5:181137845-181137867 CCTGAGTGTGAGAGGGTGGCTGG + Intergenic
1004330874 6:14719520-14719542 CTTGAGTGGGAGAGGAAGGAAGG - Intergenic
1004388890 6:15193027-15193049 CCTCAGTTGGAGAGGGTTCTTGG - Intergenic
1005513127 6:26530013-26530035 CCTGATTGGGCGAAGGTGGAAGG - Intergenic
1005740328 6:28785396-28785418 CTTCTGGGGGAGGGGGTGGAGGG - Intergenic
1006020527 6:31115121-31115143 CCTCTGTGGGAGCAGCTGGAAGG + Exonic
1006417870 6:33915509-33915531 CCTCAGTGGGTGATGCAGGAGGG + Intergenic
1006498277 6:34439892-34439914 CCACAGTGTGACAGTGTGGAAGG - Intergenic
1006638956 6:35479265-35479287 CCCCAGTGGGAGTGGGGGAAAGG - Intronic
1006877751 6:37313379-37313401 CCTCAGTGGGCTAAGGTGGGAGG + Intronic
1007077230 6:39075497-39075519 TCTGAGTGGGAGATGGGGGAGGG + Intronic
1007095090 6:39208062-39208084 GCACAGGGGGAGAGGGAGGAGGG - Intronic
1007324954 6:41052918-41052940 CCACTGGGGGAGAGTGTGGAAGG - Intronic
1007837643 6:44686513-44686535 ACTCAGTGGGAAAGGAGGGAAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008631938 6:53370437-53370459 CGGCTGTGGGAGAAGGTGGACGG + Intergenic
1009608250 6:65902393-65902415 CATCAATGGGAGAGTGAGGATGG - Intergenic
1009690997 6:67031673-67031695 CCACAGGGGGAGGGGGTGGACGG + Intergenic
1010180980 6:73086323-73086345 CCTCAGTGTGAGTGGAGGGAAGG - Intronic
1011602762 6:89075246-89075268 CCTCAGTGGTATAAGGAGGAGGG + Intergenic
1012432864 6:99184721-99184743 CCACAGTGGGAGAGGATCCACGG + Intergenic
1013286688 6:108688033-108688055 CCTCAGTAGGGGAGGAGGGAGGG + Intergenic
1013601574 6:111710112-111710134 GCTGGGCGGGAGAGGGTGGAGGG - Intronic
1014930698 6:127332558-127332580 CTTCTGTGGGGGAGGGTGGTGGG + Intronic
1016075324 6:139788724-139788746 TGTCAGTGGGAGGGGGTGGTGGG + Intergenic
1017651710 6:156589346-156589368 CCTCAGTGGGTGGGGGTGGGGGG - Intergenic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1018697945 6:166405395-166405417 GCTCAGGGGGTGAGGGTGGGAGG - Intergenic
1019148011 6:169987068-169987090 CCTCAGTGATAGTGGGTGGGCGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019465429 7:1185600-1185622 CCACGGAGGGGGAGGGTGGACGG - Intergenic
1019488892 7:1301919-1301941 CCTCCGTGTGTGGGGGTGGATGG - Intergenic
1019548856 7:1592364-1592386 CAACAGTGGGAGTGGGTGGTGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019757469 7:2783446-2783468 CCTCAGAGGGTGAGGATGAATGG - Intronic
1019779239 7:2929857-2929879 CTGCAGGGGGAGAGGGTGGTGGG + Intronic
1020558821 7:9703004-9703026 ACTCAGGGGGACAGGGTGGGAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022394876 7:29978413-29978435 CCTCCGTGTCAGAGAGTGGAGGG - Intronic
1024612667 7:51080848-51080870 CCTCACTGGGGATGGGTGGAAGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026316269 7:69230413-69230435 CCTCAGTGGGAGACTGAGGTGGG - Intergenic
1026664434 7:72330215-72330237 CCTCAGAGGTGGAGGGTGCAGGG + Intronic
1026831022 7:73610216-73610238 ACACAGTGAGAGAGGATGGAGGG - Intronic
1026904661 7:74056216-74056238 GCTCAGTGAGAGAGGCTGGGCGG - Intronic
1026980498 7:74523928-74523950 CCGAGGTGGGAGAGGGTGGAAGG + Intronic
1027344599 7:77244779-77244801 GGTCAGTGGGAGGGTGTGGAGGG - Intronic
1029414436 7:100434043-100434065 CCCCAGTGGGAGAGGGGGTTGGG + Exonic
1030422847 7:109330169-109330191 ACTCAATGGGGGAGGGTGGGAGG + Intergenic
1030482217 7:110119514-110119536 CCTCAGTGGGACTGGTTAGACGG + Intergenic
1032019276 7:128397881-128397903 CCAAAATGGGAGAGGGTGGGAGG - Intronic
1032063725 7:128747555-128747577 GCTCAGTGGGGGAGGGTGGGAGG - Exonic
