ID: 961174338

View in Genome Browser
Species Human (GRCh38)
Location 3:124821474-124821496
Sequence CCTGAAGGACAGAAGGTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 418}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961174330_961174338 16 Left 961174330 3:124821435-124821457 CCAGCAAATGCAGTGCATCCTTT 0: 1
1: 0
2: 5
3: 14
4: 155
Right 961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 57
4: 418
961174333_961174338 -9 Left 961174333 3:124821460-124821482 CCAGCCAATCTTCTCCTGAAGGA 0: 1
1: 0
2: 1
3: 10
4: 165
Right 961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 57
4: 418
961174331_961174338 -2 Left 961174331 3:124821453-124821475 CCTTTCGCCAGCCAATCTTCTCC 0: 1
1: 0
2: 1
3: 10
4: 148
Right 961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 57
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961174338 Original CRISPR CCTGAAGGACAGAAGGTGGA TGG Exonic
900092491 1:926476-926498 GCTGAAGGCCAGAGGGTGCAAGG + Intronic
900174702 1:1286551-1286573 CCAGAAGGAGGGAAGGTGGGAGG + Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
902761061 1:18581006-18581028 GGTGAAGGAGAGATGGTGGAGGG - Intergenic
903084548 1:20843801-20843823 ACTGGAGGACAGAAGGTGGAAGG - Intronic
903283128 1:22261549-22261571 GCTGAGGGACAGGAGGTGGTGGG + Intergenic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903460301 1:23516299-23516321 CCAGAGGGACAGGAGGTGGGGGG - Intronic
904490141 1:30853554-30853576 CATGCAGGACTGAAGGCGGAAGG - Intergenic
905358166 1:37399271-37399293 CCTCAAGGAAAGAAGGTGATGGG - Intergenic
906109802 1:43315062-43315084 CCTGAGGGACAGAAGGGTGTGGG - Intronic
906794968 1:48689480-48689502 GAAGAAGGACAGAAGGAGGAAGG - Intronic
906803528 1:48758275-48758297 CTTTGAGGACAGAAGATGGAAGG - Intronic
907275664 1:53315321-53315343 CCTGAAGGACAGATGGGAGAGGG + Intronic
907525893 1:55053820-55053842 CCTGAAGGTCAGTGTGTGGAGGG + Intronic
908981328 1:69962819-69962841 ACTGGAGGACAGAGGGTGGGAGG + Intronic
910111969 1:83692755-83692777 CCTTAAGGGTAGGAGGTGGAAGG - Intergenic
910352425 1:86313512-86313534 CCTGATGGATAGAAGATGAAGGG + Intergenic
910889561 1:92003024-92003046 TCTAAAGGTGAGAAGGTGGAAGG + Intronic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
911877288 1:103184097-103184119 CATGAAAGATAGAAGGTTGAAGG - Intergenic
912187257 1:107292971-107292993 TCTGAAGGGCATAAGGCGGAAGG - Intronic
912560519 1:110548274-110548296 CCTGAGGGGCAGAAGTGGGAAGG - Intergenic
913667390 1:121060793-121060815 CCTGAAGGAGAGAAGCTGTGGGG - Intergenic
914019081 1:143847936-143847958 CCTGAAGGAGAGAAGCTGTGGGG - Intergenic
914657632 1:149756143-149756165 CCTGAAGGAGAGAAGCTGTGGGG - Intergenic
914846744 1:151287669-151287691 ACTGGGGGACAGAAGGTGAATGG + Exonic
915104778 1:153527020-153527042 CCTGAAGGCCAGAGGGTGAATGG + Intergenic
916014787 1:160740340-160740362 CTTGAGGGAGATAAGGTGGAGGG + Intronic
916411178 1:164548686-164548708 CATGAAGGACACATGGAGGACGG - Intergenic
918132316 1:181640260-181640282 CCTGAAGGCCTGAAGGTACATGG - Intronic
918407372 1:184224183-184224205 CCAGACGGCCAGAAGGTGGGTGG - Intergenic
921205451 1:212844949-212844971 CATGAGGGACAGAAGTTGGAAGG - Intronic
921294847 1:213692043-213692065 ACTGAAGGACATAAGGCAGAAGG + Intergenic
922237492 1:223733103-223733125 CCTGCAGGACAGGAGGTGTGTGG - Intronic
922321047 1:224487385-224487407 ACAGAAAGACAGAAGGAGGAAGG - Intronic
922486836 1:225979898-225979920 GCTGAAGGAAAGAATGTGCATGG - Intergenic
922494059 1:226042135-226042157 CCTGAAGTACAGAAAGCAGAGGG - Intergenic
922845098 1:228678405-228678427 CGTGAGGGACAGAAGTTGGAAGG + Intergenic
923253110 1:232195211-232195233 CCTAAATGACACAAAGTGGATGG - Intergenic
923799827 1:237197643-237197665 CCTGTAGGAATGAGGGTGGAAGG + Intronic
924883835 1:248190488-248190510 CCTGAAAGACATAAGGAGAATGG + Intergenic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1064811657 10:19206866-19206888 GCTGTAGGGCAGAAGGTGAATGG - Intronic
1065245164 10:23748806-23748828 CATGAAGAACAGAAGTAGGAAGG - Intronic
1067282904 10:44886402-44886424 CCTGCAGGAGAGAAGGGGGAGGG - Intergenic
1070123435 10:73600579-73600601 ACTTGAGGATAGAAGGTGGAAGG + Intronic
1071699347 10:87913403-87913425 CTTGAAGGACAGAAGGCAGTGGG - Intronic
1072230305 10:93408915-93408937 TCTGCAGCACAGAAGGGGGATGG + Exonic
1072780698 10:98249353-98249375 GCAGAAGGTCAGAGGGTGGAAGG + Intronic
1073523964 10:104162167-104162189 CCTGGAGGAGAGAAGGGGAAAGG + Intronic
1074027103 10:109647675-109647697 CCTGAAGTACATTAGCTGGAGGG - Intergenic
1075094265 10:119460780-119460802 CCTCAAGGGCAGAAGATGCAGGG + Intergenic
1076526749 10:131116919-131116941 CCTGAAGGACCGAAGGCTGCGGG - Exonic
1076830535 10:132992224-132992246 CCTCGAGGACAGAGGGTGGACGG + Intergenic
1077280606 11:1743430-1743452 GATGAAGGACAGATGGAGGATGG + Intronic
1077379545 11:2223161-2223183 CCTGAAGGAAAGAATAGGGAGGG + Intergenic
1078397778 11:10996813-10996835 CTTTGAGGACAGAAGTTGGAAGG - Intergenic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1078577690 11:12515813-12515835 CCTGATGGATAGAAGCTGGGAGG + Intronic
1078743921 11:14092937-14092959 GCAGAAGGACAGAAGATTGATGG - Intronic
1079215149 11:18503343-18503365 CCTGAAGAAGAGAAGCTTGAGGG - Intronic
1079997295 11:27307567-27307589 GTTGTAGGACAGAAGATGGAGGG - Intergenic
1080750242 11:35144148-35144170 CCTGATGGAGAGGAGGTGGTTGG + Intronic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1081450397 11:43165924-43165946 CCTGTAGGAGAGTAGATGGAAGG + Intergenic
1081472931 11:43393608-43393630 CCCGAAGGACAGGGGGAGGATGG + Intronic
1082943076 11:58728412-58728434 ACTGAGGGGCATAAGGTGGAAGG - Intronic
1083191290 11:61054136-61054158 CCTCAAAGACAGTATGTGGATGG + Intergenic
1083732681 11:64661232-64661254 GCTGCAGGGCACAAGGTGGAGGG - Intronic
1083816827 11:65137547-65137569 CCTGAAGGGCAGAGTGTGGGAGG - Intergenic
1085692675 11:78676415-78676437 TCAGAAGGAACGAAGGTGGAGGG + Intronic
1085804652 11:79624084-79624106 GGTGAAGGACAGGAAGTGGAGGG + Intergenic
1085988343 11:81810819-81810841 CGTGAGGGACAGAAGTTGGAAGG - Intergenic
1086973403 11:93107165-93107187 GCTGAGAGACAGAAGCTGGATGG + Intergenic
1087007963 11:93487423-93487445 CCTGAAGGCCAGTGGGTGTATGG + Intronic
1088842187 11:113636349-113636371 ACTGAAGGACTGATGATGGATGG + Intergenic
1090997704 11:131881884-131881906 CTTGCAGGACAGAAGGTTGCGGG + Intronic
1091440906 12:511382-511404 GGTGGAAGACAGAAGGTGGAAGG - Intronic
1091440976 12:511680-511702 GGTGGAAGACAGAAGGTGGAAGG - Intronic
1091559788 12:1603192-1603214 TCTAAACGACAGAAGATGGAGGG - Intronic
1091868451 12:3864074-3864096 CCTGATGGACGGTATGTGGAAGG - Intronic
1092265809 12:6979628-6979650 ACTGAAGGTCAGAGGGTGAAGGG - Intronic
1093400175 12:18736643-18736665 CCTGAAGGCATGAAGTTGGAAGG + Intronic
1094139344 12:27164650-27164672 CCTGAGGGAGATAAGATGGAAGG - Intergenic
1098348588 12:69532503-69532525 CTTGCATGGCAGAAGGTGGAGGG + Intronic
1098393009 12:69989392-69989414 CCTCAAGGGAGGAAGGTGGAAGG + Intergenic
1099127193 12:78777053-78777075 CCTGAAGGCCAGAGGCTGGCTGG + Intergenic
1101903693 12:108810073-108810095 CCTGTGGGACAGGAGGTGGCAGG - Intronic
1102050096 12:109855959-109855981 CCTGGAGGAGAGAAGGTGCTCGG - Intronic
1102116432 12:110406603-110406625 CGTGAGGGACAGAAGTTGGAAGG + Intergenic
1102446281 12:113005253-113005275 GATGGTGGACAGAAGGTGGAGGG + Intronic
1103348074 12:120264689-120264711 CCTGACGCAGAGAGGGTGGAGGG + Intronic
1103739389 12:123081208-123081230 CTAAAAGGAGAGAAGGTGGATGG + Intronic
1104146228 12:126036322-126036344 CCAGAAGGAAAGCAGGTGTATGG + Intergenic
1104166013 12:126230328-126230350 CGTGAAGAACAGAAGTGGGAGGG + Intergenic
1104239582 12:126975000-126975022 CCAGAAGGTCAGAGGGTGGCAGG - Intergenic
1104874634 12:132025396-132025418 CATGAGGGACAGAGGGTAGATGG + Intronic
1105284385 13:18992753-18992775 ACAGAAGGACAGAAGGCAGAAGG + Intergenic
1105284577 13:18993821-18993843 CCTGAAGGCCAGAAGTAAGAAGG + Intergenic
1105284689 13:18994482-18994504 CCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284727 13:18994724-18994746 CCAGAAGGTTAGAAGGAGGAAGG + Intergenic
1105284789 13:18995089-18995111 CCAGAAGGCCAGAGGGTAGAAGG + Intergenic
1105508787 13:21034214-21034236 CCTGAGGCTCAGAAGGTGCATGG + Intronic
1106476262 13:30100813-30100835 CCTGATAGACAGAAGGTGCTTGG - Intergenic
1106606205 13:31231623-31231645 CCAGAAGAACAGAAGGGGAAAGG - Intronic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107144350 13:37042177-37042199 GCTGATGGACTGAATGTGGAAGG + Intronic
1107701672 13:43054936-43054958 CCTGGAGCACAGAAGGAGGGCGG + Intronic
1108321562 13:49295451-49295473 TCCCAAGGACAAAAGGTGGAGGG + Intergenic
1108815486 13:54285932-54285954 CCTGAAGGAGACAAGGAGAATGG - Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109582172 13:64355111-64355133 GTTGAAGGGTAGAAGGTGGATGG + Intergenic
1111037928 13:82704211-82704233 CCTGAAGGTTGGAAGGGGGATGG - Intergenic
1112022727 13:95385596-95385618 CCTGAAGGTCAGAAGCAAGATGG - Intergenic
1112788622 13:102979541-102979563 TCTGAAGGCCCGAAGGGGGATGG + Intergenic
1112953566 13:105032516-105032538 CAAAAAGGACAGAAGGTAGAAGG + Intergenic
1113137067 13:107102872-107102894 CCAGTAGGACAGGATGTGGAAGG + Intergenic
1115464737 14:33702702-33702724 CCTGAAGGGGAGAGGGTGGGAGG + Intronic
1115499155 14:34034123-34034145 GCTGATGAACAGAAGGTGCAAGG + Intronic
1115704746 14:35987549-35987571 CCTGAAGGTCAGAAGCAAGATGG - Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1117151080 14:52888970-52888992 CATGAGGGACAGAAGGGAGAAGG + Intronic
1117859001 14:60069808-60069830 CCTGTAGGCCTGAAGGTGTAAGG - Intergenic
1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG + Intergenic
1118932168 14:70252963-70252985 CCTGAGAGACAAAAGGGGGAAGG - Intergenic
1120408587 14:84121040-84121062 CCTGAAGCCCACAAGGTGGAGGG + Intergenic
1121417906 14:93791553-93791575 AGTGAAGGACAAGAGGTGGAAGG + Intergenic
1121789928 14:96691354-96691376 CCTGAAGGAGAGAACTTAGAAGG + Intergenic
1121816641 14:96933846-96933868 CCTGGAGGACAGAAAGAGGGGGG + Intergenic
1122002266 14:98668787-98668809 GCTGAAGGAGAAAAGCTGGAAGG - Intergenic
1122218253 14:100218563-100218585 CCTGCAGGACAGCACGTGGGAGG + Intergenic
1122896508 14:104760187-104760209 CCTGGAGGACAGAAGAGGGCAGG + Intronic
1124469754 15:29973341-29973363 CATGAAGGTCAGAAGGTGGTGGG + Intergenic
1125041137 15:35188613-35188635 ACTGAGGGACAGAAGGCAGAAGG - Intergenic
1125159709 15:36628704-36628726 CTTTAAGGCCAGAGGGTGGATGG + Intronic
1125629633 15:41136604-41136626 CGTGAGGGACAGAAGTTGGAAGG - Intergenic
1126927392 15:53605335-53605357 ACTGAAGAACAGAAGGTGGGAGG + Intronic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128363156 15:66976812-66976834 CCTGAAGGGCAGGGGGTGAAGGG + Intergenic
1129644151 15:77414941-77414963 TCTGAAGGACAGTTGGTTGAGGG - Intronic
1129712571 15:77827998-77828020 CCTGAAGGAGAAGAGTTGGAAGG - Intergenic
1130691634 15:86086373-86086395 CCTGAAATAAAGAAAGTGGAGGG + Intergenic
1131373453 15:91903838-91903860 ACAGAAGGACTGAAGGAGGATGG + Intronic
1131767637 15:95697346-95697368 TCAGTAGGAAAGAAGGTGGAGGG - Intergenic
1132137334 15:99354447-99354469 CCTAAAGGAAAGGAGGGGGAAGG + Intronic
1132143737 15:99414776-99414798 CCTGAAGCGCAGGAGGTGGTAGG + Intergenic
1135491908 16:22916619-22916641 ACTGAAGGTCCGAAGGTTGATGG + Intergenic
1136226606 16:28864217-28864239 CCCGAAGGGCGGGAGGTGGAGGG - Intronic
1137469731 16:48743564-48743586 CCTCAGTGACAGAAGGTGGTTGG - Intergenic
1138087079 16:54142911-54142933 GCTGAAGGAAAGAAGGTGTGAGG + Intergenic
1138435109 16:56994218-56994240 AAGGAAGGAGAGAAGGTGGAGGG + Intronic
1138512298 16:57515687-57515709 ACAGAAGGATAGGAGGTGGATGG - Intronic
1139265587 16:65635570-65635592 TCTGAATGACAGAAGGTCAAGGG - Intergenic
1139324563 16:66142166-66142188 CCTGAGGGACAAAAGGTCGCAGG + Intergenic
1139922128 16:70467161-70467183 CCTGTGGGACAGAAGGGGCAGGG - Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140078568 16:71723753-71723775 CCTGAAGGTGAGGAGGCGGATGG - Intronic
1140491446 16:75339646-75339668 CCTAAAGGGCAGAAGGCTGAGGG - Intronic
1140776690 16:78255203-78255225 CTAGAAGGACAGCAGGGGGACGG - Intronic
1140862619 16:79031364-79031386 CCTGAAGAAAAGAAGGAGGCAGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141218635 16:82048241-82048263 CCTATAGGATAGGAGGTGGAAGG + Intronic
1142147294 16:88497926-88497948 CCTGATGGACAGCAGGGAGATGG + Intronic
1142415501 16:89938989-89939011 CCTGGAGCACTGAAGGTGAAGGG + Intergenic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1143763706 17:9123393-9123415 CCTGTAGGACAAAAGATGGACGG - Intronic
1144180423 17:12746382-12746404 GTAGAAGGGCAGAAGGTGGAAGG + Intronic
1144579037 17:16447706-16447728 CCTGAAGGAGGTAAGATGGAAGG - Intronic
1144935104 17:18891739-18891761 GCCGAGGGACAGAAGGTGAAGGG - Intronic
1145086229 17:19943450-19943472 CCAAAAGGACAGAATGGGGAGGG + Intronic
1145237140 17:21215970-21215992 CTTGAAGGACAAAAGTTGGCTGG - Intergenic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147693782 17:42335945-42335967 CCAGAAAGACAGAAAGTGAAAGG + Intronic
1148000658 17:44385335-44385357 CCTGCAGGAGACAAGGAGGAGGG + Exonic
1148480100 17:47954399-47954421 CCACAAGGACAGGAGTTGGAAGG + Intronic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1149736961 17:59004103-59004125 CCTGAGGGACAGAGGAAGGAAGG + Intronic
1151146493 17:72046456-72046478 GCTGAAGCACAGAAGGTGGCTGG + Intergenic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151681983 17:75627151-75627173 TGTCGAGGACAGAAGGTGGAGGG - Exonic
1152249868 17:79206778-79206800 CCTGAGGGATAGAAGAGGGAAGG - Intronic
1152603003 17:81274548-81274570 GCTGCGGGACAGAAGATGGATGG + Intronic
1154026863 18:10716184-10716206 GGTGGAGGAGAGAAGGTGGAAGG - Intronic
1154220370 18:12447843-12447865 CCAGAAGGGCACAAGGGGGAAGG - Exonic
1154344801 18:13532842-13532864 CCTGGAGGACGGAAGGCGCAGGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155924030 18:31634568-31634590 CCTCAAGGACAGAAAGTCGTGGG - Intronic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1161446865 19:4323511-4323533 CCTGAGGGACAGCGGGGGGAGGG - Exonic
1161491997 19:4567272-4567294 CCTGGAGGAGAGAAGGTTGGGGG - Intergenic
1162262601 19:9545016-9545038 CATGAGGGACAGAAGTTGGAAGG - Intergenic
1162279267 19:9681857-9681879 TCTGCAGGACAGCAGGGGGATGG + Intergenic
1163092917 19:15033688-15033710 CCTGCAGCACAGAGGGAGGAGGG - Intergenic
1163349245 19:16765012-16765034 CCTGAGGGAGAGAAGGGGGGAGG - Exonic
1164663315 19:29999500-29999522 CCTGAAGCACAGAAGGTTATGGG - Intronic
1164782467 19:30904206-30904228 CCTGAGGGACAGGAGGAGGCCGG - Intergenic
1164823013 19:31264594-31264616 CCTGCATGACAGCAGGTGGCTGG - Intergenic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165942206 19:39420604-39420626 CCTGAAAGACAGGAGGATGAGGG - Exonic
1167173337 19:47848514-47848536 AATGAAGGACAGAAAATGGAGGG - Intergenic
1168250381 19:55138109-55138131 CCTGTAGGACTGAGGGAGGAGGG + Intronic
925612977 2:5718682-5718704 CCTGAAGGACACAGGGAGGATGG - Intergenic
926133762 2:10322418-10322440 CCAGCAGGACAGCAGGTGCAAGG + Intronic
926313754 2:11694538-11694560 ACACAAGGACAGAAGGTAGAAGG - Intronic
926380450 2:12281991-12282013 CCTGGAGTAGAGAAGTTGGAAGG + Intergenic
926939478 2:18119621-18119643 CGTGCAGGACAGAGGGAGGAAGG - Intronic
927233867 2:20851940-20851962 CCTGAACCACTGAAGCTGGAAGG - Intergenic
927311095 2:21632179-21632201 CCTGAAACATAGAAGGTGCATGG + Intergenic
927326157 2:21807743-21807765 CCTGAAACAGAGAAAGTGGAGGG - Intergenic
927791748 2:26015611-26015633 CCTGGAGGAAAGAAGGGGAAGGG + Intergenic
927865194 2:26583545-26583567 GAGGAAGGACAGAAAGTGGAGGG + Intronic
928873761 2:36012757-36012779 CCTGAAGGATACAGGGGGGAGGG - Intergenic
929453415 2:42050832-42050854 CCTGATGGTCAGAAGATGAATGG - Intronic
929464182 2:42129891-42129913 CATGAGGGACAGAAGGAGGCAGG + Intergenic
929763611 2:44826205-44826227 TCTGGAGGGCAGAAGGTAGAAGG - Intergenic
932230326 2:70078528-70078550 CCTGAAGGAGATAAGGGAGAAGG + Intergenic
932457723 2:71860229-71860251 ACTGAAGGAGAGAAAGGGGACGG + Intergenic
932571092 2:72938739-72938761 CCAGAAGGAGAGAAAGTGGCGGG - Intergenic
933596693 2:84289921-84289943 GCTGCAGAACAGAAGGTGGGAGG + Intergenic
934109382 2:88727551-88727573 ACTGAAGGATAGAGGGTGGAGGG - Intronic
934939881 2:98493027-98493049 CCTGATGGGCAGCTGGTGGAGGG - Intronic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935277025 2:101483936-101483958 CATAAGGGACAGAAGGTGGAAGG - Intergenic
935385807 2:102499028-102499050 AGGGAAGGACAGAAGCTGGATGG + Intronic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
937472191 2:122183658-122183680 CCTGAAGAGGAGAAGGTGAATGG + Intergenic
937575638 2:123418209-123418231 CCTGAAGGACAGCTGAGGGAGGG + Intergenic
938987665 2:136595020-136595042 CTTGAAGGCCAGAAGGTAGTGGG - Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
939971343 2:148664637-148664659 CCTGAAGACCAGGAGGTGGAGGG - Intronic
940207291 2:151217128-151217150 CCTGAGGGACATAAGGCAGAAGG + Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
941115429 2:161466848-161466870 CCTGTAGGCCAGAAAGTGGGAGG - Intronic
941887895 2:170548233-170548255 CCTGGAGGAGAGAATGTGAATGG + Intronic
942077861 2:172373473-172373495 CATGAAGAAAAGAAGGTGCAAGG - Intergenic
944303453 2:198152138-198152160 CCAGAAGGGCAAAAGGTGGAAGG + Intronic
945003456 2:205376847-205376869 CCTGAAGGAAAGAAAGTACATGG + Intronic
945555010 2:211265844-211265866 CATGAGGGACAGAAGTTGGAAGG - Intergenic
946090013 2:217213507-217213529 CCTTGAGGACGGAGGGTGGAAGG + Intergenic
947107428 2:226681965-226681987 CCGGCAGGACAGAGAGTGGATGG + Intergenic
947154182 2:227144967-227144989 CTAGAAGGAGGGAAGGTGGAAGG + Intronic
947645761 2:231738476-231738498 CCTGAAGTAAAGAAGAAGGAAGG - Intronic
948073761 2:235149105-235149127 CTTGAAGGTGTGAAGGTGGATGG - Intergenic
948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG + Intergenic
949080879 2:242098616-242098638 CCTGAAGCATAGAACGTGAAGGG + Intergenic
1168930009 20:1614064-1614086 ACTGAAGGCCAGAAGATAGAGGG + Intronic
1169567326 20:6869274-6869296 CCGAAAGGGCAGAAGTTGGAGGG + Intergenic
1170567393 20:17614880-17614902 CCTGATGGTCAGAAGGTTGACGG + Exonic
1171778036 20:29389066-29389088 GATGAAGGAGAGAAGGAGGAGGG - Intergenic
1172038726 20:32028938-32028960 CCTGAGGGCCAGGAGCTGGAGGG + Intronic
1173099728 20:40074440-40074462 CCTCTAGCACAGAAGGTGAAAGG + Intergenic
1173933475 20:46841063-46841085 TTTGAAGGACTGAAGGAGGATGG + Intergenic
1174260513 20:49291398-49291420 CCTGAATGACACAAGGCAGAGGG - Intergenic
1175188830 20:57197987-57198009 CCTTAAGGCCACAAGGTGGGAGG + Intronic
1175353646 20:58345010-58345032 TCTGAAGGACAGAAGAGGGATGG - Intronic
1175384554 20:58585848-58585870 CCTGGAGGACACAAGAAGGAAGG + Intergenic
1177180386 21:17738694-17738716 ATTGAAGAACAGAAGATGGAAGG + Intergenic
1177391368 21:20477348-20477370 GCTGAAGAAGAAAAGGTGGAAGG + Intergenic
1178103051 21:29291096-29291118 CCTGCAGGACAGGAGAAGGATGG - Intronic
1179879603 21:44287847-44287869 CCTGAAGGATAGGGAGTGGACGG - Intronic
1179908825 21:44437520-44437542 CCTGAAGGTCAGGAGCTGGTTGG - Intronic
1180180519 21:46116800-46116822 ACCGATGGACAGAAGGTAGAGGG + Exonic
1180750835 22:18123183-18123205 CCTGGAGGAGTCAAGGTGGAAGG + Intronic
1180763850 22:18231037-18231059 CCTGCAGGCCAGAAGGTGGTGGG - Intergenic
1180771796 22:18393505-18393527 CCTGCAGGCCAGAAGGTGGTGGG + Intergenic
1180803175 22:18643119-18643141 CCTGCAGGCCAGAAGGTGGTGGG + Intergenic
1180818478 22:18808358-18808380 CCTGAATGACAGATGGTTGGAGG + Intergenic
1181061379 22:20283674-20283696 CCTGAAAGGCGGATGGTGGAAGG - Intergenic
1181204701 22:21242813-21242835 CCTGAATGACAGATGGTTGGAGG + Intergenic
1181218542 22:21352141-21352163 CCTGCAGGCCAGAAGGTGGTGGG - Intergenic
1181884649 22:26010659-26010681 GATGAAGGACAGAGGATGGAAGG - Intronic
1182469417 22:30538937-30538959 CCTGCAGGACCGAGGGTGGTTGG - Intronic
1182710739 22:32321613-32321635 ACTGAAGGGCGGAAGGTGGGAGG - Intergenic
1183220051 22:36506619-36506641 CCTGAGGGAGATAAGATGGAGGG - Intronic
1183268985 22:36849106-36849128 ACGGAAGGGCAGAAGGTGTAGGG - Intergenic
1184034510 22:41912115-41912137 CATGAAGGACAGATGGGTGACGG + Intronic
1184255226 22:43282630-43282652 ACTGATGGAGAGAAGGTGGGTGG - Intronic
1184266736 22:43351276-43351298 ACTGCAGGACAGAAGGAGGATGG - Intergenic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1185241303 22:49749007-49749029 CCCTGAGTACAGAAGGTGGAGGG - Intergenic
1185371974 22:50465129-50465151 CCTGGATGACAGAAGGAGGTCGG + Exonic
1203222224 22_KI270731v1_random:52602-52624 CCTGAATGACAGATGGTTGGAGG - Intergenic
1203233633 22_KI270731v1_random:134496-134518 CCTGCAGGCCAGAAGGTGGTGGG + Intergenic
1203268607 22_KI270734v1_random:34212-34234 CCTGAATGACAGATGGTTGGAGG + Intergenic
949935571 3:9113121-9113143 CCTGAAGGACAAGACGTGCATGG + Intronic
949971907 3:9414607-9414629 CCTTAAGGACATAAAATGGAAGG + Intronic
950192889 3:10990457-10990479 CACGAAGGACAAAAGGGGGATGG + Intergenic
950798687 3:15531956-15531978 CCTGAAGGAAGGAGGGAGGAGGG - Intergenic
950863805 3:16173346-16173368 GGGGAAGGAGAGAAGGTGGAAGG - Intergenic
950899322 3:16482987-16483009 CCTGGAGGAGGGAAGGTGGATGG - Intronic
951194610 3:19810320-19810342 CCTGAGGGAAAGAAGAGGGAAGG + Intergenic
951951581 3:28204234-28204256 CCTGAAGGAGACAAGGAGAATGG + Intergenic
953565261 3:44026939-44026961 CCTGAAGGAGAGCAGGGAGATGG - Intergenic
953656188 3:44856617-44856639 CATGAGGGACAGAAGTTGGAAGG + Intronic
953718165 3:45333478-45333500 CCTGTAGGATAGAAGAAGGAGGG - Intergenic
954442379 3:50528756-50528778 CCTGAAAGAGAGCTGGTGGAGGG - Intergenic
954616350 3:51970634-51970656 CCTGAAGGACAGCAGCTGAGGGG + Intronic
954941049 3:54373659-54373681 CCTTCAGGAAATAAGGTGGAAGG + Intronic
956153403 3:66267562-66267584 CCTGAAGGTGAGAAGCTGGTTGG + Intronic
956855947 3:73274878-73274900 CCTGAAGGACAGAAGAAGCCAGG - Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
960952719 3:123010087-123010109 CCTGGAGGACCGGAGGTGGCTGG + Intronic
961141630 3:124561306-124561328 TCTGCAGGACAGAAGGTAGAAGG - Intronic
961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG + Exonic
961352225 3:126311322-126311344 CCTGAAGGACAGTAGGAGCTTGG - Intergenic
961408287 3:126698934-126698956 CGTGAAGGAAAGGAGGGGGAGGG - Intergenic
961558268 3:127711417-127711439 CCAGAAGGAGAGATGGGGGAGGG - Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962854163 3:139329280-139329302 CAGGAAGGAGAGAGGGTGGAGGG + Intronic
963024174 3:140901624-140901646 ACATAAGGACAGAAAGTGGAAGG + Intergenic
963111561 3:141692929-141692951 CTTGAGGGACAGAAGTTGGAAGG + Intergenic
963509657 3:146231014-146231036 TCTGGAGGGCAGAAGGTGGGAGG - Intronic
965186342 3:165469342-165469364 ACAGAAGAATAGAAGGTGGATGG + Intergenic
965289773 3:166864793-166864815 CCTGAAGGAAGGAAGTGGGAAGG + Intergenic
965677183 3:171210176-171210198 ACGGAAGGACAGAAGGTAGAGGG + Intronic
967120030 3:186374502-186374524 GCTCAGGGACTGAAGGTGGAAGG - Intergenic
967829967 3:193910133-193910155 GCCGAAGGAGTGAAGGTGGATGG - Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968233884 3:197020290-197020312 CATGAAGGACAGAATTGGGACGG + Intronic
968553296 4:1235135-1235157 ACTGAAGGACAGCCGGTGGGGGG + Intronic
969139645 4:5057261-5057283 ACTGAAGGACAGGAGTAGGAAGG - Intronic
969182378 4:5452102-5452124 CAAGAAGCACAGAATGTGGATGG - Intronic
969348779 4:6585907-6585929 CCTTGAGGAGAGAAGGTGAAGGG - Intronic
969457709 4:7309682-7309704 CCTCGAGGAAAGAAGGTGTATGG - Intronic
969614824 4:8246246-8246268 CCTGAAGGACTCATGGTGGGCGG + Intergenic
969905757 4:10394241-10394263 CCTTGAAGACAGAAGTTGGATGG + Intergenic
971249426 4:24961165-24961187 GCTGAAGGACAGAAAGAAGAAGG + Intronic
971785737 4:31099972-31099994 ACAGAAGGAAAGAAGGAGGAAGG + Intronic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
973191682 4:47392646-47392668 GCTGAAGATTAGAAGGTGGAAGG - Intronic
973232660 4:47859975-47859997 ACTGAAGGACAGAAGGGGATTGG + Intronic
973959157 4:56092232-56092254 ACTCAAGGAAAGAAGGTGCATGG + Intergenic
974961410 4:68705763-68705785 CCTCTAGGAGAGAAGGTGGTTGG - Intergenic
975231809 4:71944403-71944425 ACTGAAGTACAGAAAGTGGTAGG + Intergenic
977681321 4:99801555-99801577 CCTGAATTCCAAAAGGTGGAGGG + Intergenic
977919271 4:102625595-102625617 CCTGAAGCCCAGAAGGTGAGGGG + Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
979968656 4:127107364-127107386 CCTGAAAGAGATAAGGAGGATGG + Intergenic
980507373 4:133740019-133740041 GCTGAAAGACAGAAGATGAATGG - Intergenic
980959240 4:139458449-139458471 CCTGAAGGGTGGAAGGTGGGAGG - Intronic
982555236 4:156853305-156853327 CCTGAAAGACACAATGTGAAGGG + Intronic
982785848 4:159535961-159535983 CCTGCAGGACAGAAGGAATAGGG - Intergenic
982896459 4:160933918-160933940 CCTGAAGGGTCGAGGGTGGAAGG + Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983550781 4:169015419-169015441 CCAGAAGGATAGAGGGGGGAAGG - Intergenic
985059054 4:186058072-186058094 GGTGAATGACTGAAGGTGGATGG - Intergenic
985641647 5:1066110-1066132 CCTGAAGGTCAGAGGGTGGGAGG - Intronic
986140817 5:5027759-5027781 CCTGAAGGAGACAAGGGGAATGG + Intergenic
986368612 5:7059246-7059268 CATGAGGGACAGAAGTAGGAAGG + Intergenic
987117402 5:14736631-14736653 CGTGAAGGTCAGAAGGAGAAGGG - Intronic
987739387 5:21885841-21885863 AGTGAAGGAAAGAAGGTGCATGG - Intronic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
989406380 5:41065690-41065712 CCAAAAGAACAGAAGGTGGGAGG - Intronic
989427363 5:41312409-41312431 CTTGAAGGAAAGAAAGAGGAAGG - Exonic
989688563 5:44115665-44115687 CATGAGGGACAGAAATTGGAAGG + Intergenic
990222358 5:53606391-53606413 CCTGGATGACAGAAAGTGTATGG - Intronic
990245241 5:53857808-53857830 GCTTAAGGCCAGAATGTGGAAGG + Intergenic
990513450 5:56510484-56510506 ACTGGAGGAAAGAAGTTGGAAGG - Intergenic
991559542 5:67934988-67935010 TGTGAAGGACAGAAGGAAGAAGG + Intergenic
992994992 5:82323868-82323890 GCAGAAGGAGAGAATGTGGAGGG - Intronic
993227419 5:85184696-85184718 TCTGAAGGGGAGAAAGTGGAAGG - Intergenic
993496248 5:88612588-88612610 CCAGAAGGACAGAAGAAAGAGGG + Intergenic
993622386 5:90184016-90184038 CATGAAGGAAAGAAGGAGGAAGG + Intergenic
994315368 5:98326884-98326906 ACTCAAAGACAGAGGGTGGAAGG - Intergenic
994537077 5:101045891-101045913 CATTAAGAACAGAAGGTGGCAGG - Intergenic
994778643 5:104065506-104065528 CGTGAGGGACAGAAGTTGGAGGG + Intergenic
995993333 5:118269231-118269253 CAGGAAGGACAGAAGGTTCAAGG - Intergenic
996022783 5:118610191-118610213 TCTGATGCACAGAAGCTGGATGG + Intergenic
997496195 5:134328490-134328512 GCTGAAGGATAGAAGGTAAAAGG + Intronic
998216077 5:140239536-140239558 CTTGAAGGCAAGAAGGTGGGAGG + Intronic
998540272 5:142974824-142974846 CCTGAGGGACAGAGGGCGAAAGG - Intronic
999985702 5:157003346-157003368 CCTGAAAGACAGAGGGCTGATGG - Intergenic
1001536914 5:172504454-172504476 CCTGAAGCTCAGAAGCTGGATGG + Intergenic
1002342460 5:178526102-178526124 CCTGAAGGAGAGAGGGCAGAGGG + Intronic
1002551884 5:180000488-180000510 CCAGAAGGAGAGAAGGGGAAAGG - Intronic
1005274857 6:24205798-24205820 CCTGAAGAAGAGAAGGCTGAGGG - Intronic
1005601070 6:27426466-27426488 TGTGAAGGACAGAAGGTTGTGGG - Intergenic
1005972197 6:30770064-30770086 CATGAAGGCCTGAAGCTGGACGG - Intergenic
1006340140 6:33442455-33442477 CATGAAGGACTGAAGGTCGATGG - Exonic
1007713242 6:43838201-43838223 CCTGTAGGACAGGTGGGGGATGG + Intergenic
1008102473 6:47406803-47406825 GCTGAGGGAAAGAAGGTGGCAGG + Intergenic
1008666288 6:53720249-53720271 TCAGAAGTACAGAAGGTGGAAGG - Intergenic
1009866643 6:69406288-69406310 CCTGAAGGTGAGAAGGTAAAGGG + Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010195746 6:73238574-73238596 GCTGAAGGACAGGACTTGGAGGG + Intronic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1012442156 6:99270641-99270663 CCGGAAGGGCAGAGGGTTGAGGG - Intergenic
1012976469 6:105785603-105785625 ACTGAAGGACAAAAGAAGGAAGG - Intergenic
1014045060 6:116876307-116876329 TCAAAAGAACAGAAGGTGGAAGG + Intergenic
1014480640 6:121932353-121932375 CCTAAAGAAGAGAAGGTTGAGGG - Intergenic
1016330145 6:142946102-142946124 CCTTAAGGACAGAGGGAGGGCGG + Intergenic
1018428830 6:163707677-163707699 CCCAAAGGACAGAATGCGGATGG + Intergenic
1018731022 6:166650499-166650521 GCTGGAGGAGAGAAGGAGGAGGG + Intronic
1018900258 6:168048364-168048386 CTTCAAGGTCAGAAGGAGGACGG - Intergenic
1018940956 6:168308626-168308648 GCTGGAGTACAGACGGTGGAGGG - Exonic
1019326854 7:442728-442750 GATGAAGGATAGATGGTGGAAGG + Intergenic
1019404928 7:877964-877986 CCTGAAGGCCAGGAGGAGGGAGG - Intronic
1020578377 7:9963397-9963419 CCTGAAGGACAGATGGAATAGGG + Intergenic
1021654453 7:22861601-22861623 TTTGAAGGGCAGAAGGTGCAGGG + Intergenic
1022503715 7:30897766-30897788 CCTGAAGGAAAGTGGGTGGGAGG + Intergenic
1023687361 7:42749975-42749997 CCTGAAAGTCACAAGGTAGAAGG - Intergenic
1024008193 7:45242755-45242777 CCTAAAGCTCAGAAGGTGAAGGG + Intergenic
1024242370 7:47445465-47445487 CCTGAAAGCCAGGAGATGGAAGG - Intronic
1026114396 7:67484188-67484210 CCTCAAGGAAAAAAGGAGGAAGG - Intergenic
1026998870 7:74637763-74637785 ACTGAATGACTGAAGGTGAAGGG - Intergenic
1027780997 7:82520318-82520340 TCTGGAAGACAGAAAGTGGATGG + Intergenic
1028799963 7:94951675-94951697 CCAGAAGGACAGTAGGAGGAAGG - Intronic
1029722026 7:102374321-102374343 CCAGAAGGCAAGGAGGTGGAGGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030290239 7:107864817-107864839 TCTGAAGGACAGAAAGTAGAGGG + Intergenic
1030565195 7:111145301-111145323 GCTGGAGGACAGAAGCAGGAAGG + Intronic
1030680735 7:112431012-112431034 CATGAAGAAAAGAAGGTGGGAGG - Intronic
1033116592 7:138631308-138631330 CTTGAAGGATAGATGGTTGAGGG - Intronic
1034875688 7:154722928-154722950 TCTGAAGAAAAGAAGATGGAAGG - Intronic
1035690462 8:1556367-1556389 CCTGCAGGAGTGCAGGTGGACGG + Intronic
1035850434 8:2914579-2914601 CTTGGAGGACAGCGGGTGGAAGG - Intergenic
1035933422 8:3809958-3809980 CCTGCAGCAAAGAAGTTGGAAGG - Intronic
1036057915 8:5280376-5280398 CCTGAATGTCAGAGGGAGGAGGG - Intergenic
1036695008 8:10968528-10968550 CCTGGAGGACAGGAGGAGGGAGG - Intronic
1037930644 8:22878181-22878203 CCTGAGGGAAAGGGGGTGGAGGG + Intronic
1039097922 8:33906951-33906973 CCAGAAGGAGAGAAGGTATAGGG - Intergenic
1039891821 8:41690658-41690680 AGGGAAGGACCGAAGGTGGAAGG - Intronic
1040401408 8:47053383-47053405 CCTGTAGGACGGAAGGAGGTGGG + Intergenic
1042630108 8:70806799-70806821 CCTGAAGGAGAGGAGGAGAATGG + Intergenic
1043529327 8:81132630-81132652 CCAGCAAGACAGAAGGGGGAAGG - Intergenic
1044586030 8:93869808-93869830 CCTGAAGGGAAGAAGGGAGAAGG - Intronic
1044831391 8:96253402-96253424 CCTACAGGACAGAAGGTAGAAGG - Intronic
1044963347 8:97552543-97552565 AGTGAAGGAAAGAAGGAGGAAGG - Intergenic
1045930544 8:107620662-107620684 GCTGAAGGACAGTATGAGGAAGG - Intergenic
1047441819 8:124885373-124885395 CCTGAAGGAGAGGATCTGGATGG + Intergenic
1047596191 8:126380043-126380065 CCTGGAGAACAGAAGTTGGATGG + Intergenic
1047637162 8:126776923-126776945 CCAGAAGGAAAGAAGAGGGAGGG + Intergenic
1048581210 8:135731189-135731211 CTTGAATGACATAAGGAGGAAGG + Intergenic
1049033774 8:140058626-140058648 CCTGCAAGACAGACAGTGGAAGG + Intronic
1049199795 8:141334475-141334497 CCTGGAGGACAGAGAGGGGATGG - Intergenic
1049790395 8:144469743-144469765 CCTGGAGGAGAGAGGGTGGCTGG + Intronic
1051777326 9:20650208-20650230 CCTGGAGGGCAGAAAGTGGGAGG + Intergenic
1052203611 9:25811473-25811495 CCAGCAGGACAGAAGATGAAGGG - Intergenic
1052804759 9:33002875-33002897 CCTTCAAGACAGAAGGTGGGAGG + Intronic
1055251885 9:74317464-74317486 CATGAAGGAAAGAAAGTGAATGG - Intergenic
1055441592 9:76342011-76342033 CCTGGAGCAGAGAAGGTGGATGG + Intronic
1056116679 9:83447614-83447636 CCTGAAGCACAGGAGGTCAAGGG + Intronic
1056177922 9:84053476-84053498 CCCAAAGGAGAGAATGTGGAGGG + Intergenic
1056655084 9:88502622-88502644 CCTGGGGGACACAAGGAGGATGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058079269 9:100685276-100685298 CCTCAAGGAGAGAAGGAGGTTGG + Intergenic
1060114570 9:120929864-120929886 CTTGTAGGACTGATGGTGGAGGG + Intergenic
1060220966 9:121763914-121763936 ACTGAAGGACAGGATGGGGAAGG - Intronic
1060389422 9:123266924-123266946 TCTGGAGTACAGTAGGTGGAGGG - Intronic
1060861212 9:126956319-126956341 CCTCAGGGACTGAAGTTGGATGG + Intronic
1061075368 9:128338141-128338163 ACTGAAGGAGAGCAGGTGGCTGG + Intergenic
1061909287 9:133714314-133714336 CTTGAGGGGCAGAAGGTGGCAGG + Intronic
1062261489 9:135665299-135665321 CCTGAAGTTCTGGAGGTGGAAGG - Exonic
1185461778 X:336083-336105 CCTTAAGCCCAGCAGGTGGAGGG + Intronic
1185625775 X:1481127-1481149 CCTAAAGGTCAGAGGGTGCAGGG - Intronic
1188031366 X:25267906-25267928 CCAGAAGCACAGACGGGGGAAGG - Intergenic
1188332699 X:28893939-28893961 CATGAGGGACAGAAGTTGGAAGG + Intronic
1189107201 X:38249260-38249282 CCTAAAGGACAGAAGTTACATGG + Intronic
1191677614 X:63808137-63808159 CCTGAAGGTCACAAGATGGCTGG - Intergenic
1192326014 X:70133174-70133196 GCTGAAGGGCACAGGGTGGAAGG + Intergenic
1192733652 X:73827112-73827134 CAAGTAGGGCAGAAGGTGGAAGG - Intergenic
1193091257 X:77495697-77495719 CCTGAAGGAGACAAGGAGAATGG + Intergenic
1193768384 X:85560023-85560045 CCTGAAGGAGACAAGGAGAATGG - Intergenic
1195548569 X:106140159-106140181 CCTGAAGGAAACAGGGAGGATGG + Intergenic
1195616290 X:106914868-106914890 GCTGAATGACAAAATGTGGAGGG + Intronic
1196889135 X:120275503-120275525 CCTGAAGAACAGAACCTGAAAGG - Intronic
1196941967 X:120785883-120785905 ACTGAAGAACAGGAGCTGGAAGG - Intergenic
1197494330 X:127159134-127159156 ACTGTAGGAAAGAAGGTAGATGG - Intergenic
1198518410 X:137429629-137429651 CCTGGAGGACAGAGCGTGAAAGG + Intergenic
1199893385 X:152110042-152110064 CCTGAGGGAAAGAAGGGGGAAGG - Intergenic
1199950984 X:152706145-152706167 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199953281 X:152722759-152722781 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199956401 X:152745691-152745713 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1199958698 X:152762316-152762338 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1200409759 Y:2849568-2849590 GCTGGAGGACAGAAGGTGATGGG + Intronic