1032098593 7:128953922-128953944 CCTCAGTGGGAAAGGGAGTTGGG - Intergenic
1032713609 7:134485016-134485038 TCTCAGTAGAAGAGGGAGGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034969748 7:155411475-155411497 CCTCAGTGGTAGGTGGGGGACGG - Intergenic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035531643 8:356943-356965 ACTCAGGGGGAAAGGGTGGGAGG - Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036750370 8:11440031-11440053 CCTGGGTGGGAGTGGGGGGAGGG - Intronic
1036795406 8:11752707-11752729 CCTCACTGGGATAGGATTGACGG + Intronic
1037930694 8:22878360-22878382 GCTCTGCGGGAGAGGGTGGAGGG + Intronic
1037963244 8:23115423-23115445 GCTGAGTGGGAGGGGGTGGGTGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038922463 8:32099907-32099929 ACTCAGTGGATGAAGGTGGAGGG + Intronic
1039031469 8:33314234-33314256 CCTCAGTTGGAGAGGCTGCAGGG - Intergenic
1039813228 8:41068587-41068609 CTTCAGTGGGAGAAGAAGGAAGG - Intergenic
1039944611 8:42118674-42118696 CTGTAGTGGGAGGGGGTGGACGG - Intergenic
1039965101 8:42278278-42278300 CCTGGGTGGCTGAGGGTGGACGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040980061 8:53237890-53237912 CCTCAGTGGGAGGATCTGGATGG + Intronic
1040986028 8:53295198-53295220 CCTCAGTGGTAAAGGAAGGAAGG + Intergenic
1041151953 8:54944242-54944264 CTCCAGTGGCAGAAGGTGGAGGG + Intergenic
1042880341 8:73481143-73481165 ACTCAGAGGGAGAGAGTGAAAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046744274 8:117860346-117860368 CCTCAAGGTGGGAGGGTGGAAGG + Intronic
1047206564 8:122806993-122807015 GCTCACTGGTAGAGGGTGGAGGG + Intronic
1048103222 8:131378302-131378324 CCTCAGGGGATGAGAGTGGAGGG + Intergenic
1048440994 8:134458826-134458848 CCACAGTGGGAGTGCGTGGTGGG - Intergenic
1048709900 8:137198070-137198092 CCTCTGTGGGACAAGGGGGAGGG - Intergenic
1048846631 8:138608779-138608801 CCTGAGTGGGGGAGTGTGGTGGG - Intronic
1049270053 8:141690721-141690743 CCTCAGTGGGTGGGGCTGGTGGG + Intergenic
1049426562 8:142540522-142540544 CCTCAGAGCGGGAGGGTGGGCGG + Intronic
1049640385 8:143712558-143712580 CCCCAGTGGGTGGGGGTGCAGGG - Intronic
1049724699 8:144140313-144140335 CCACAGGGGCAGAGGGTGGCTGG - Exonic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050873515 9:10606338-10606360 ACTCAGTGGAAAAGGATGGAGGG - Intronic
1051683253 9:19629854-19629876 CTTCAGTGGGAGAGTGTGAATGG + Intronic
1052767455 9:32656366-32656388 CCTGAGGGTGAGAGGGTGGGAGG + Intergenic
1053056329 9:34995017-34995039 GCTCAGTGAGAGAGGGAGGGAGG - Intronic
1053788029 9:41666177-41666199 CTTTAGTGGTAGAGGGTGGTAGG + Intergenic
1054157104 9:61648591-61648613 CTTTAGTGGTAGAGGGTGGTAGG - Intergenic
1054176305 9:61877519-61877541 CTTTAGTGGTAGAGGGTGGTAGG + Intergenic
1054476879 9:65579596-65579618 CTTTAGTGGTAGAGGGTGGTAGG - Intergenic
1054661234 9:67703289-67703311 CTTTAGTGGTAGAGGGTGGTAGG - Intergenic
1055025179 9:71711919-71711941 ACTCAATGGGAGAGAGTGCATGG + Intronic
1056574229 9:87842977-87842999 CCTCAGTGGAACCGGGGGGAGGG - Intergenic
1057216284 9:93230593-93230615 CCTCACTGGGAGATGGTGCCAGG - Intronic
1057262032 9:93590403-93590425 CAGGAGTGGGAGAGAGTGGAAGG - Intronic
1057892738 9:98881550-98881572 CCCCAGTGGGTGAGGATGGGAGG + Intergenic
1058121982 9:101148743-101148765 TCTCTGTGGGACTGGGTGGAGGG - Intronic
1059140842 9:111851794-111851816 GCCCAGGGGGAGAGAGTGGATGG - Intergenic
1059248924 9:112871013-112871035 CCTCACTGGGAGATGTGGGAAGG + Exonic
1060475493 9:123983611-123983633 CCTCAGTAGGAGGGGCTTGAGGG - Intergenic
1060984976 9:127814751-127814773 CCCCAGAGTGAGAGTGTGGATGG + Intergenic
1061249345 9:129417354-129417376 AGTCACTGGGAGAGGATGGATGG - Intergenic
1061615065 9:131774103-131774125 ACTGAGTGGGAGAGGGTGAGTGG - Intergenic
1062147368 9:134997096-134997118 GGTGAGTGGGAGAGTGTGGAGGG + Intergenic
1062207088 9:135343183-135343205 GCTCAGTGGGACCTGGTGGAGGG - Intergenic
1062253840 9:135611665-135611687 CCTCAGTGGGAGCTTCTGGAGGG - Intergenic
1185952473 X:4451950-4451972 CTTCAGTGAGGGAGGCTGGATGG + Intergenic
1185977571 X:4738633-4738655 CCTCTTTGGGAGCAGGTGGAAGG + Intergenic
1186080413 X:5924846-5924868 ACTCAGAGGGAAAGGGTGGGAGG + Intronic
1186414428 X:9370772-9370794 ATTCAGTGGGAGAGGATGGCCGG + Intergenic
1186979119 X:14939939-14939961 CCACAGTGGGAGGGGGAGGAGGG - Intergenic
1187099356 X:16176945-16176967 TCTCTGAGGGAGAGGGAGGATGG + Intergenic
1188005734 X:25014508-25014530 CCACAGCGGGAGAGGGTGGGGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189489754 X:41461169-41461191 ACTCAGAGGGAAAGGGTGGGAGG - Intronic
1189526031 X:41823027-41823049 CCTCAGCGGGGGTGGGGGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190126455 X:47709686-47709708 CATCAGTGGGGGTGGGTGGATGG + Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1192900033 X:75486803-75486825 CCACTGTGGGAGATGGTGGAGGG - Intronic
1193568750 X:83114459-83114481 ATTCAGTGGGAGAGAGAGGAAGG + Intergenic
1194191985 X:90848604-90848626 CCACTGTGGGAGATGGTGGGGGG + Intergenic
1194600568 X:95915798-95915820 CCTCAGTTGCAGAGAATGGATGG + Intergenic
1195741867 X:108072939-108072961 TCTCAGTGGTGGCGGGTGGAGGG + Intronic
1196627472 X:117892691-117892713 CCTCAGTGGTGGTGGGAGGAAGG + Intergenic
1197664120 X:129204853-129204875 ACTCAGGGGGAAAGGGTGGGAGG - Intergenic
1199704001 X:150408216-150408238 CATCACTGGGAGAGGGTGACTGG + Intronic
1200686468 Y:6264039-6264061 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200688008 Y:6274209-6274231 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200954411 Y:8929859-8929881 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200992011 Y:9355286-9355308 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200994666 Y:9375566-9375588 TCTCAGTGGGAGAGCTGGGAAGG - Intronic
1200997329 Y:9395912-9395934 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200999843 Y:9464449-9464471 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201002502 Y:9484758-9484780 TCTCAGTGGGAGAGCTGGGAAGG - Intronic
1201005161 Y:9505045-9505067 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201007820 Y:9525372-9525394 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201010436 Y:9545562-9545584 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201047259 Y:9900493-9900515 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1201060206 Y:10037746-10037768 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1201987506 Y:19985721-19985743 ACTCATTGGGACTGGGTGGACGG - Intergenic
1202111485 Y:21426628-21426650 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1202116959 Y:21477509-21477531 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1202232537 Y:22671248-22671270 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1202310619 Y:23524910-23524932 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1202560183 Y:26145684-26145706 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic