ID: 961175228

View in Genome Browser
Species Human (GRCh38)
Location 3:124829939-124829961
Sequence AAGGGGAAGCAGGAATGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1328
Summary {0: 1, 1: 0, 2: 11, 3: 125, 4: 1191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961175222_961175228 0 Left 961175222 3:124829916-124829938 CCTCACTCTCAGTCATCCATGAA 0: 1
1: 0
2: 1
3: 14
4: 204
Right 961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG 0: 1
1: 0
2: 11
3: 125
4: 1191
961175221_961175228 13 Left 961175221 3:124829903-124829925 CCTTAAAATCTGACCTCACTCTC 0: 1
1: 0
2: 2
3: 18
4: 192
Right 961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG 0: 1
1: 0
2: 11
3: 125
4: 1191
961175220_961175228 23 Left 961175220 3:124829893-124829915 CCTCTCAGTTCCTTAAAATCTGA 0: 1
1: 0
2: 0
3: 25
4: 264
Right 961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG 0: 1
1: 0
2: 11
3: 125
4: 1191
961175219_961175228 26 Left 961175219 3:124829890-124829912 CCTCCTCTCAGTTCCTTAAAATC 0: 1
1: 1
2: 1
3: 29
4: 309
Right 961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG 0: 1
1: 0
2: 11
3: 125
4: 1191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961175228 Original CRISPR AAGGGGAAGCAGGAATGAGA TGG Intronic
901536144 1:9883987-9884009 ATGGGGAAGGAGGAAGGAGGAGG + Intronic
901701125 1:11045244-11045266 GAGGGGAAGCAGGGCTGAGAAGG + Intronic
902100911 1:13987965-13987987 AAGGGCAAGAAAGGATGAGAAGG + Intergenic
902143828 1:14379665-14379687 AAGGGGAGGAAAGAATGGGAAGG + Intergenic
902143958 1:14381012-14381034 AAGGGGAGGGAAGAATGGGAAGG - Intergenic
902208452 1:14887153-14887175 AAGGGGAAGCAGGAAGGAAATGG - Intronic
902228423 1:15011856-15011878 AAGAGGAAGGAGGAGTGGGAAGG + Intronic
902279350 1:15362934-15362956 AAGTGGAAGCAGCACTGGGAAGG - Intronic
902472653 1:16659470-16659492 AATGGGAAGGGGGAAAGAGAAGG + Intergenic
902486151 1:16747973-16747995 AATGGGAAGGGGGAAAGAGAAGG - Intronic
902542107 1:17162922-17162944 AAGAAGAAGCAGGGATGAGAAGG + Intergenic
902621811 1:17655170-17655192 GAAGGGAAGCAGCAATGACAGGG - Intronic
902741840 1:18444262-18444284 GAGGGGAAGCTTGAATGGGAAGG - Intergenic
903002850 1:20278777-20278799 AAGGGGAAGCAAGAGAGAGATGG + Intergenic
903127452 1:21257595-21257617 CAAGAGAAGCAGGCATGAGAGGG + Intronic
903149877 1:21399125-21399147 AAAGGGAAGGAGCAAAGAGATGG + Intergenic
903242442 1:21992436-21992458 AAGGTGAAGCAGGAACATGAAGG + Intronic
903245952 1:22015621-22015643 AAGGTGAAGCAGGAACATGAAGG + Intergenic
904078830 1:27859154-27859176 AAGGGGAAGCAGAGAGGTGACGG - Intergenic
904087190 1:27917127-27917149 AAGGGGAAGGAGGAAGGAGAAGG - Intergenic
904087193 1:27917140-27917162 AAGAGGAAGGAGGAAGGGGAAGG - Intergenic
904348513 1:29889862-29889884 AATGGGAAGGAGGCAGGAGATGG + Intergenic
904348844 1:29891931-29891953 CAGAGCAATCAGGAATGAGATGG - Intergenic
904580604 1:31541103-31541125 AAGGGGAAGCCGGCATCACATGG + Intergenic
904848835 1:33441552-33441574 AAGAGGGAGGAGGAAGGAGAAGG - Intergenic
904904454 1:33884443-33884465 AAGCGGGAGGAGGAATAAGATGG - Intronic
905387885 1:37616681-37616703 AAGGTGGAGCAGGCATGAGAAGG + Intronic
905919767 1:41711678-41711700 AAGGGGTAGCAGGAAGGACGAGG - Intronic
906075988 1:43052535-43052557 AAAGAAAAGGAGGAATGAGATGG + Intergenic
906138992 1:43522110-43522132 AAGGGGAAGCCGAACAGAGAAGG - Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906738296 1:48154139-48154161 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
906779478 1:48559796-48559818 AAGAGGAAGCAGGAATGTAGGGG - Intronic
906994745 1:50780301-50780323 GAGTGGAAGCAGGTGTGAGAGGG + Intronic
907165975 1:52411700-52411722 AAAGGGAAGCAGGATGGTGAAGG - Intronic
907223961 1:52927647-52927669 AAAGGGAAGGAGGAAGCAGAAGG - Intronic
907270802 1:53289934-53289956 GAGGGGAAGCAGGAGTGTGGTGG - Intronic
907401138 1:54225675-54225697 CAGGGGAGGGAGGAAGGAGAAGG + Intronic
907639787 1:56176362-56176384 ATTGGGCAGCAGGAAGGAGAGGG - Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907875668 1:58484898-58484920 AGGGGGAGGGAGGAATGAGTAGG + Intronic
908427160 1:64018282-64018304 AAGGAGAAGCAGGAAACTGAGGG - Intronic
909182260 1:72439542-72439564 AAGGGGAGGCAAGAGTGGGAAGG - Intergenic
909271361 1:73627418-73627440 AAGTGGAAGGAAGAGTGAGAAGG + Intergenic
909483675 1:76151517-76151539 AAGGGGAGTGGGGAATGAGAAGG + Intronic
910002127 1:82353856-82353878 AAGTGGAAGCAGGAGAGAGAGGG + Intergenic
910271011 1:85394306-85394328 AAGGGAAAGCAGGCATGGAAAGG - Intronic
911088758 1:94001150-94001172 AGGGGGAAGCAGTAATCAGAAGG - Intronic
911094379 1:94043993-94044015 AAGGGGAAGGAGGAAGGAAAGGG - Intronic
911159204 1:94667582-94667604 AAGGGGAAGGAGGAATAGAATGG + Intergenic
911244306 1:95499958-95499980 AAAGGGAAGCAGGTTTAAGAGGG - Intergenic
911536474 1:99106208-99106230 AAGGGGAGGGAGAAGTGAGAAGG + Intergenic
911694406 1:100872691-100872713 GAGGAGAAGGAGGAATAAGAGGG + Exonic
911884584 1:103281386-103281408 AAGGGGACTCAGGAAAGAAAAGG + Intergenic
912127382 1:106555585-106555607 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
912473433 1:109921392-109921414 AAGAGAAACCAGGAAAGAGATGG - Intronic
912487336 1:110039544-110039566 AAGGGGAGGCTGGGATGGGAAGG + Intronic
912593782 1:110853618-110853640 AAATGGAAGCAGGAATGCAAAGG - Intergenic
913380077 1:118201137-118201159 GAGGGGGAGGAGGAAGGAGACGG - Intergenic
913576494 1:120180546-120180568 GAGGGGAAGGGGGAATGAGCCGG + Intergenic
914426272 1:147579933-147579955 AAGAGGAAGAATGAATGAAAGGG - Intronic
914558400 1:148791984-148792006 GAGGGGAAGGGGGAATGAGCCGG + Intergenic
914614435 1:149338246-149338268 GAGGGGAAGGGGGAATGAGCCGG - Intergenic
915112331 1:153572024-153572046 AAGAGGAAGCTGCAGTGAGAAGG - Intergenic
915345800 1:155196260-155196282 AAAGGGAGGCAGGAAGGAGAGGG + Intronic
915431872 1:155872888-155872910 AAGGTGAAGGAGGGATCAGATGG + Intronic
915461493 1:156073161-156073183 TGGGGGAAGCAGGCATGGGAGGG + Exonic
915507549 1:156367260-156367282 AAGGGGCAGGAGGAAAGAAAAGG + Intronic
915632534 1:157163442-157163464 AAGGGGCTGCAGGAATGGGAAGG - Intergenic
915870287 1:159552257-159552279 AAGGGTACGCAGAAATCAGAAGG - Intergenic
915969475 1:160343559-160343581 GAGGGGCAGCAGGAACCAGAAGG - Intronic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916055894 1:161068864-161068886 ATGGGGAAGAATGAAAGAGAGGG - Intronic
916218249 1:162417391-162417413 AAGAGGGAGCAGGACTGAGAAGG + Intergenic
916242911 1:162657790-162657812 AAGGGAAAAGAGGAAGGAGAGGG - Intronic
916440313 1:164818521-164818543 CTGGGAAAGAAGGAATGAGAAGG + Intronic
916692936 1:167208625-167208647 AAGGGGAAGCAAGCATGAAGAGG + Intergenic
916801537 1:168220845-168220867 ACGGGCAAGCAGGTATGAGGTGG + Intergenic
916988062 1:170213038-170213060 AAGGGAAAGGAGGAGTAAGATGG - Intergenic
917096443 1:171403567-171403589 AGGGCACAGCAGGAATGAGACGG + Intergenic
917333311 1:173904744-173904766 AAGGGGAAGGAAGAGTGAGAAGG - Intronic
917448711 1:175128539-175128561 AAGGGCAAGGAGGAAAGAGGTGG - Intronic
917707298 1:177647421-177647443 AAGGAGGAGCAGGGATGAGAAGG + Intergenic
917860818 1:179141615-179141637 AAGGGGAATGGGGAATAAGAAGG - Intronic
917954892 1:180085078-180085100 AAGGGGAAGGAGGAAAGAAAAGG - Intronic
918028895 1:180783469-180783491 AAAGGGGAGTAGGTATGAGAAGG - Intronic
918069470 1:181124455-181124477 AAGGGGAAGCAGGGAAGGGGAGG - Intergenic
918399366 1:184147955-184147977 GAGGGGAAGCAGGAAATTGAAGG - Intergenic
919016777 1:192048585-192048607 AAGAGGAAGAAGAAAGGAGAAGG + Intergenic
919077898 1:192834776-192834798 AAGGAAAAGGAGGAATGAAAGGG + Intergenic
919206988 1:194431153-194431175 GAGGGGAAGCTAGAAAGAGAAGG + Intergenic
919319645 1:196019187-196019209 ATGTGCAAGCAGGAATGAGAAGG + Intergenic
919743695 1:200995404-200995426 AAGGGGAGGGAGGACTGAAAGGG + Intronic
919882222 1:201908217-201908239 TAGCGGAAGCAGGTATGGGATGG - Intronic
919972586 1:202590708-202590730 AAGCAGAAGTGGGAATGAGAGGG + Exonic
920057409 1:203202587-203202609 AATGGGAATGAGGAATGAGCAGG - Intergenic
920077218 1:203346170-203346192 CAGGGGAGAAAGGAATGAGAGGG + Intronic
920227962 1:204451503-204451525 AATGGGCTGCAGGAAGGAGAGGG - Intronic
920230583 1:204467157-204467179 TAGGGGAGGCAGGAGAGAGAAGG + Intronic
920375038 1:205503773-205503795 AGGAGGAAGCAGAGATGAGAGGG + Intergenic
920438142 1:205961406-205961428 AAAGGGAGGCAGAGATGAGAGGG + Intergenic
920693048 1:208161280-208161302 AAGGGGATTGAGGAAGGAGAGGG - Intronic
920803610 1:209211737-209211759 AAGGGTAAGCAAGAGTTAGATGG - Intergenic
920942323 1:210495352-210495374 AAAGGGCACCAGGAATCAGAAGG + Intronic
920944592 1:210516270-210516292 AAGGGGAAGAAAGAAAGACAGGG + Intronic
921118159 1:212113962-212113984 CAAGGGAAGCAGGAAGGAAAGGG + Intergenic
921435527 1:215115707-215115729 AAAGGAAAGCATGAAAGAGAAGG - Intronic
921446935 1:215258080-215258102 AGGGTGAAGCATGAATAAGATGG + Intergenic
922085514 1:222343259-222343281 AAAGGGAGTCAGGAAGGAGAAGG + Intergenic
922145554 1:222940287-222940309 AAGGGGAAGCTGGCCAGAGAAGG + Intronic
922478361 1:225922177-225922199 AAGGGGCATCAGGGCTGAGATGG + Intronic
922544646 1:226446934-226446956 AAGGGCAACCAAGAATGAGAAGG - Intergenic
922550816 1:226493053-226493075 AAGAGGCAGGTGGAATGAGAAGG - Intergenic
922931366 1:229392394-229392416 TAAGGGAAGCAGGAAAGGGAAGG - Intergenic
922979298 1:229812208-229812230 AAGGGAAGGAAGGAAGGAGAAGG + Intergenic
923756289 1:236794151-236794173 GAAGGGAGGGAGGAATGAGATGG - Intergenic
1062812611 10:477791-477813 AAGGGAAGGAAGGAAAGAGAAGG + Intronic
1063153629 10:3358389-3358411 AAGGGGAGGTAGGGAGGAGAAGG - Intergenic
1063716136 10:8529056-8529078 AAGGATAAGTAGGAATTAGATGG + Intergenic
1063759704 10:9058875-9058897 CAAGGGAAGAAGGAAAGAGAAGG - Intergenic
1064007783 10:11712237-11712259 AAGGGGAAGCAGGAATTTCGTGG - Intergenic
1064694383 10:17950821-17950843 GACGGGAAGCAAGAAAGAGATGG + Intergenic
1065070751 10:22021627-22021649 AAGGGAGCACAGGAATGAGAGGG + Intergenic
1065204487 10:23344169-23344191 GAGGGGAAGGGGGAAGGAGATGG + Intronic
1065349531 10:24783089-24783111 AAGGGCAGGCAGGATTGTGAAGG - Intergenic
1065373705 10:25016003-25016025 AAGGGGAAGCAGTGAAGAAAGGG - Exonic
1065431395 10:25660985-25661007 AAGGGGAGGGAAGAGTGAGAAGG - Intergenic
1065747417 10:28855009-28855031 AAGGATAAGGAGGAAGGAGACGG - Intronic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1065797754 10:29322797-29322819 AAGAGAAAGAAGGAAAGAGAGGG + Intergenic
1065853870 10:29814139-29814161 AGAGGGAAGGAGGAAAGAGAAGG - Intergenic
1066501642 10:36000690-36000712 GAGAGGAAGCAGGAAAGAGAGGG - Intergenic
1066629491 10:37445019-37445041 GAGAGGAAGCAAGAAAGAGAGGG - Intergenic
1067559069 10:47292005-47292027 AAGGGGGAGCAGGGATCACATGG - Intergenic
1067691306 10:48504047-48504069 ATGGGGAAGGAGGGATGGGAAGG + Intronic
1067752250 10:48979337-48979359 AAGTGGAAGCAGATATGGGAGGG - Intronic
1067978025 10:51048286-51048308 GAGAGGAAGGAGGAAAGAGAGGG - Intronic
1067992239 10:51227798-51227820 AAGGTGTGGCAGGGATGAGAGGG + Intronic
1068040588 10:51819215-51819237 GAGAGGAAGCAAGAAAGAGAGGG + Intronic
1068269172 10:54697658-54697680 AAGGGGAAGGGGGAAGGGGAAGG + Intronic
1069277893 10:66615460-66615482 AAGGAGACACAGGAAGGAGAAGG + Intronic
1069960148 10:72074771-72074793 AAGAGGAAGAAGGAGAGAGAGGG - Intronic
1070377647 10:75849181-75849203 CAGGAGAAGCAAGAATAAGAAGG - Intronic
1070661466 10:78309432-78309454 ATTGGGAGGCAGGGATGAGAAGG + Intergenic
1070891025 10:79942336-79942358 AAGGGAAAGGAGGAAGGACAAGG - Intronic
1071018119 10:81021647-81021669 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1071152233 10:82649245-82649267 AAGGGGAGGCAGGAGGTAGAGGG - Intronic
1071718445 10:88120006-88120028 AGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1071718466 10:88120059-88120081 AGGGGGAAGCAGGAAGGATGGGG + Intergenic
1071718473 10:88120077-88120099 TGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1071718479 10:88120095-88120117 GGGGGGAAGCAGGAACGAGGGGG + Intergenic
1071718484 10:88120112-88120134 AGGGGGAAGCAGGAACGAGGGGG + Intergenic
1071718499 10:88120165-88120187 AGGGGGAAGCAGGAACGAGGGGG + Intergenic
1071718513 10:88120213-88120235 AAAGGGAAGCAGGAAGGCGGGGG + Intergenic
1072054963 10:91745735-91745757 AAGGAGAAGGAAGAAGGAGAAGG + Intergenic
1072517448 10:96199547-96199569 AAGGACAAGTAGAAATGAGATGG + Intronic
1072996351 10:100248222-100248244 GAGTGGAAGCAGGTATGAAAGGG + Intronic
1073435375 10:103512993-103513015 ACAGGGAACCAGAAATGAGAAGG - Intronic
1073499477 10:103922847-103922869 AAGGGGAAGCCAGAGAGAGAGGG - Intergenic
1073768415 10:106708769-106708791 GTGGAGAAGCAGGAATGGGAAGG - Intronic
1073937200 10:108647870-108647892 AGGAGGAAGTAGGAAGGAGAGGG - Intergenic
1074241230 10:111641226-111641248 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1074840831 10:117349270-117349292 GAGAGGCAGAAGGAATGAGAAGG + Intronic
1074876236 10:117615621-117615643 CATAGGAAGCAGGTATGAGATGG + Intergenic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1075327566 10:121546744-121546766 AACGGGTAGAAAGAATGAGATGG + Intronic
1075515387 10:123104209-123104231 ATATGGGAGCAGGAATGAGAAGG - Intergenic
1076004816 10:126940024-126940046 GAGGAGAAGCAAGAAGGAGAAGG + Intronic
1076179685 10:128397552-128397574 AAGGAGAAACAGGGATGGGATGG - Intergenic
1076605938 10:131689890-131689912 AGGGGGCAGCAGGAAGGAAAGGG - Intergenic
1076874870 10:133211051-133211073 AAGGGGAAGCACCAAGCAGAGGG + Intronic
1077391338 11:2301962-2301984 AAGGGCAGGCAGGAAGGGGAGGG - Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078360142 11:10661653-10661675 AGGGGGAAGCAGAGATCAGAGGG - Intronic
1078362539 11:10680411-10680433 AAGGGAAAGAAAGAAAGAGAGGG + Intronic
1078566863 11:12422669-12422691 GGGGGAAAGCAGGAAAGAGAAGG - Intronic
1078593351 11:12665127-12665149 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1078654263 11:13223492-13223514 AAGGGGGAGCAGGAAAAAGGAGG - Intergenic
1078722379 11:13896937-13896959 AAAGGGAAGGAGGACTGTGAGGG + Intergenic
1079182155 11:18203507-18203529 AAGTGGAAGGAGGAAGAAGAAGG + Intronic
1079329468 11:19521747-19521769 ATGAGGAAGCAGGAATCAGAGGG + Intronic
1079449560 11:20588044-20588066 AAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1079571927 11:21953445-21953467 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1079754584 11:24240315-24240337 AAAGGGGAGCAAGCATGAGAAGG + Intergenic
1080021521 11:27565573-27565595 AAAGGGAAGGAGGATTGAGGAGG + Intergenic
1080237903 11:30092878-30092900 AAGGAGAAGGAGGAAGGAGGAGG - Intergenic
1080422212 11:32120486-32120508 AAGGGGAAGCAGGCATCACATGG - Intergenic
1080429654 11:32186421-32186443 AAGTGGAAGTAGAAATGAGTAGG - Intergenic
1080603218 11:33841331-33841353 AAGGGAAAGGAGGAGGGAGAAGG - Intergenic
1080982902 11:37429888-37429910 CAGGGCAATCAGGCATGAGAAGG - Intergenic
1081779871 11:45702844-45702866 AAGGGGAATGAGGAGTGAGAAGG + Intergenic
1081940224 11:46935402-46935424 AAGGGAAAGCAAGAATTAGGAGG + Intergenic
1082273336 11:50195735-50195757 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1082852743 11:57779980-57780002 GAGGGGAAGGAGGCAAGAGAAGG - Intronic
1083139142 11:60707244-60707266 AAGAGGATGCAGAAGTGAGAAGG + Intronic
1083166290 11:60890147-60890169 AAGCTGAAGCTGGAATGAGAGGG - Intergenic
1083275413 11:61594411-61594433 AAGGGGAACAAGGAATTAGGTGG + Intergenic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083403207 11:62439038-62439060 AAAGTGAACCAGGAAGGAGAGGG + Intronic
1083593806 11:63909749-63909771 GAGGGGAAGGAGGGAGGAGAGGG - Exonic
1083738195 11:64693711-64693733 GAGAGGAAGCAGGTAGGAGAAGG + Intronic
1083799273 11:65037035-65037057 AGTGGGAAGAAGGAATGGGAGGG + Intronic
1083974580 11:66107364-66107386 AAAGGGAAGCAGGAATAATGTGG - Intronic
1084363088 11:68681785-68681807 AAGGAGAAGAAGAAAAGAGAAGG - Intergenic
1084422608 11:69067812-69067834 AAAGGAAAGAAGGAAAGAGAAGG - Intronic
1084497940 11:69516097-69516119 AAGTGGAAGCAAGAGAGAGAAGG + Intergenic
1084884288 11:72193368-72193390 AAGGGGAGGAAGGAAAGGGAGGG + Intronic
1085684580 11:78610119-78610141 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1085805441 11:79631903-79631925 AAGGGAATGTAGGAATGAGGAGG + Intergenic
1086311057 11:85536813-85536835 GAGGGGAAGCGAGAAAGAGATGG - Intronic
1086363042 11:86079021-86079043 TAGAGGAAGAAGGAAAGAGATGG - Intergenic
1086866957 11:91991285-91991307 GAGGGGGAGCAAGAAAGAGAGGG - Intergenic
1087178581 11:95119889-95119911 AAGGGGAGGGAAGAGTGAGAAGG - Intronic
1087840059 11:102911150-102911172 AAGGGGAAGAATGAAAAAGAAGG + Intergenic
1088303914 11:108387876-108387898 AAGGGGTAGCAGTAGTAAGAAGG - Intronic
1088375768 11:109140301-109140323 AAGGGAGAGAAGGAAGGAGAGGG - Intergenic
1088507132 11:110537897-110537919 ATGGGGTAGCAAGAATGACAGGG - Intergenic
1088626488 11:111733825-111733847 GAAGGGAACCAGGGATGAGAGGG + Intronic
1088758791 11:112909862-112909884 AAGGGAAAACAGGTATGTGAGGG - Intergenic
1088787638 11:113197021-113197043 ACGTGGCAGCAGGAAAGAGAAGG + Intronic
1088808878 11:113376059-113376081 GTGGGAAAGCAGGAAGGAGAAGG + Intronic
1088879530 11:113962730-113962752 AAGAGGGATCAGGCATGAGAAGG + Intergenic
1089010818 11:115130255-115130277 AAGGGGAAGTGGGGAGGAGAGGG - Intergenic
1089055913 11:115584669-115584691 AAGAGGAAGAAGTAATGAGGAGG + Intergenic
1089173872 11:116534740-116534762 CAGGGTAAGGAGGAATGGGAAGG + Intergenic
1089277881 11:117351642-117351664 AGGGAGAAGATGGAATGAGAGGG - Intronic
1089295193 11:117463163-117463185 AAGGTGAAGCAGGAAGGCTATGG + Intronic
1089348496 11:117807450-117807472 AAGAGCAAGAAGGGATGAGATGG + Intronic
1089459052 11:118642123-118642145 AAGAGGAAGAAGGAAGGGGAAGG - Intronic
1089544126 11:119209675-119209697 AAGATAAAGCAGGTATGAGATGG - Intronic
1089668812 11:120037846-120037868 GAGGGGAAGCAAGAGCGAGAGGG - Intergenic
1089759703 11:120714352-120714374 AAGGGAAGGCAGGAAGGAAAAGG - Intronic
1089839270 11:121400252-121400274 AAGAGGAAGCAAGAGAGAGAGGG - Intergenic
1089946585 11:122480091-122480113 AAGGGGAGGGAAGAATGGGAAGG + Intergenic
1090331067 11:125932569-125932591 AAGGGGAAGCAGGCTTGGGCTGG - Intergenic
1090464627 11:126923287-126923309 AAGGAGAAGGAAGAAGGAGAAGG - Intronic
1090464634 11:126923338-126923360 AAGGAGAAGGAAGAAGGAGAAGG - Intronic
1090618346 11:128537886-128537908 AGGGAGAAGAAGTAATGAGATGG + Intronic
1090841069 11:130487797-130487819 AATGGGAAGAAGGAAAGAGAAGG - Intergenic
1090847554 11:130543705-130543727 AAGGGGAGGCTGGAGAGAGAGGG + Intergenic
1091011122 11:132001569-132001591 GAGAGGAAGCAGGAGAGAGAGGG + Intronic
1091172409 11:133530449-133530471 GAGGGGAAGCGGGTATGAGGAGG + Intronic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091518916 12:1216104-1216126 AACGGAAAGAAGGAAGGAGAGGG - Intronic
1091629261 12:2146920-2146942 TAGGGGAAGCAGGGAAGAGAGGG + Intronic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1091637047 12:2205118-2205140 AAAGGGAAGGAGGAATGTCAGGG - Intronic
1091944875 12:4530271-4530293 ACCCGGAAGCAGAAATGAGAAGG + Intronic
1092087246 12:5773215-5773237 ATGGGGAAGCAACAATGGGAGGG - Intronic
1092159545 12:6308584-6308606 AGTGGGAAGGAGGAATAAGAGGG - Intergenic
1092477032 12:8828327-8828349 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1092907828 12:13118079-13118101 GAGGGGAAGAAGGAATGGAAAGG - Intronic
1092950386 12:13498256-13498278 GGGGGGAAGCAGAACTGAGAGGG + Intergenic
1093009613 12:14092135-14092157 CAGGAAAAGCAGTAATGAGAGGG + Intergenic
1093903242 12:24660826-24660848 AAGGAGAGGGAGGAATGGGAAGG - Intergenic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094349359 12:29506622-29506644 AAGGGCAAGAAGGTCTGAGAGGG - Intronic
1095116112 12:38354175-38354197 CAGGGGAATCAGGTAGGAGAAGG - Intergenic
1095312466 12:40716324-40716346 AAGGGGAAGGAGGAAAGGAAGGG - Intronic
1096005751 12:48169676-48169698 GAGTGGAAGCAGGTGTGAGAGGG - Intronic
1096377500 12:51125424-51125446 GAGTGGAAGCAGGTGTGAGAGGG - Intronic
1097160253 12:57041336-57041358 GAGGGGAGGTAGGACTGAGACGG - Intronic
1097238263 12:57554746-57554768 AAGAGGGAGCAGGAATCACATGG + Intronic
1097357987 12:58623427-58623449 AAGGGGAAGAAGGCAAGTGAGGG - Intronic
1097658783 12:62403651-62403673 AAGGGGAAGTAGAATGGAGAGGG + Intronic
1098333919 12:69382419-69382441 AAGGGGAGGGAAGAATGGGAAGG - Intronic
1098343545 12:69476029-69476051 AAGGGGCACGAGGAAGGAGAGGG - Intronic
1098521274 12:71437524-71437546 ATGAGGAAGCAGGAGAGAGAGGG + Intronic
1098953588 12:76666259-76666281 AAGGGGAAGCATGAAAGAAGTGG + Intergenic
1098994459 12:77102852-77102874 AAGAGGAAGAAGGCAAGAGAGGG - Intergenic
1099025037 12:77454849-77454871 ATGGGGGAGGGGGAATGAGAGGG + Intergenic
1099064910 12:77963911-77963933 GAGGAGAAGAAGGAAGGAGAAGG - Intronic
1099410191 12:82315531-82315553 AAGGGGAAGGAGGGATGAACAGG + Intronic
1099734435 12:86550117-86550139 ACGAGGCAGCAGGAAAGAGAGGG - Intronic
1099779043 12:87171225-87171247 AAGGGGAGGAAGGAGAGAGAAGG + Intergenic
1099867440 12:88301184-88301206 AAGTGGAAGGAGAAATGAAATGG - Intergenic
1100132814 12:91517515-91517537 AAGTGGAACCATGAAAGAGATGG - Intergenic
1100367872 12:93937958-93937980 AAGGGTGAGCAGGAAAGAGCAGG - Intergenic
1100659346 12:96679825-96679847 ACGGGGAGGGAAGAATGAGAGGG - Intronic
1100931139 12:99610583-99610605 AATGGGAAGCAGGAGAAAGAAGG + Intronic
1101677978 12:106937084-106937106 AAGGGGAAACAGTAGAGAGAAGG - Intergenic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1102073942 12:110045024-110045046 AGGGGGAAGAAGGAAGGAGAAGG + Intronic
1102145345 12:110651055-110651077 AAGAGGAAGAAGGGAGGAGAGGG + Intronic
1102318010 12:111905402-111905424 AAGGGAAAGGAAGAGTGAGAAGG + Intergenic
1102397052 12:112595495-112595517 AAGGGGAAGGAGGAGGGAGAGGG - Intronic
1102632121 12:114290290-114290312 AAAGGGAAACAGAAATGAAAAGG + Intergenic
1102642479 12:114379230-114379252 AAGGGGAAGCAGGAAGCACCAGG - Intronic
1102672046 12:114628456-114628478 AGATGGAAGCAGGAATGAGGCGG - Intergenic
1102720451 12:115011559-115011581 AAGGGGAGGGAGGAATGAAGAGG - Intergenic
1102800109 12:115724738-115724760 AGGAGGAAGCAGGAATAAGCAGG + Intergenic
1102894067 12:116584542-116584564 AGGGGGAAGCAGGAGCAAGAAGG - Intergenic
1103135007 12:118499453-118499475 AAGGAGAGGAAGGAAGGAGAGGG - Intergenic
1103956789 12:124581931-124581953 AAGGGAAGGAAGGAAGGAGAAGG + Intergenic
1104370494 12:128219932-128219954 AAGAGGAAGAAGGAGAGAGATGG + Intergenic
1104774262 12:131382764-131382786 AGGAGGGAGCAGGAATCAGAGGG - Intergenic
1104774470 12:131383497-131383519 AGGAGGGAGCAGGAATCAGAGGG - Intergenic
1104846121 12:131847861-131847883 GAGGGGGAGCAGGGGTGAGACGG - Intronic
1106758327 13:32844235-32844257 ATGAGGGAGCAGGAGTGAGAAGG - Intergenic
1106896051 13:34303139-34303161 AAGGGGATGAAAGAGTGAGAAGG + Intergenic
1106929457 13:34648163-34648185 AAAGGGAAGGAGGGAAGAGAAGG + Intergenic
1107238537 13:38202492-38202514 AAGGGGCAGTAGGAAAGTGAAGG + Intergenic
1107314203 13:39113553-39113575 AAAGGAAAGCAGGAAAGGGATGG - Intergenic
1107451983 13:40518097-40518119 AAGGGGATGCAGGGTTTAGAAGG - Intergenic
1107616878 13:42178927-42178949 AAGGGGAAGAAAGAAAGAAAAGG + Intronic
1107635360 13:42386816-42386838 AAGGGGGAGCAGGCATCACATGG + Intergenic
1108037680 13:46308670-46308692 GAGAGGAAGCAAGAAAGAGAGGG - Intergenic
1108396682 13:49996997-49997019 AAGGGGAAGCGGGAGAGGGAAGG + Intronic
1108544515 13:51479372-51479394 AAGAGGAAGCAAGAGTGACAGGG - Intergenic
1108951315 13:56098385-56098407 GAATGGAAGCAAGAATGAGAAGG + Intergenic
1108958244 13:56187710-56187732 GAGGGGAAGCAAGAAAGAGAGGG - Intergenic
1109157327 13:58927084-58927106 TAGGGGAAGAGGAAATGAGAAGG - Intergenic
1109628236 13:65007769-65007791 AAAGGGAAGCAGAAATAAGGGGG - Intergenic
1109729148 13:66387585-66387607 AAGAGGAAGGAAGGATGAGACGG - Intronic
1110276214 13:73644532-73644554 CAGGGCAAGCAGGCAGGAGAAGG + Intergenic
1110684028 13:78350728-78350750 TAGGGGAAGCAGCTTTGAGAAGG + Intergenic
1110897539 13:80773845-80773867 AAGGGGAAGAAGGAAAGAAAAGG + Intergenic
1110916905 13:81031715-81031737 AAGGGGAAGCAAGAGAGTGAAGG + Intergenic
1111197541 13:84894699-84894721 GAGGGGAAGCCAGAAAGAGATGG + Intergenic
1111567796 13:90039318-90039340 AACAGGAAGCATGAATGAAAGGG - Intergenic
1112168611 13:96946906-96946928 GAGGGGAAGCATGACTGAGATGG + Intergenic
1112238516 13:97658125-97658147 AAGGTGAACCAGTCATGAGAAGG + Intergenic
1112945143 13:104918997-104919019 AAGAGGAAGGAGGAATGATTTGG - Intergenic
1113251658 13:108459793-108459815 AATGGAAAGCAGCAATGAGTTGG - Intergenic
1114203947 14:20550101-20550123 AAGGGGCAGGAGGTATGAAAGGG + Intergenic
1114481791 14:23040372-23040394 AAGGGGGAGCAGGAGCTAGAAGG + Intergenic
1114521086 14:23336736-23336758 AAGGGGAAGGAGGAATAGGATGG - Intergenic
1115054683 14:29108990-29109012 AAGGGAAAGAAAGAAAGAGAGGG + Intergenic
1115522078 14:34243030-34243052 GAGGGGAATAAGGGATGAGAAGG - Intronic
1116141034 14:40994873-40994895 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1116434109 14:44877508-44877530 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
1117115538 14:52507061-52507083 CAGGGCAATCAGGAAAGAGAAGG + Intronic
1117244440 14:53870229-53870251 AAGAGGCAGCAGCCATGAGAAGG + Intergenic
1117516992 14:56511779-56511801 AAGGAGCAACAGGAATAAGAGGG + Intronic
1118092610 14:62498700-62498722 AAGGAGAAGCAAGGAGGAGAGGG + Intergenic
1118107057 14:62671712-62671734 AAGGGGAAGCAATAGTGTGATGG + Intergenic
1118446268 14:65853812-65853834 AAGGGGCAGCAGGGAGGGGAGGG + Intergenic
1120583909 14:86287344-86287366 GAAGGGAAGAAGGAAAGAGAAGG + Intergenic
1120643670 14:87046178-87046200 AAGGAGCAGCATGAATGAAATGG - Intergenic
1120977299 14:90260289-90260311 AAGGGGTAACAGGAAGTAGAGGG + Intronic
1121013376 14:90534594-90534616 GGGGAGGAGCAGGAATGAGAAGG + Exonic
1121315170 14:92957062-92957084 TAGGGGAAGAAGGGCTGAGAGGG + Intronic
1121834849 14:97082855-97082877 ATGTGGAAGCAGGGATGATATGG - Intergenic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1122826696 14:104374148-104374170 AAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1202915737 14_GL000194v1_random:170433-170455 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202877011 14_KI270722v1_random:12611-12633 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1123490750 15:20780043-20780065 AAGGGGAACTAAGAATGAAAAGG - Intergenic
1123547252 15:21349134-21349156 AAGGGGAACTAAGAATGAAAAGG - Intergenic
1125171693 15:36772601-36772623 AATGGGAAGCAAGACTGAGTTGG - Intronic
1125234386 15:37495601-37495623 AGGGGGAAGGAGGAATGAATAGG - Intergenic
1125526414 15:40378364-40378386 AAGGGGAAGGAGGAATGATTTGG + Intergenic
1125757220 15:42071925-42071947 AAGGAGAGGCAGGAGTGTGAGGG + Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126167623 15:45666987-45667009 AAGGAGAAGGAAGAAAGAGAGGG - Intronic
1126428413 15:48554560-48554582 GTGGAGAAGCAGGAAAGAGATGG + Intronic
1126572122 15:50163853-50163875 AAGGGGAAGGAAGAAGGGGAAGG - Intronic
1126674878 15:51152440-51152462 AAGAGGAAGAAGGAAGAAGAAGG + Intergenic
1126744096 15:51807536-51807558 GAGTGGAAGCAGCAATCAGAAGG + Intronic
1126802381 15:52310694-52310716 AAGGGGAAGAGTGAATGAGTAGG + Exonic
1127071855 15:55295188-55295210 AAGAGAAAGAAGGAAGGAGAAGG + Intronic
1127122051 15:55780297-55780319 AAGAGGAAGGAGGAAGCAGAAGG + Intergenic
1127155689 15:56122754-56122776 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1127196520 15:56591683-56591705 AAAGGGAAGGAAGAGTGAGAAGG + Intergenic
1127203638 15:56687987-56688009 AAGGAAAAGAAGGAAGGAGAGGG - Intronic
1127434184 15:58940185-58940207 GAAGGGAAGGAGGAATGAGCAGG + Intronic
1127446389 15:59067337-59067359 AAGGGAAAGGAGAAAGGAGAGGG - Intronic
1127546305 15:59996950-59996972 AAAGGTTAGCGGGAATGAGAAGG + Intergenic
1127969076 15:63944998-63945020 AAGGGGAGGCAGGGTTGAGGGGG - Intronic
1128241776 15:66106160-66106182 AAGGGAAAGGAGAAAGGAGATGG + Intronic
1128363451 15:66979555-66979577 AAGGGGAGGGAGGAAGGGGAAGG - Intergenic
1128522871 15:68387002-68387024 GAGGGGAAGGAAGAACGAGAAGG + Intronic
1128705026 15:69832307-69832329 AAGGGGAAGGGGGAAAAAGAAGG + Intergenic
1128811482 15:70576119-70576141 ATGGGGAAGCAGGAAAGAGTTGG + Intergenic
1128816233 15:70610736-70610758 AAGGGGATCCTGGAATGAGATGG - Intergenic
1129056076 15:72821532-72821554 AAGGGGAAACAGGAACCAGGAGG - Intergenic
1129686665 15:77689869-77689891 AGGGGGAAGCAAGAAGGGGAAGG + Intronic
1130088047 15:80795109-80795131 AAGGGGAGGCAGGGGTGAGGGGG + Intronic
1130511858 15:84595897-84595919 AAGGGGAAGGAAGAATGGGAAGG + Intergenic
1130655441 15:85789287-85789309 ACGGGGAAGCAGGGCTGAGCAGG - Intronic
1130759928 15:86808569-86808591 AAGGGGAGGAAGGAAGGAAAGGG - Intronic
1130831627 15:87607108-87607130 AGAGGGAAGCAGGCATGTGAGGG + Intergenic
1130942517 15:88523412-88523434 AAGGGGAGACAAGAGTGAGAGGG - Intronic
1131565363 15:93480492-93480514 AAGGAGAATCACAAATGAGAGGG - Intergenic
1131818613 15:96248444-96248466 AAGGGGAGGCAAGAATGTGATGG - Intergenic
1131905359 15:97136336-97136358 AAGGGGAAGCAGGACGTACATGG + Intergenic
1132282859 15:100635135-100635157 AAAGGGAAACAGGAGTGACAAGG - Intronic
1202955582 15_KI270727v1_random:76365-76387 AAGGGGAACTAAGAATGAAAAGG - Intergenic
1132880165 16:2158612-2158634 AAGAGGCAACAGGAATGTGAGGG - Intronic
1133392727 16:5422673-5422695 GAGAGGGAGCAGGAAGGAGAGGG + Intergenic
1133392853 16:5423089-5423111 AAGAGGAAGGAGGAGGGAGAGGG + Intergenic
1133819767 16:9226144-9226166 AAGGGAAGGAAGGAAGGAGAAGG - Intergenic
1133819774 16:9226168-9226190 AAGGGAAGGAAGGAAGGAGAAGG - Intergenic
1134084850 16:11349316-11349338 GTGGGGATGCAGGAAGGAGAGGG + Intronic
1134386303 16:13776596-13776618 AAGGGGAAGCAAGACAAAGAAGG + Intergenic
1134843148 16:17417478-17417500 ATGAGCAAGCAGGAATGGGAAGG - Intronic
1135166826 16:20146492-20146514 AAGGGGAGGAAGGAGGGAGAAGG + Intergenic
1135259425 16:20968033-20968055 AATGGGAAGCAGGAGCCAGAAGG + Intronic
1135499127 16:22978431-22978453 AAGGGGCAGAAGGAAGGTGAGGG + Intergenic
1135551464 16:23401351-23401373 GTGGTGAAGCCGGAATGAGAAGG + Intronic
1135832609 16:25789338-25789360 AAAGGAAAGAAGGAAGGAGAGGG - Intronic
1136008785 16:27348853-27348875 AAGAGGAAGCAGGACTGTGCTGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136539105 16:30918737-30918759 AAGGAGAAGAAGGAAGGAGGAGG - Intergenic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1137503798 16:49032835-49032857 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1137591062 16:49694191-49694213 AAGGGGGAGCAGGAGGGAGAGGG + Intronic
1138250019 16:55494861-55494883 AAGGAGAAGCAAGAATCTGATGG + Intronic
1139004276 16:62551563-62551585 AAGGGGAAAAAGGAAAGGGAAGG - Intergenic
1139019379 16:62728436-62728458 AAGGGAAAGCAGGAAACAAAAGG + Intergenic
1139060950 16:63250708-63250730 AAGGGGAAGGAGGAGGGAAAGGG + Intergenic
1139147451 16:64341596-64341618 AAGGGAAGGAAGGAAGGAGAGGG - Intergenic
1139147465 16:64341642-64341664 AAGGGAAGGAAGGAAGGAGAGGG - Intergenic
1139363613 16:66419271-66419293 AAGGGGAAGGAGGAATGGGGAGG + Intergenic
1139558517 16:67727654-67727676 AGGGGGCAGCAGGAAAGAGTGGG - Intronic
1139773726 16:69299822-69299844 AGGGGTAAGAAGTAATGAGAAGG - Intronic
1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG + Intronic
1140205324 16:72928249-72928271 AAGGGGAAGATGGAAAGAGCGGG + Intronic
1140306056 16:73804196-73804218 AAGGGGTAGGAGGAACGAGGAGG + Intergenic
1140330790 16:74054880-74054902 AAGGGGAAGAAGAAATAAAAGGG + Intergenic
1141460864 16:84178151-84178173 AAGGGGAGGGAGGAAAGAAAGGG + Exonic
1141612223 16:85188088-85188110 AAGGGGAGGCAGGTGTGGGATGG + Intergenic
1141690437 16:85593534-85593556 ACGTGGAAGCAGGAAGGAGAAGG - Intergenic
1141809022 16:86361805-86361827 CAGTGGAAGCAGGACAGAGAAGG - Intergenic
1142601213 17:1053795-1053817 AACGGGAAGCAGGAGAGGGAGGG + Intronic
1142816224 17:2428010-2428032 AAGTGGAAGAGGGAAGGAGAGGG + Intronic
1143287323 17:5800057-5800079 GAGGAGAAGGAGGAAGGAGAGGG - Intronic
1143595772 17:7912639-7912661 AAGGGGCAGCAAGAAAGTGAAGG - Exonic
1144225389 17:13139894-13139916 ACGTGGCAGCAGGAAGGAGAAGG - Intergenic
1144715627 17:17433600-17433622 AAGGGTAAACAGGAATTGGAGGG - Intergenic
1145056453 17:19706805-19706827 AGTGGGGAGCAGGAATGAGGTGG - Intronic
1145886822 17:28387834-28387856 ATAGGGAAGAAGGAATGAGGGGG + Intronic
1145933238 17:28700665-28700687 AAGGGGAAGAGGGTAAGAGAGGG + Intronic
1145986193 17:29048568-29048590 AAGGCGGGGCAGGAAAGAGATGG - Intronic
1146304678 17:31721916-31721938 AAGTGGAGGCATAAATGAGAAGG + Intergenic
1146485952 17:33242748-33242770 AAGTGTAAGGAGGACTGAGAAGG - Intronic
1146784914 17:35711448-35711470 TGGGGGAAGCTGGAATGAGAAGG - Intronic
1146986148 17:37220366-37220388 AAAGGGAAGCAGGAAAAAGCAGG + Intronic
1147216312 17:38901173-38901195 AAAGGGAAGCAGGGATGACTGGG - Intronic
1147626586 17:41904306-41904328 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1147746697 17:42699116-42699138 CTGGGGAAACAGGGATGAGAAGG - Exonic
1148046452 17:44747919-44747941 AAGGGGAAGCAGGGCTCAGAGGG - Intronic
1148538702 17:48462520-48462542 AAAGGGAGGCAGGAGAGAGAGGG + Intergenic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1149061454 17:52427606-52427628 AAGAGGAGGCAGGCATAAGAAGG - Intergenic
1149417174 17:56471328-56471350 AAAGGAAAGCAGGGAAGAGAAGG - Intronic
1150493261 17:65588837-65588859 AAGGGGAAGGGGGAAAGGGATGG - Intronic
1151145229 17:72034388-72034410 AGGGGGAAGCAGGAGGGACATGG - Intergenic
1151175530 17:72284856-72284878 AAGAGGAAGAAGGAAAGAAAAGG - Intergenic
1151192389 17:72407935-72407957 TAGGAGGAGCAGGAATTAGAAGG + Intergenic
1151552672 17:74831099-74831121 GAGGGGAAGCAGGTGTCAGACGG - Intronic
1152112638 17:78365728-78365750 TATGCGAAGCAGGAAAGAGAGGG - Intergenic
1152304735 17:79513899-79513921 TAGGGGAAGCAGGGGTGAGCTGG - Intronic
1152320446 17:79606079-79606101 CAGGGGCAGCAGCAGTGAGAAGG + Intergenic
1152397067 17:80039933-80039955 AAGGGGAAGCAGCAGTGGAAGGG + Exonic
1152628106 17:81397541-81397563 AAGGGAAAGAAGGAAAGGGAGGG - Intronic
1153114891 18:1643177-1643199 AAGGGCAATCAGGCAGGAGAAGG - Intergenic
1153152884 18:2114642-2114664 AAGGCGAAGGAGGAATGAATTGG - Intergenic
1153210504 18:2758220-2758242 AAAGGAAAACAGGAAAGAGAAGG - Intronic
1153416011 18:4846378-4846400 ATGAGGAAGGAGGAATGAGTGGG - Intergenic
1153576546 18:6527513-6527535 GAAGGGAAGCAGGAATAGGAGGG + Intronic
1156010673 18:32494046-32494068 AAGTCGAAGCAGGAAACAGATGG - Intergenic
1156576210 18:38318999-38319021 GAAGGGAAGCAGGAAAGAGAAGG + Intergenic
1156601707 18:38614929-38614951 AGGTGGAAGCAAGAAAGAGATGG - Intergenic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1157170925 18:45404429-45404451 AATGGGAAGAAGGAAGGAAAGGG - Intronic
1157193203 18:45598341-45598363 AAGGGGAGGGAGAAATGACATGG + Intronic
1157303664 18:46500082-46500104 AGGGGGAAGAAGAAAAGAGAAGG - Intronic
1157396667 18:47347237-47347259 AAGTGGGAGCAAGAAAGAGAGGG + Intergenic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157715971 18:49887530-49887552 AAGGGGGAGCAGGCATCACATGG - Intronic
1157740998 18:50092738-50092760 AAGGGGAAGAGGAAATGATATGG + Intronic
1157815267 18:50725439-50725461 AAGGGGCTGCTGGAATGGGACGG - Intronic
1158186740 18:54780015-54780037 ATGGGGAAGCAGTCAGGAGAAGG - Intronic
1158186781 18:54780186-54780208 AGGGGGAAGCAGTCAGGAGAGGG - Intronic
1158423108 18:57313442-57313464 AGGGGGAAGGGGGAAGGAGAAGG + Intergenic
1158454610 18:57595085-57595107 AAGGAGATGCTAGAATGAGATGG + Intergenic
1158521783 18:58177132-58177154 AAGGAGAGGAAGGAATGAGGAGG - Intronic
1158911558 18:62068183-62068205 ATGGGGATGAAGGAAGGAGACGG + Intronic
1159002061 18:62983157-62983179 AAGGGGAATTGGGAATTAGATGG - Intergenic
1159091970 18:63860225-63860247 AAGGGGAAGAAAGAGTGAGAAGG - Intergenic
1159650007 18:70966898-70966920 AAAAGGAAGCAGGAATCAGAGGG + Intergenic
1159890957 18:73952807-73952829 AAAAGGAAGCTGGAAAGAGATGG + Intergenic
1160237673 18:77098942-77098964 AGGGGGAAGGAGGAGTGAGAAGG - Intronic
1160667888 19:341710-341732 AAGTGGAAGCAGGAAAAAGAGGG + Intronic
1160676700 19:394946-394968 ATGGGGAAGGATGATTGAGAAGG + Intergenic
1161357311 19:3826192-3826214 CAGGGGAAAGAGGAATGAGCAGG - Intronic
1161657172 19:5523421-5523443 AAGGGGAGGCAGGGAGGGGACGG - Intergenic
1161753939 19:6117725-6117747 AGGGGGAAGAAGGGAAGAGAGGG + Intronic
1161867796 19:6847475-6847497 AAAGGGAAGCAGCACTGACATGG - Intronic
1161934343 19:7362297-7362319 AAGGAGAAGGAGGAAGAAGAAGG + Intronic
1161978165 19:7617493-7617515 GGGGGGCAGCAGGAATGAGCAGG - Intronic
1162300478 19:9842177-9842199 AAGTGGAAGAAGAAGTGAGAGGG + Intronic
1162339213 19:10081761-10081783 AAGGAGGAGGAGGAAGGAGAAGG + Intergenic
1162376023 19:10305745-10305767 ATGGGGAAGCAAGATGGAGAAGG + Intronic
1162718129 19:12646745-12646767 AGGGGGAAGGAGGAGTGAGGAGG + Intronic
1162897983 19:13776766-13776788 AAGAGGAAACAGGAGTGAGGAGG - Intronic
1163000275 19:14362731-14362753 AAGGAGAAGAAAGAAAGAGAGGG + Intergenic
1163099517 19:15085989-15086011 AAGGGGAAGGAGGGTTGAGGGGG + Intergenic
1163501017 19:17676260-17676282 AAGAGGAGGCAGGGATGAGAGGG + Intronic
1163529176 19:17839711-17839733 AAAAGGAAGAAGGACTGAGAAGG - Intronic
1163609316 19:18292824-18292846 AAGCTGAAGCAGGAAGGGGAGGG - Intergenic
1164210434 19:23093512-23093534 GGGGGGAAGCAGGAACCAGAGGG - Intronic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1165361951 19:35342159-35342181 AAGAAGAAGAAGGAAGGAGAAGG - Intronic
1165673247 19:37697419-37697441 GAGTGGAAGCAGGTGTGAGAGGG - Exonic
1165745135 19:38226248-38226270 AAGGGGGAGGAGGGGTGAGACGG - Intronic
1165745679 19:38228680-38228702 AAGAGGAAGCAAGAGCGAGATGG + Intronic
1166251722 19:41576062-41576084 CAAGGGAGGCAGGACTGAGAGGG + Intronic
1166348659 19:42182946-42182968 AAAGGGAAGCAGGTTAGAGAAGG + Intronic
1166415936 19:42595007-42595029 ACAGGGAGGCAGGACTGAGAGGG - Intronic
1166420593 19:42633213-42633235 ACAGGGAGGCAGGACTGAGAGGG - Intronic
1166496162 19:43304713-43304735 ACAAGGAAGCAGGACTGAGAGGG - Intergenic
1166499729 19:43331604-43331626 AAGGGGAAGCAGGAACCAGAAGG - Intergenic
1166571416 19:43799187-43799209 ATGGGGAAGCAAGGAAGAGAAGG - Intronic
1166888868 19:45977658-45977680 AAGGAGAAGAATGAATGGGATGG + Intergenic
1166983763 19:46648070-46648092 CAAGGAAAGGAGGAATGAGAGGG + Exonic
1167240840 19:48342206-48342228 AAGGGGAAGAAGGAAGGGAAGGG + Intronic
1167596568 19:50431585-50431607 AAGGGGAAGCGGGGAGGAGGTGG - Intergenic
1167651774 19:50734872-50734894 GAGGGCAAGCAGGAGAGAGATGG - Intergenic
1167788786 19:51657946-51657968 AAGGAGAAGGAGGAACGAGGAGG + Intergenic
1168115934 19:54221389-54221411 AAGAGGAGCCAGGACTGAGAGGG + Intronic
1168118917 19:54241137-54241159 AAGAGGAGCCAGGACTGAGAGGG + Intronic
1168231769 19:55037115-55037137 AAGGCTAAGCAGGAAGAAGATGG - Intronic
1168271705 19:55253487-55253509 CAGGGGCAGCCAGAATGAGACGG + Intronic
1168433805 19:56302320-56302342 AAAGGGAAGGAGGAAGGGGAGGG - Intronic
1168501905 19:56899955-56899977 GAAGGGAAGGAGGAAGGAGAAGG + Intergenic
1202673664 1_KI270710v1_random:20321-20343 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202705044 1_KI270713v1_random:16288-16310 AATGGGAAGGGGGAAAGAGAAGG + Intergenic
925247224 2:2394725-2394747 AAGGGGAAGCAGGCGTGTGTGGG - Intergenic
925575869 2:5359068-5359090 AAGGGGAAGCAGGAGAGAAAAGG + Intergenic
925604531 2:5645225-5645247 GAGGGAAAGAAGGAGTGAGAGGG + Intergenic
925927586 2:8681666-8681688 GAGGGGAAGGAGGAGGGAGAAGG - Intronic
925983541 2:9196441-9196463 AAGGGGATGGAGGAATAACAGGG - Intergenic
926457390 2:13083739-13083761 AAGGGGAAGGAGGCATAAGGTGG - Intergenic
926516326 2:13851064-13851086 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
926537156 2:14127560-14127582 ATGGTGAAGCAGGAGAGAGACGG + Intergenic
926921573 2:17945756-17945778 AAGGGGAAGCTGTAATTATAGGG - Intronic
927113494 2:19880701-19880723 AAAGGGAATCATGTATGAGAAGG + Intergenic
927203420 2:20592340-20592362 AAGGGGAAGTAGGAATGGGCGGG - Intronic
927498015 2:23563677-23563699 AATGGGAAGCAGGGCTGAAAGGG - Intronic
927521626 2:23702545-23702567 GATGGGAAGCAGGACTGAGTGGG - Intronic
927670895 2:25068036-25068058 ACAGGGAAGCAGGTAAGAGATGG - Intronic
927726984 2:25433148-25433170 CAGGTGAAGCAGTATTGAGAAGG - Intronic
927901982 2:26827034-26827056 AAGAGGCAGGTGGAATGAGAAGG - Intergenic
927939927 2:27097126-27097148 CTGGGGAAGCAGGAAGGACAGGG + Intronic
928098051 2:28417537-28417559 AAGGGAAAAGAAGAATGAGACGG - Intergenic
928212875 2:29336826-29336848 AAGAGCAAGCAGGTAGGAGATGG - Intronic
928293605 2:30061553-30061575 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
928296368 2:30087488-30087510 GAGGTGAAACAGGAATGGGAAGG - Intergenic
928605565 2:32942528-32942550 GAGAGGAAGCAGGAGAGAGAGGG - Intergenic
928851188 2:35749122-35749144 CAGGGAAATCAGGAAGGAGAAGG + Intergenic
928862412 2:35874854-35874876 AAGGGGAGGGAAGAGTGAGAAGG - Intergenic
928908183 2:36390632-36390654 AACTGCAAGCAGAAATGAGAAGG - Intronic
928970378 2:37021945-37021967 AAGGGTAAGCAGTGATCAGATGG - Intronic
929291863 2:40201815-40201837 ATGGGAAAGCAGCAATGATAAGG + Intronic
929435202 2:41923412-41923434 AAGGGGGAGCAAGCCTGAGATGG - Intergenic
929522017 2:42661902-42661924 AAAGGGAAGTAGGACTCAGAAGG - Intronic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929591002 2:43146230-43146252 GAGGGGAAGGAGGAATGGTAGGG - Intergenic
929635943 2:43521084-43521106 AAGGGAAGGGAGGAAAGAGAGGG + Intronic
929998653 2:46846417-46846439 AGGGAGAAGCAGGCATAAGAGGG + Intronic
930475513 2:51876223-51876245 AAGGGGAAGGAAGAATGTGAAGG + Intergenic
930944827 2:57061284-57061306 AAGGGGAGGGAAGAGTGAGAAGG - Intergenic
930945891 2:57075242-57075264 GAGGGGAAGCAAGACAGAGATGG + Intergenic
931063111 2:58553586-58553608 AAGGGGGAAAAGGAAGGAGAAGG - Intergenic
931123194 2:59244052-59244074 AAAGGAAAGAAGGAAGGAGAGGG + Intergenic
931287859 2:60847657-60847679 CAGGGAAAGCAGCACTGAGAAGG - Intergenic
931402619 2:61944869-61944891 AAGGGGAAGTAGGAGTAAGGTGG + Intronic
931409879 2:62019152-62019174 AAGAGAAAGGAGGAAAGAGAAGG - Intronic
931637324 2:64352208-64352230 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
931682042 2:64759019-64759041 AAAGGGGAGCAGGAAGGTGATGG - Intergenic
931967677 2:67551338-67551360 AAGGAGAAGCAACAAGGAGAAGG + Intergenic
931989377 2:67774506-67774528 AAGAGGAAGAAGGAATTATAAGG - Intergenic
932076229 2:68665774-68665796 AATAGGAACCAGGAATGGGAAGG + Intergenic
932428967 2:71662074-71662096 ATGGGGAAACAGGCATGGGAGGG - Intronic
932831049 2:74990612-74990634 AAGGGGCAGAAGGAGGGAGAGGG - Intergenic
932977244 2:76618228-76618250 AAGGGTGAGTAGGTATGAGAGGG - Intergenic
933035698 2:77394773-77394795 AAGGTGAAGCAGGAACACGAAGG + Intronic
933272230 2:80245579-80245601 AATGACAAGCAGGAATGGGATGG - Intronic
933550757 2:83772316-83772338 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
933788309 2:85862352-85862374 AATGGGGAGCAGGGATGAGAAGG + Intronic
934152851 2:89165276-89165298 AAGGGCAATCAGGCAAGAGAAGG - Intergenic
934214391 2:90016656-90016678 AAGGGCAATCAGGCAAGAGAAGG + Intergenic
935345390 2:102103339-102103361 AAGGGGAAGGAGCAAAGAGGAGG + Intronic
935450611 2:103204683-103204705 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
935629618 2:105202378-105202400 ATGGTGAAGCAGGAGAGAGAGGG + Intergenic
935930261 2:108116618-108116640 AAGAAGAAGCAAGAGTGAGAAGG + Intergenic
935998202 2:108797159-108797181 AAAGGGTATAAGGAATGAGAAGG + Intronic
936486393 2:112929432-112929454 AAGGGAAATGAGAAATGAGAGGG + Intergenic
937102633 2:119283388-119283410 AAGGCAAAGCAGGAAGGAGGAGG - Intergenic
937613509 2:123892859-123892881 AAGGTGAGGGAAGAATGAGAAGG - Intergenic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
937866595 2:126756241-126756263 AAGGGGAAGTAAGAATTAGCTGG - Intergenic
937883803 2:126886761-126886783 ACGGGGAGGCAGGAATCAGGAGG - Intergenic
937978253 2:127594367-127594389 AAGGGGCAGCAGGGATGGGTGGG - Intronic
938512619 2:131966601-131966623 GAGGGGAAGCGAGAAAGAGACGG - Intergenic
938565759 2:132516852-132516874 AAGAGGGAGGATGAATGAGAGGG + Intronic
938619325 2:133032383-133032405 AAGAAGAGGGAGGAATGAGAAGG + Intronic
939075249 2:137594066-137594088 GAGGGGAAGCAGAACTGAAAAGG + Intronic
940116848 2:150219150-150219172 AAGGGGAAGCAGGCAGGATCAGG + Intergenic
940453838 2:153872308-153872330 GAGGGGAAGCGAGAAAGAGACGG - Intronic
940688996 2:156891172-156891194 AGAAGGAAGCAGAAATGAGATGG + Intergenic
940809538 2:158226953-158226975 AAGGGCAATCAGGCAGGAGAAGG + Intronic
941227718 2:162868967-162868989 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
941528193 2:166631986-166632008 AAGGGGAGGGAAGAATGGGAAGG - Intergenic
941802458 2:169675451-169675473 AAGGGGGAGCAGGCATGTCATGG + Intronic
941987935 2:171526330-171526352 AAGGGGAATAAAGAAGGAGAGGG - Intronic
942143489 2:173001738-173001760 AAGGGGGAGCAGGAGCGAGGTGG + Intronic
942734641 2:179096405-179096427 AAGGGGAAGGAAGAATGAGAAGG - Intergenic
942873959 2:180769227-180769249 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
942881959 2:180871737-180871759 AAGGGGAAGAAAGAATGAGGAGG + Intergenic
943131050 2:183853533-183853555 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943354811 2:186839878-186839900 AGGGGGAAGCAGCAAAGGGATGG - Intronic
943416903 2:187619058-187619080 GAGAGGAAGCAAGAGTGAGAAGG + Intergenic
943485404 2:188473497-188473519 AAGGGGATGAAAGATTGAGAAGG - Intronic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
943678911 2:190747051-190747073 AAGGAGAAGCTGGAATAAAAAGG - Intergenic
943786453 2:191883026-191883048 AAGGTGAAGGAGGCAGGAGATGG - Intergenic
943807613 2:192141644-192141666 AAGAGGAAGCATGAAAGAGAGGG + Intronic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944188693 2:196978266-196978288 AAGGGGGAGCAGGAGAGAGAGGG - Intronic
944442366 2:199755206-199755228 AAGGGGATACAGGCATCAGATGG - Intergenic
944646361 2:201784620-201784642 AAGGTGAAGCAGGAATACAAAGG + Intergenic
944646481 2:201785585-201785607 GAGGGGAATCAGGAACAAGAGGG + Intergenic
944681975 2:202085402-202085424 AAGCAGAAGAAGGAATCAGAAGG + Intronic
945012371 2:205479256-205479278 AAGGAGAAGTGGGAAGGAGAAGG - Intronic
945199076 2:207263627-207263649 AAGGTAAAGGAGGAAAGAGAAGG + Intergenic
945579277 2:211572573-211572595 AAGGGGTTGCAGGAAAGTGAGGG - Intronic
945786786 2:214249423-214249445 AAGGAGAAGGAGGAAAGATAGGG + Intronic
945881653 2:215330648-215330670 AAGGGAAAGGAGGGATGAGGCGG - Intronic
946038608 2:216764767-216764789 AAGAGGAAGCTGGAAGTAGAAGG - Intergenic
946326471 2:218986989-218987011 AAGCAGAAAGAGGAATGAGAAGG - Intergenic
946537854 2:220650920-220650942 AAGGCGGTGCAGAAATGAGAAGG - Intergenic
946769308 2:223072160-223072182 GAGGAGCAACAGGAATGAGAGGG - Intronic
947293749 2:228607016-228607038 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
947511018 2:230754415-230754437 AAGGGGAAGAAGGAGGGAAAGGG - Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
947830189 2:233134150-233134172 AAGGAGGAGGAGGAAGGAGAGGG + Intronic
947911190 2:233802060-233802082 CTGGGGAAGCAGGGATGGGATGG + Intronic
948011468 2:234652428-234652450 ACGGGGACCCAGGAATGACAGGG - Intergenic
948577651 2:238965004-238965026 AGGGGGAAGCAGGAGGGAGGAGG - Intergenic
948594965 2:239073948-239073970 AATGGGCAGCAGGACTGAGGGGG + Intronic
948594998 2:239074055-239074077 GTGGGGAAGCAGGACTGAGGGGG + Intronic
948655284 2:239473061-239473083 AAGAGGAAGAAGGGGTGAGAAGG + Intergenic
948662007 2:239513362-239513384 AAGGGGGAGCAGGCAGGCGAAGG - Intergenic
1168740799 20:189835-189857 AAGGGGGAGGAGGGATGATATGG - Intergenic
1168771127 20:417661-417683 GAGAGGAAGCAGGAGTGAAAGGG - Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168915268 20:1480200-1480222 AAGGGAAAGAGGGGATGAGATGG + Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169710094 20:8551524-8551546 AAAGGGATGCAGGTATGGGATGG - Intronic
1170351652 20:15448004-15448026 AAGGGGAGGCAGAGATGGGATGG - Intronic
1170416395 20:16147439-16147461 AATGGGCAGCAGGAAGCAGATGG - Intergenic
1170440699 20:16376290-16376312 ATGGGGCAGCTGGAATGAGCAGG + Intronic
1170444821 20:16415646-16415668 AAGGGGATGGAGGGAGGAGAAGG - Intronic
1170606099 20:17876031-17876053 AGGGGGAAGCAGGCATGAGGAGG + Intergenic
1170966061 20:21072572-21072594 AAGGAGAATCAGGAATTTGAAGG + Intergenic
1171201908 20:23248478-23248500 AAGGGGATGCATGAGTGTGAGGG - Intergenic
1171370868 20:24661312-24661334 AAGGGGAGGGAGGGAAGAGAGGG + Intronic
1171722144 20:28573819-28573841 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1172126273 20:32627018-32627040 AAGGGGAAGCAGGTGTCAGGAGG - Intergenic
1172206218 20:33164625-33164647 GAGGGAAAGAAGGAAAGAGAGGG - Intronic
1172733469 20:37108414-37108436 AAGGGGAAACTGGACTGGGATGG + Intronic
1173294277 20:41742193-41742215 AAGGGGAAGGAGGAAGGAAGGGG - Intergenic
1173651040 20:44664401-44664423 AAGGGGAAGTATGACAGAGAGGG - Intergenic
1173901441 20:46592616-46592638 AGCGGGGAGGAGGAATGAGAGGG + Intronic
1174707050 20:52667678-52667700 ATGGGAAAGGGGGAATGAGAAGG - Intergenic
1174886581 20:54341841-54341863 ATGAGGAGGCAGGAATGAAAGGG - Intergenic
1174993601 20:55541223-55541245 AAGGAGGAGGAAGAATGAGAGGG - Intergenic
1175006091 20:55684902-55684924 ACGCAGAAGCAGGAGTGAGAAGG - Intergenic
1175024135 20:55883327-55883349 AAGGGGAAGCACAAAGGAGCAGG - Intergenic
1175246432 20:57584997-57585019 ATGGGGAGGCTGGAATGGGAGGG + Intergenic
1175380796 20:58562040-58562062 CAGAGGAAGGAAGAATGAGAGGG + Intergenic
1175491166 20:59381944-59381966 GGGGTGAAGCAGGAATGAGGCGG - Intergenic
1175608012 20:60327502-60327524 GAGGGGAGGCAAGACTGAGAAGG + Intergenic
1175711774 20:61227123-61227145 TAGGGGAAGGAGGATTGAGTGGG - Intergenic
1176081433 20:63275313-63275335 AAGCGGCAGCAGTAATGATATGG + Intronic
1176235929 20:64053562-64053584 AAGGGCCAGCAGGACCGAGAGGG + Intronic
1176239014 20:64067392-64067414 GAGGGGAAGCGGGAGGGAGAAGG + Intronic
1176347501 21:5763357-5763379 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176347960 21:5768534-5768556 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176354315 21:5883941-5883963 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176354774 21:5889118-5889140 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176367536 21:6043069-6043091 AAGGGGAAGAATGATGGAGACGG - Intergenic
1176496867 21:7555921-7555943 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176497326 21:7561098-7561120 AAGGGGAATCAGCAAGGAGATGG + Intergenic
1176541822 21:8161427-8161449 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176542281 21:8166604-8166626 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176560773 21:8344472-8344494 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176561232 21:8349649-8349671 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176635089 21:9185080-9185102 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176638276 21:9270053-9270075 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1177477866 21:21646920-21646942 AAATGGTAACAGGAATGAGAAGG + Intergenic
1177978837 21:27885344-27885366 GAGGGGAAGCAAGAAAGAGACGG + Intergenic
1178007297 21:28235443-28235465 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1178116382 21:29421739-29421761 CAGGGCAATCAGGAAGGAGAAGG + Intronic
1178643207 21:34363381-34363403 AAGAGGAAGAAGGAAGAAGAAGG - Intergenic
1178883113 21:36464197-36464219 AAGGGGAAGCAGGCATGACACGG - Intronic
1179123012 21:38566324-38566346 TGGGGGAAGCAGGAATTGGAGGG - Intronic
1179291217 21:40019926-40019948 AAGGGAAAGAAGGAGGGAGAAGG - Intronic
1179462320 21:41545572-41545594 AAGGGAAAGAAAGAAAGAGAAGG + Intergenic
1179755983 21:43495473-43495495 AAGGGGAAGAATGATGGAGACGG + Intergenic
1179835745 21:44031577-44031599 ATGGGGAAGACAGAATGAGAGGG + Intronic
1180295697 22:10932506-10932528 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180370698 22:12033354-12033376 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180371590 22:12042887-12042909 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180415062 22:12701730-12701752 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180422318 22:12877550-12877572 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180735621 22:18014453-18014475 AAGGGGAAGAAGGTAAGAGAAGG - Intronic
1181038939 22:20182894-20182916 AAGGGGAGGCAGGGGTGGGAGGG + Intergenic
1181534356 22:23534013-23534035 AAGGGAAGGCAGGAGGGAGAGGG + Intergenic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1181789219 22:25250501-25250523 AAGGGAAAGAAGGAAGGAGAAGG - Intergenic
1182246335 22:28960775-28960797 AAGAGGAAGTAAGAATGAGCAGG - Intronic
1182711994 22:32328982-32329004 AAGAGGAAGCAGGAGGCAGAGGG - Intergenic
1182954405 22:34407799-34407821 AAAGGGAAGTAGGGCTGAGATGG + Intergenic
1183375839 22:37464486-37464508 AGGGGGGAGCTGGAAGGAGAGGG + Intergenic
1183425783 22:37738761-37738783 AGGGGGAAGCAGGTTGGAGATGG + Intronic
1183499309 22:38168934-38168956 AAAGGGAAGAAGGAAGGACAGGG - Intronic
1183506782 22:38213946-38213968 AAGGGGAAGTTGGGATGAGGAGG - Intronic
1184287768 22:43481662-43481684 AAGAGGAAGAAGGAAACAGAGGG - Intronic
1184399538 22:44265866-44265888 AAGAGGAAGCAGGAGGCAGAGGG - Intronic
1184959363 22:47917900-47917922 AAGGAGAAGGAGGAAGGAGAGGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1203246762 22_KI270733v1_random:77846-77868 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1203247221 22_KI270733v1_random:83022-83044 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
949184931 3:1179108-1179130 AAGAGGGAGCAAGAATGACAGGG + Intronic
949414330 3:3799638-3799660 AGGGGGAGGCAGGACTGGGAAGG - Exonic
949462653 3:4309628-4309650 AATGGGAAGCAGGGGTGTGAAGG - Intronic
949787702 3:7759797-7759819 AAAGGGAAGCAGGGGAGAGAGGG + Intergenic
949788147 3:7764127-7764149 AGGGGGAATCAGGAATGCTAAGG + Intergenic
949903294 3:8837713-8837735 AAGGGTAAGCAGGTTTAAGATGG + Intronic
949961803 3:9318419-9318441 AGGGGGAAGGAGGAAAGAGGAGG - Intronic
949974736 3:9445768-9445790 TGGAGGTAGCAGGAATGAGAAGG - Intronic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950360867 3:12448549-12448571 AAGGGAAGGAAGGAAGGAGAAGG + Intergenic
950360911 3:12448741-12448763 AAGGGAAGGAAGGAAGGAGAAGG + Intergenic
950528926 3:13541201-13541223 AAGGGGAAGAAGGACTGGGCAGG + Intergenic
951144844 3:19214619-19214641 TAAGGGAAGCAGGATTGAGAAGG - Intronic
951178131 3:19625813-19625835 AAGGGCAATCAGGCAGGAGAAGG - Intergenic
951494987 3:23316336-23316358 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
951783072 3:26386732-26386754 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
952277796 3:31894306-31894328 AAGGGGAGGCAGGAAGGAACGGG + Intronic
952820704 3:37483491-37483513 AGGGGGAAGTAAGAATGGGAAGG + Intronic
953173843 3:40531431-40531453 AAGGAGAATCAAGAATGAGAAGG - Intronic
953238907 3:41130943-41130965 AAGGAGCACCAGGGATGAGATGG - Intergenic
953493269 3:43366914-43366936 AATGGAAAGCGGGAAGGAGAAGG - Exonic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954139252 3:48596431-48596453 AAGGGGGAGCAGGACCCAGATGG - Intergenic
954368353 3:50157576-50157598 AAGGAGAAGAAGGACAGAGAGGG - Intronic
954690024 3:52390813-52390835 AAGGGGATGCAGTAAGGAGAGGG + Intronic
955645908 3:61137193-61137215 ATGGGGAAGAAGGAAGGAGCAGG - Intronic
955750753 3:62183817-62183839 ATGGGGAAGGATGAAGGAGAAGG + Intronic
955809554 3:62772433-62772455 AAGGGGCAGCAGGAAAGAAAAGG - Intronic
956098704 3:65745228-65745250 AAACAGAAGCAGGAAAGAGAAGG + Intronic
956230557 3:67011544-67011566 AAGCGGGAGCAGGAAAGAGAGGG + Intergenic
956340761 3:68221287-68221309 AATGGGAAGGAGAAAAGAGAAGG - Intronic
956513251 3:70017577-70017599 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
956778717 3:72587721-72587743 AGAGGGAAGCAGGACTGGGAGGG + Intergenic
956850278 3:73222515-73222537 GAGGGGAAGTAGGAAAGAGATGG - Intergenic
957120340 3:76082428-76082450 AATGAGAAGCAGGAACAAGAGGG + Intronic
957523038 3:81345570-81345592 AAGGGGAAGGTGGATGGAGATGG + Intergenic
957813042 3:85253657-85253679 AAGGCTAAGCAAGAAAGAGAAGG - Intronic
957867982 3:86049702-86049724 AGGGGGAAGGAGGAAGGTGAGGG + Intronic
959118445 3:102205804-102205826 AAGAGGAAGGAGGAGTGGGAAGG - Intronic
959303968 3:104636126-104636148 AAGGGGACGGAAGAATGGGAAGG + Intergenic
959547384 3:107612968-107612990 AAGGGGAGGGAAGAGTGAGAAGG - Intronic
959798072 3:110456863-110456885 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
959951822 3:112187743-112187765 ATGTGGAAGAAGAAATGAGAAGG - Intronic
959988991 3:112609943-112609965 ATGGGAAAGCAGTAATGAGGTGG + Intronic
960153473 3:114274720-114274742 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
960238597 3:115314299-115314321 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG + Intronic
960737139 3:120793201-120793223 AAGAGGATGCAGGAAAGAGGAGG - Intergenic
960795049 3:121476688-121476710 AAGGCCAAGCAGTACTGAGAGGG + Exonic
960865332 3:122194104-122194126 TAGTGGAGGCAGGAATGAGAAGG - Intronic
961165694 3:124762305-124762327 AAGAGCAAGCAGGAATGAGGAGG + Exonic
961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG + Intronic
961237340 3:125378531-125378553 CTGGTGAAGCAGGAAAGAGATGG - Intergenic
961476124 3:127147422-127147444 AGGGGGCAGAAGGAATGAGAAGG + Intergenic
961572355 3:127808804-127808826 ATGGAGGAGCATGAATGAGAAGG - Intronic
961620414 3:128219496-128219518 ATGGGGAAACAGCAAGGAGAAGG - Intronic
961734558 3:128993423-128993445 CGGGGGAAGCAGGGAAGAGAAGG - Intronic
961951918 3:130758659-130758681 AAGGAGAAGCAGCAAAGACAGGG - Intergenic
961994153 3:131223385-131223407 AAGGGGAAGAAGGAAAGAAGTGG - Intronic
962011711 3:131397983-131398005 AAGGGGAACCAGCCTTGAGATGG - Intergenic
962193640 3:133336971-133336993 AAGGGGAGGAAAGAGTGAGAAGG + Intronic
962258417 3:133887476-133887498 GAGGGGCTGCAGGAGTGAGATGG - Intronic
962405238 3:135094659-135094681 GAGGGAAAGCAGGAGGGAGAAGG - Intronic
962665548 3:137650512-137650534 AAGGGCAAGCAGGAGTGGAATGG - Intergenic
963020409 3:140868381-140868403 AAGGGGAGGGAAGAATGGGAAGG - Intergenic
963692735 3:148525328-148525350 GAGGGGAAGCAAGAAAGAGATGG - Intergenic
964020078 3:151999397-151999419 AAGTGGAATCAGCAATGAAATGG + Intergenic
964745750 3:160010916-160010938 GAGGGAAAGTAGGAATGGGATGG - Intergenic
964845409 3:161039405-161039427 ATGGGGAAGCAGTAAGGAGGGGG + Intronic
965144941 3:164889587-164889609 AAGGGGAGGCAAGAGTGGGAAGG - Intergenic
966463552 3:180203748-180203770 AAGGGGAAGGAAGAGTGGGAGGG + Intergenic
967215158 3:187203489-187203511 AAGGCGAACCAGGAGCGAGAGGG - Intergenic
967263813 3:187672319-187672341 AAGGAAAAGGAGGAATAAGAAGG - Intergenic
967693635 3:192506073-192506095 AAGGTGAAGCAGGGATAGGAAGG + Intronic
968075588 3:195814415-195814437 AAGGGGACGCAGGAAAGACCTGG - Intergenic
1202748620 3_GL000221v1_random:134968-134990 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
968897777 4:3414686-3414708 AAGGGGAAGTAGGAAAAAGGAGG + Intronic
969155497 4:5206264-5206286 GAGGGGAATCAGGAGTGAAAAGG - Intronic
969474107 4:7411525-7411547 AAATGGAAGGAAGAATGAGAAGG - Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969653121 4:8479219-8479241 AAGGTCAAGCAGAAATGAGCTGG - Intronic
970296729 4:14638796-14638818 AAGGGGAAGGAGGAAAGTAAAGG + Intergenic
970309644 4:14768536-14768558 ATGGTGGAGCAGGAGTGAGAGGG + Intergenic
970348825 4:15180566-15180588 TAGGGAAAGCTGGCATGAGATGG - Intergenic
970444188 4:16110230-16110252 AGGGGGAAGGAGGAAGGAGGGGG + Intergenic
970444195 4:16110247-16110269 AGGGGGAAGGAGGAAGGAGGGGG + Intergenic
970444200 4:16110264-16110286 AGGGGGAAGGAGGAAGGAGGAGG + Intergenic
970486150 4:16526614-16526636 AAGTGGAAGAAGGATTCAGAAGG + Intronic
970565383 4:17327159-17327181 AAGGAGAAGCAGAGATGAGGTGG - Intergenic
970803943 4:20007727-20007749 CAGGGAAAGGAGGAATGAGAAGG + Intergenic
970827376 4:20292501-20292523 AAGGAGAAGGAGCACTGAGACGG + Intronic
970894523 4:21086903-21086925 AAGGGAAAGAGGGAAAGAGAGGG - Intronic
971001950 4:22333144-22333166 AAGGAGAAGCAGGCAGGAGCTGG - Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971105215 4:23517342-23517364 AAGGAGAAGGAGGAGTGGGAAGG - Intergenic
971125349 4:23747737-23747759 AAGGGAAAGCAGAGAAGAGAGGG - Intergenic
971251266 4:24975327-24975349 AAGGAGAAGGGGGAAGGAGAGGG + Intronic
971296507 4:25398368-25398390 AAGGTGAAGTTGGAAGGAGACGG + Intronic
971480900 4:27114298-27114320 AAAAGGAAGCAGAAAAGAGAAGG - Intergenic
971735920 4:30452013-30452035 GAGCGGAAGCAGGAGAGAGAGGG - Intergenic
972104096 4:35461343-35461365 AAAGGGAAGGAAGAATGGGAAGG - Intergenic
972306927 4:37839588-37839610 AAGTAGAAGATGGAATGAGAAGG + Intronic
973011907 4:45086455-45086477 AAGGGGATTCAGGAATGCTAGGG - Intergenic
973113046 4:46419111-46419133 ATGGTGGAGCAGGAAAGAGAGGG + Intronic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
973218726 4:47700888-47700910 AAGGGAAAGCAGCATTGAGGAGG - Intronic
973359988 4:49156074-49156096 AAGGGAAAACAGGAATGGAACGG - Intergenic
973400749 4:49635981-49636003 AAGGGAAAACAGGAATGGAATGG + Intergenic
973401968 4:49643494-49643516 AAGGGAAAACAGGAATGGAATGG + Intergenic
973648536 4:52974167-52974189 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973693888 4:53470487-53470509 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973755011 4:54065539-54065561 AAGGGGAGGAAGGAAGGAAAAGG + Intronic
974597179 4:64029772-64029794 AAGGGGAGAGAAGAATGAGAGGG - Intergenic
974715645 4:65667648-65667670 AAGAGGCAGAAGGAAAGAGAAGG - Intronic
974983653 4:68992552-68992574 AAGGGCAATCAGGCAGGAGAAGG - Intergenic
976777192 4:88719621-88719643 AAGGAGAAGAAAGAAGGAGAAGG - Intergenic
977258536 4:94768488-94768510 AAGGGGAGGGAAAAATGAGAAGG - Intronic
977613956 4:99066488-99066510 AAGATGAAGCAGGAATAAGGTGG + Intergenic
977677584 4:99764959-99764981 AAGGGGAAGCAGGCATCACATGG - Intergenic
977998710 4:103529288-103529310 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
978287867 4:107099384-107099406 AAGGGGAGGAAAGAGTGAGAAGG + Intronic
979087719 4:116434877-116434899 CAGAGCAATCAGGAATGAGAAGG - Intergenic
979169522 4:117583341-117583363 AAGTGGAAGTAGGACAGAGAGGG - Intergenic
979205053 4:118029375-118029397 AGGAGGAAGGAGGAAGGAGATGG - Intergenic
979323638 4:119353303-119353325 ATAGGGAAGGAGGAAAGAGAAGG - Intergenic
979658626 4:123226205-123226227 CAGGGCAATCAGGAAGGAGAAGG - Intronic
979806337 4:124976574-124976596 ATGGTAAGGCAGGAATGAGAGGG - Intergenic
980065037 4:128178155-128178177 AAGGGAAAGCAGGAGGGAAATGG + Intronic
980185446 4:129455553-129455575 CAGGGGACACATGAATGAGAAGG - Intergenic
980200426 4:129650246-129650268 AAGTGAAAGCAGGAATGAGATGG + Intergenic
980264981 4:130503564-130503586 ATGGGGAAGCATGAATTATAGGG - Intergenic
981170324 4:141615689-141615711 GAGGGGAAGTAAGAAAGAGATGG - Intergenic
981205910 4:142040123-142040145 AAGAGGAGGGAGGAAGGAGAGGG + Intronic
981329266 4:143488971-143488993 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
981352589 4:143750146-143750168 AAGGGGAAGCAGGCCTCAGCAGG - Intergenic
981583253 4:146271941-146271963 AAGGAGAATCAGGAATGCCAGGG - Intronic
981609675 4:146579857-146579879 TAGGGGAGGAAGGCATGAGAAGG + Intergenic
981690512 4:147503416-147503438 AACAGGAAGCAGGAAAGAGCAGG + Intronic
981780520 4:148424136-148424158 AAGAGTAAGCAGGCATGAAAGGG + Intronic
982293815 4:153806428-153806450 GAGGGGAAGCGAGAAAGAGATGG - Intergenic
982327510 4:154144012-154144034 AAGGGGAAACAGCATTTAGAGGG - Intergenic
982564454 4:156971195-156971217 AAGGCGAGGGAGGAATGAGGGGG + Exonic
982627885 4:157790794-157790816 AAGGGAAAGGAGAAATAAGAAGG - Intergenic
982725885 4:158905601-158905623 AAAAGGATGCAGGAATTAGAAGG - Exonic
982899469 4:160980536-160980558 AAGGGGAGGGAAGAATGGGAAGG - Intergenic
982911616 4:161149150-161149172 AAGGGGAGGAAAGAGTGAGAAGG + Intergenic
983145057 4:164203262-164203284 AAGAGAAAGAAGGAAAGAGAGGG + Intronic
983241470 4:165237969-165237991 ATAGGGAAGGAGGAAAGAGAAGG - Intronic
983273955 4:165595033-165595055 TAGGAGAAGAAGGATTGAGAGGG + Intergenic
983900384 4:173127289-173127311 AAGGGAAAGAAAGAAAGAGAAGG - Intergenic
983971761 4:173883928-173883950 AAGGGAAAGCAGGGATGTGGAGG - Intergenic
984059917 4:174978929-174978951 AGGATGAAGCAGGAGTGAGAAGG + Intergenic
1202753173 4_GL000008v2_random:28465-28487 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1202759072 4_GL000008v2_random:93262-93284 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
985548063 5:519940-519962 AAGGGCAGGCAGGAGCGAGACGG - Intronic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986422554 5:7599286-7599308 TAGGAGAAGCAGGAATGAAAAGG + Intronic
986468367 5:8049968-8049990 AAGGGAAGGAAGGAAGGAGAAGG + Intergenic
986468374 5:8049992-8050014 AAGGGAAGGAAGGAAGGAGAAGG + Intergenic
986946656 5:13029269-13029291 AAGGGGAAGGGGGAAGAAGAAGG + Intergenic
987052696 5:14161340-14161362 AAGGGAAACCAGGAAGAAGAGGG - Intronic
987174773 5:15296084-15296106 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
987367019 5:17157954-17157976 ATGGGGAAGAAGGCATGAAAAGG + Intronic
987457955 5:18170057-18170079 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
987923697 5:24314503-24314525 GAGGGGAAGCAAGAAAGAGACGG - Intergenic
988089615 5:26519705-26519727 AAGGAGAAGGAAGAAGGAGAAGG + Intergenic
988340176 5:29960550-29960572 AAGGGGAAGGAAGAGTGAGAAGG + Intergenic
988666783 5:33337696-33337718 GAGGGTGAGCAGGAGTGAGAAGG + Intergenic
988929914 5:36027805-36027827 ATGGGGAGTCAGGAATGTGAGGG - Intergenic
989361667 5:40608386-40608408 AAAGGGCAGGAGGACTGAGAGGG - Intergenic
989551305 5:42738731-42738753 AAGGGCAATCAGGCAGGAGAAGG + Intergenic
989690034 5:44131142-44131164 AAGTGGAAGCAACAAGGAGAAGG - Intergenic
990442863 5:55864025-55864047 AAGGGAGAGCAAGAATGAAAAGG + Intronic
990499902 5:56385733-56385755 AGGGGGCAGGAGGAAGGAGAAGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990759864 5:59116806-59116828 AAATGACAGCAGGAATGAGAAGG + Intronic
990869226 5:60413452-60413474 AGGAGGAAGGAGGAAGGAGAAGG + Intronic
991180535 5:63746497-63746519 AAGGGGAGGGAAGAATGGGAAGG - Intergenic
991398001 5:66224866-66224888 AAGGGGAAGCAGGCACCACATGG + Intergenic
991980997 5:72230568-72230590 AAGGGAAATCAGGAATGTGTTGG - Intronic
992155862 5:73954533-73954555 AAAGGGAAGGAGGAATGAAAAGG + Intergenic
992174710 5:74138632-74138654 AATCGAAAGCAAGAATGAGAAGG - Intergenic
992401157 5:76413003-76413025 AAGGGGCAGCAGTAATGAGGGGG - Intronic
992497148 5:77305294-77305316 GATTGGAAGCAGGAAGGAGAAGG + Intronic
992498063 5:77312544-77312566 AAAGGGAAGAAGCAATGAAATGG + Intronic
992934584 5:81688197-81688219 AAGGGGAGGGAAGACTGAGAAGG + Intronic
993158504 5:84258262-84258284 AGGAGGAAGCAGAAATGAGCAGG + Intronic
993779252 5:92045344-92045366 GAGAGGAAGGAGGAAGGAGAGGG - Intergenic
994310023 5:98259028-98259050 AAGGGGAGAGAGGAGTGAGAAGG - Intergenic
994400111 5:99268551-99268573 AAGCGAAAGCAGTACTGAGAAGG - Intergenic
995259952 5:110091939-110091961 AAGGGGAAGCAGAATTGATAAGG - Intergenic
995265413 5:110153226-110153248 AGTGGGAAGGAAGAATGAGAAGG + Intergenic
995348854 5:111152090-111152112 AAAGGGAAGAAGGAAAGAAAGGG - Intergenic
995669007 5:114578948-114578970 AAGAGGGAGGAGGAATGTGAGGG - Intergenic
996011757 5:118488220-118488242 AAGGGGAAGGAGGATTGAAGGGG + Intergenic
996594544 5:125185639-125185661 AAGGGGAGGGAAGAATGGGAAGG + Intergenic
996651224 5:125879492-125879514 AGGGGAAAGGAGGAAAGAGAAGG - Intergenic
996681194 5:126229296-126229318 GAGGGGAAGCGAGAAAGAGACGG - Intergenic
997136679 5:131333957-131333979 AAGGGCAATCAGGCAGGAGAAGG - Intronic
997138109 5:131348142-131348164 AAGGGCAATCAGGCAGGAGAAGG + Intronic
997379556 5:133425947-133425969 GAAGGGAAGCAGGAATGACGTGG + Intronic
997504140 5:134402780-134402802 AAGAGGCAGGTGGAATGAGAAGG - Exonic
997800970 5:136861717-136861739 AAGAGGAAGCAAGAAAGAGCAGG - Intergenic
997832714 5:137164839-137164861 AAGGGGAGGGAAGAGTGAGAAGG + Intronic
997897828 5:137735789-137735811 CAGAGGAAGGAGGATTGAGAAGG - Exonic
997950608 5:138239901-138239923 AATGGGAAGTAGTAATCAGATGG - Intergenic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998394726 5:141811462-141811484 AAGGGGAATGAGGAAGGAGATGG - Intergenic
998399544 5:141841410-141841432 AGGGGGAAGGAGGGAAGAGAAGG + Intergenic
998400376 5:141845721-141845743 AAGGAGAAGCAGGGGTGTGAAGG - Intergenic
998825133 5:146093756-146093778 AAAAGGAAGGAGGCATGAGAAGG - Intronic
998901723 5:146862585-146862607 AAGGGGAAGCAGGAATGGCCTGG + Intronic
999050947 5:148523378-148523400 ATGGGCAAGGAGGAATGGGAGGG + Intronic
999507933 5:152217766-152217788 GTGGGGGAGTAGGAATGAGAAGG + Intergenic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
1000185058 5:158851356-158851378 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1000260021 5:159578756-159578778 GAGGAGAAGCAAGATTGAGAGGG + Intergenic
1000427146 5:161104803-161104825 AAAAGGAAGAAGGAAAGAGAGGG - Intergenic
1000452617 5:161408722-161408744 AGAGGGAAGGAGGAAGGAGAAGG + Intronic
1000822225 5:165998773-165998795 AAGGGGATGAATGAATGACATGG + Intergenic
1000872000 5:166588531-166588553 AAAGGGAAGGAGGAGAGAGAAGG - Intergenic
1000882452 5:166713917-166713939 AAGAGGAAGCAGGAAAGAGAGGG + Intergenic
1001086196 5:168701636-168701658 AAGGAGAAGCAGGAGCCAGAAGG - Intronic
1001249527 5:170136052-170136074 AAGGGCCAGCAGGAAGGAGGGGG + Intergenic
1001266215 5:170276384-170276406 GAGGGGAAGATGGAAGGAGAAGG - Intronic
1001329574 5:170752686-170752708 AGAGGGAGGCAGGAAGGAGAGGG - Intergenic
1001422128 5:171596223-171596245 CCTGGGAAGGAGGAATGAGATGG - Intergenic
1001737808 5:174021120-174021142 AAGGAGAAGGAAGAAGGAGAAGG + Intergenic
1001737813 5:174021156-174021178 AAGGAGAAGGAAGAAGGAGAAGG + Intergenic
1002531473 5:179848932-179848954 AAGGGGAAGACGGTACGAGACGG + Intronic
1002761259 6:204190-204212 AAGTGGAAGCAGGGACCAGATGG + Intergenic
1002894594 6:1369440-1369462 AAGGGGGAGGAGGAGAGAGAAGG + Intergenic
1002969129 6:1996116-1996138 AAGAGGAAGGAGGAAGGAGGAGG - Intronic
1003337283 6:5185922-5185944 AAGGGGAGGCAGGAGTGAGGAGG + Intronic
1004238384 6:13896076-13896098 AAGGAGGAGCAGGGAAGAGAGGG + Intergenic
1004266450 6:14152075-14152097 AAGAGGAAGAAGGAAGGAGGAGG - Intergenic
1004601637 6:17156074-17156096 AAAAGGAAGGAGGAATGAGATGG - Intergenic
1004816701 6:19319072-19319094 AAGAGAAAGAAGGAAAGAGAAGG - Intergenic
1004945608 6:20609348-20609370 AAGGAGAAGAAGGGAGGAGAAGG - Intronic
1005369923 6:25121797-25121819 AAAAGGAAGGAGGAAGGAGATGG + Intergenic
1005449637 6:25960335-25960357 AATGGGAAACAGGTGTGAGATGG + Intergenic
1005647764 6:27857419-27857441 GAGGAGAAGAAGGAAGGAGAAGG + Intronic
1006368532 6:33630503-33630525 AAGGGAAAGCTGGGAAGAGAGGG - Intronic
1006484050 6:34323238-34323260 AATGGAAAGAAGGAAAGAGAGGG + Intronic
1006585636 6:35109249-35109271 AAGGCAAAGCAGCACTGAGAGGG + Intergenic
1006812334 6:36827981-36828003 AAGGGGAAGCAGGGAGGAAAGGG - Intronic
1006889948 6:37418178-37418200 AGGGGGACGGAGGAATGGGAAGG + Intergenic
1007182365 6:39938823-39938845 AGAGGGAAGCAGGCATGACATGG + Intergenic
1007310914 6:40945478-40945500 AAAAGGGAGCAGGAAAGAGAGGG + Intergenic
1007412344 6:41672290-41672312 CAGAGGAAGCAGGCATGAGGCGG + Intergenic
1007945408 6:45822341-45822363 AAAGGGAATCAGGAAACAGATGG + Intergenic
1007958564 6:45938557-45938579 TAGGGGAAGCAGGAGTCACAAGG + Intronic
1007973944 6:46081262-46081284 AAAGGGAAGCAGGAATTAGCAGG - Intergenic
1008068863 6:47079283-47079305 AAGGGAGAGCAGGAAGGAGACGG + Intergenic
1008690309 6:53971451-53971473 AAGAGGAAGAAGGAAGGTGAAGG + Intronic
1008849317 6:56005598-56005620 AAAGGAAAACAGAAATGAGAAGG - Intergenic
1008863241 6:56176922-56176944 AAGGGGGAGGAGGAAGGAGGAGG + Intronic
1008880818 6:56378499-56378521 AAGAGGAAGGAAGAATGGGAAGG + Intronic
1009659395 6:66591536-66591558 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1009856761 6:69274642-69274664 AAAGGGAAGAAGGGAAGAGAAGG - Intronic
1009885445 6:69618697-69618719 AAAGGAAAGCAGGAAGGAGAAGG + Intergenic
1010080334 6:71854331-71854353 AATCTGAAGAAGGAATGAGAGGG - Intergenic
1010144583 6:72652456-72652478 AAGGGGAGGGAGGAAAAAGAGGG - Intronic
1010232215 6:73545100-73545122 AGGAGGAAGGAGGAAGGAGAAGG - Intergenic
1010265578 6:73862245-73862267 AAGGAGAAGCAGGAAAGGTAGGG - Intergenic
1010343273 6:74781858-74781880 AAGGAGAAGAAAGAATGGGAAGG + Intergenic
1010549029 6:77198181-77198203 AAGGTTAAGCAGCAATGTGAAGG + Intergenic
1010716882 6:79240258-79240280 AAGTGGGAGTGGGAATGAGAAGG - Intergenic
1010780834 6:79944833-79944855 AAGGGGAAACAGAAATGGGCGGG - Intronic
1011435575 6:87333175-87333197 GAGAGGAAGCAAGAAAGAGAGGG + Intronic
1011632353 6:89339579-89339601 GAGGGGAAGGGGGAAGGAGAGGG + Intronic
1011781878 6:90798696-90798718 AAAGAGAAGAAAGAATGAGAGGG - Intergenic
1012049983 6:94328971-94328993 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1012499131 6:99869319-99869341 AAGGGGAAGCAACAATGAGAAGG + Intergenic
1012648159 6:101716023-101716045 AAGGGGAAGCAGGTAGAAGGTGG - Intronic
1013006745 6:106081115-106081137 GAGGGGAGGGAGGAAAGAGAAGG - Intergenic
1013325236 6:109039087-109039109 AAGGAGAAGGAGGGAGGAGAAGG + Intronic
1013465794 6:110415879-110415901 TGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1013470129 6:110456752-110456774 AAGGTGTAGCAGGAATAAGAGGG - Exonic
1013597693 6:111674754-111674776 GAGGTGAAGCAGGAATGGGCTGG + Intronic
1013744842 6:113333573-113333595 ATGGGGAAACTGGAAGGAGAAGG + Intergenic
1014030819 6:116701945-116701967 AAGGCAAAGAAGGAAAGAGAGGG - Intronic
1014105939 6:117561104-117561126 ACAGTGAAGCAGGAATGAAAAGG + Exonic
1014177212 6:118343683-118343705 GAGGAGAAGCAGGAATTAGGTGG + Intergenic
1014482952 6:121961280-121961302 AAGGGTAAGAAAGCATGAGAAGG - Intergenic
1014568080 6:122975774-122975796 AAATGGAAGCAGGAAGGAGCTGG - Intergenic
1014684378 6:124477732-124477754 AAGGGGAAGGGGGAAGGAGAGGG - Intronic
1015275300 6:131377822-131377844 AAGGAGAGGCAGGAGAGAGAAGG - Intergenic
1015415092 6:132939241-132939263 GAGAGGGAGCAGGAAAGAGAGGG - Intergenic
1015895369 6:138011589-138011611 ATGGCCAAGCAGCAATGAGAAGG + Intergenic
1015944034 6:138482047-138482069 CAGGTGAAGCAAGAAAGAGAGGG + Intronic
1016457311 6:144244805-144244827 AAGGGGAGGCAATAGTGAGAAGG - Intergenic
1016783742 6:147988156-147988178 AAGAGTAAGCAGGAAACAGAGGG + Intergenic
1017013988 6:150085135-150085157 AAGGAGAAGCAGGAAAGAGGAGG + Intergenic
1018471127 6:164099369-164099391 ATGGGGAAGGGGAAATGAGAGGG - Intergenic
1018479418 6:164174844-164174866 AAGGAGAAGCATGAATAGGATGG + Intergenic
1018623879 6:165758671-165758693 AAGAGGAAGAAAGAAGGAGAAGG + Intronic
1019410726 7:905473-905495 AAGGGAAAGGAGAAAGGAGAAGG + Intronic
1019410935 7:906523-906545 AAGGGAAAGGAGAAAGGAGAAGG + Intronic
1019506129 7:1392401-1392423 AAGAGGCAGCAAGAGTGAGAGGG - Intergenic
1019914256 7:4122314-4122336 GGGGGGAGGCAGGGATGAGATGG + Intronic
1020150879 7:5680855-5680877 AAGGACAAGCTGGAATGAGTGGG - Intronic
1020574759 7:9912894-9912916 AAGGGGAGGCAAGAGTGGGAAGG - Intergenic
1020786027 7:12573379-12573401 AAGGGGAAACAGGAAGAAGTTGG + Intronic
1021214539 7:17900535-17900557 AAGGGGAGGGAAGAATGGGAAGG - Intronic
1021301635 7:18980697-18980719 AAGAGGAAGAAGGAAGAAGAAGG - Intronic
1021697119 7:23286329-23286351 AGGGGGAAGGAGGGAGGAGAGGG - Intergenic
1021791592 7:24211355-24211377 AAGGGGCAACAGTAATGACAAGG - Intergenic
1021898469 7:25259618-25259640 AAGGGGAAGGAAGAAGTAGAGGG + Intergenic
1022080264 7:27012969-27012991 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1022212574 7:28225808-28225830 AAGGGGAGGGAGCAATGAGAGGG + Intergenic
1022223528 7:28339858-28339880 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1022348308 7:29539495-29539517 AAGGGGAGGAAGGAGTGAGCAGG + Intergenic
1022473334 7:30694869-30694891 AAGGAGGAGCAGGGAGGAGAGGG + Intronic
1022803544 7:33798944-33798966 AAGGGGAAGCAGGTCTAAGGGGG - Intergenic
1023061552 7:36332474-36332496 GATAGGAAGCAGGAAAGAGAAGG - Intronic
1023149129 7:37183196-37183218 AAGGAGAAGGAGGAAGGAGGAGG + Intronic
1023473978 7:40556422-40556444 TAAGGAAAGCAGGACTGAGAAGG - Intronic
1023644347 7:42293668-42293690 AGGGGGAAGATGGAATGGGAGGG - Intergenic
1023961995 7:44935038-44935060 AAGGGGAGGGAGAAATGAGGAGG + Intergenic
1024934905 7:54702159-54702181 AAGGGGAAGCAGGAACTCCAGGG + Intergenic
1025873143 7:65453751-65453773 AAGGCAAGGCAGGAATGAGAGGG + Intergenic
1025922658 7:65927940-65927962 AAGGGGAGGCAGGAAGGAGGAGG + Intronic
1025946064 7:66105604-66105626 GAGGGCAAGAAGGCATGAGACGG + Intronic
1026144402 7:67734037-67734059 AAGGGAAAGAAAGAAAGAGAAGG - Intergenic
1026204003 7:68239653-68239675 GAAGGGAAGGAGGAAAGAGAAGG + Intergenic
1026216991 7:68358368-68358390 GAGGGGAAGCCGAAATGAAACGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026899230 7:74027884-74027906 GAGGGAAAGCGGGAAAGAGATGG + Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027159772 7:75793791-75793813 AAGGGGAGGAAGGAAGGGGAAGG + Intergenic
1027365433 7:77452770-77452792 ATGGGCAAGCAGGAAAGAAAAGG + Intergenic
1027604947 7:80288395-80288417 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1027645318 7:80790330-80790352 AAGGAGGAGGAGGAAGGAGAAGG + Intronic
1029062654 7:97814479-97814501 AAGGGCAATCAGGCAGGAGAAGG + Intergenic
1029187257 7:98748150-98748172 GAGGGAAAGAAGGAAGGAGAGGG + Intergenic
1029455417 7:100668438-100668460 AGGGGGAAGAAGGAAGAAGATGG + Intergenic
1029546359 7:101212433-101212455 ATGGGGGTGCAGGAAGGAGATGG + Intronic
1029595714 7:101536576-101536598 ACAGGGAAGCAGAAATCAGATGG + Intronic
1029676646 7:102074427-102074449 AAGGGGAAGCAGGTGGGAGCTGG - Intronic
1029840344 7:103356039-103356061 ACGGGAAAGCAAGTATGAGAAGG - Intronic
1030102223 7:105956533-105956555 AGGGGGAAGAAGGAATCAGCTGG + Intronic
1030408264 7:109142869-109142891 AAGTGGAAGGAAGAGTGAGAAGG - Intergenic
1030616055 7:111739235-111739257 AAGGAGAAGCTGGGAAGAGAAGG + Exonic
1031424932 7:121594091-121594113 AGGAAGAAGCAGGAATGAGCGGG + Intergenic
1031442612 7:121812381-121812403 AAGGGGAGGCAAGAGTGGGAAGG + Intergenic
1031743355 7:125463040-125463062 AAGTGGAAGAGGGAATAAGAAGG - Intergenic
1031989821 7:128190175-128190197 GAGGGGAAGCAGGATTGGGCAGG + Intergenic
1031993210 7:128211175-128211197 AAGGAAAGGCAGGAATGAAAAGG + Intergenic
1031998527 7:128248796-128248818 AAGTGGAATCAGGAGTGGGAAGG - Intronic
1032436790 7:131907345-131907367 AAAGGGAAGGAGGGAGGAGACGG + Intergenic
1032591738 7:133198391-133198413 AAGTCTAATCAGGAATGAGATGG + Intergenic
1033041713 7:137925197-137925219 GAGGGGAAGCAGGAGGCAGAGGG + Intronic
1033300832 7:140183755-140183777 AAGTCAAAGCTGGAATGAGATGG + Intergenic
1033442722 7:141395044-141395066 AATTGGAAACAGGAGTGAGAGGG - Intronic
1033498127 7:141920359-141920381 AAAGTGAAACAGGAATGAAAGGG + Intronic
1033691387 7:143740699-143740721 AAGGGGAGGCAAGAGTGGGAAGG + Intergenic
1033804362 7:144937525-144937547 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804369 7:144937538-144937560 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034353380 7:150431942-150431964 AAGGGGGAAAAGGAGTGAGAAGG + Intergenic
1034392106 7:150794733-150794755 GAGGGGGAGCAGGATTGAGCAGG - Intronic
1034398123 7:150842783-150842805 AATGGGATGTAAGAATGAGAAGG + Intronic
1034467255 7:151237408-151237430 AAGGGGAGGCAGGGCTGAGCTGG + Exonic
1034572751 7:151970188-151970210 AAGGGAAAGCAGGAAGGGGCGGG + Intronic
1034643747 7:152625924-152625946 ATGGGGAAGCAGGAACAAGGGGG + Intergenic
1035020803 7:155799010-155799032 AGGGAGAAGCAGGAGTGAGTGGG + Intergenic
1035329371 7:158086045-158086067 AAGCCAAAGCAGGAATGGGAAGG - Intronic
1036063320 8:5350478-5350500 AAGGTCAAGCAGGAATAAAAAGG - Intergenic
1036386851 8:8289357-8289379 AAGGGAAAGGAGGAATGCAACGG - Intergenic
1036399660 8:8396528-8396550 AAGGGAAGGAAGGAAGGAGAAGG + Intergenic
1036567301 8:9948377-9948399 AAGGGGAAGCTGGGATGATTAGG + Intergenic
1037339719 8:17831510-17831532 GAGGGGAAGCAAGAGAGAGATGG + Intergenic
1037492691 8:19411019-19411041 AAGGATAAGAAGAAATGAGATGG - Intronic
1037722315 8:21455354-21455376 CAGGGGCAGAATGAATGAGAGGG - Intergenic
1037829867 8:22181077-22181099 AAGGGGAAGGATGGGTGAGAAGG - Intronic
1038070328 8:24006246-24006268 AAGGGGAAGGAGGGATAAAAGGG - Intergenic
1038147571 8:24913145-24913167 AAGGGGAAGGAGGGAGGAGACGG + Exonic
1038336892 8:26652845-26652867 CATGTGAAGCAGGAAAGAGATGG + Intronic
1038554363 8:28495915-28495937 AAGGGGTAGGAGGAAAGAGAGGG - Intronic
1038665591 8:29534765-29534787 AAGGGGAGGGAGGAATGCCATGG + Intergenic
1038726720 8:30088343-30088365 GAGGGGAAGCGAGAAAGAGAGGG - Intergenic
1039160478 8:34612810-34612832 AAGGAAAAGCAGGAATGAGAGGG - Intergenic
1039314475 8:36356420-36356442 AAGGGAAAGAAAGAAGGAGAAGG + Intergenic
1039317344 8:36387998-36388020 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1039413236 8:37373205-37373227 AAGGGGAAGCAGGCACAAGGCGG + Intergenic
1039792326 8:40885851-40885873 AAGGGGAACAGGGAGTGAGAGGG - Intronic
1040520246 8:48170392-48170414 AAGGGGAAGAAAGAAAGAAAAGG - Intergenic
1040546444 8:48401632-48401654 AAGGGGTAGGAGGAAGGAGGAGG + Intergenic
1040747279 8:50660486-50660508 AAAGGAAAGAAGGAAGGAGAAGG + Intronic
1040754625 8:50757963-50757985 AAGGAGAGGCAGGAATTAGGAGG - Intronic
1040845513 8:51834083-51834105 AGGGGCCAGCAGAAATGAGAAGG + Intronic
1040910226 8:52510608-52510630 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1041138812 8:54790899-54790921 AAGGAGAAGAAGGAAAGATAGGG + Intergenic
1041192730 8:55369437-55369459 AAGGGAAAGGAGGAACGGGAGGG + Intronic
1041267617 8:56080370-56080392 AAGGAGAAGGCGGAAGGAGAAGG + Intergenic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1042208517 8:66353170-66353192 AAGAGGAAGCAAGAGTCAGAGGG - Intergenic
1042437669 8:68786272-68786294 AAGGGTAAAAAGGAAGGAGAGGG - Intronic
1042642084 8:70947407-70947429 AAAGGAAAGGAAGAATGAGAGGG + Intergenic
1042852747 8:73233101-73233123 AAGAAGAAGGAGGAAGGAGAAGG - Intergenic
1042852790 8:73233561-73233583 ATTGGGAAGCAGGAATGGGAAGG - Intergenic
1043163409 8:76873562-76873584 AAGGAGAAGCATGGATGGGATGG + Intergenic
1043285961 8:78531776-78531798 AAAGGGAAGGAGGAGAGAGAGGG + Intronic
1043417271 8:80063988-80064010 GAGGGGAAGGAAGAAAGAGAGGG + Intronic
1043740144 8:83801264-83801286 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1044094936 8:88051923-88051945 AAGGGCAAGTAGGAATCTGAGGG + Intronic
1044287218 8:90422888-90422910 AAGGTGAAGCAGGAGAGATAAGG - Intergenic
1044595568 8:93955223-93955245 AAGGAGAAGCAGAGGTGAGAGGG - Intergenic
1044740457 8:95321244-95321266 CAGGGGAAGCAGGTGTTAGAAGG - Intergenic
1044998002 8:97855658-97855680 AAGAGGGTGCAGGAAGGAGAGGG - Intergenic
1045054499 8:98357697-98357719 AGGAGGAAGCAGAAAGGAGAAGG - Intergenic
1045099402 8:98829218-98829240 AAGGGGAAGGAGGAATAATTAGG - Intronic
1045186315 8:99841994-99842016 GAGGGGGAACAGGAGTGAGACGG - Intronic
1045336773 8:101211752-101211774 AAGGGGCAGCAAGCATGAGTGGG + Intergenic
1045478093 8:102569954-102569976 AAAGGGGTGCAGGAATGGGACGG + Intergenic
1045560494 8:103257405-103257427 AAGGGCGAGAAGGAAGGAGAAGG - Intergenic
1045922145 8:107544259-107544281 AAAGGGAAGCAAGGATGGGAGGG + Intergenic
1045949008 8:107830470-107830492 AAGGTAAGGAAGGAATGAGAAGG - Intergenic
1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG + Intergenic
1046169466 8:110485994-110486016 AAGGAGAGGGAAGAATGAGAAGG + Intergenic
1046424720 8:114031657-114031679 CAGGGCAATCAGGCATGAGAAGG - Intergenic
1046452457 8:114411928-114411950 AAGGGGTAGGAGCAATGTGAAGG + Intergenic
1046486212 8:114892235-114892257 AATGGGAATCAGAAATGAAAGGG - Intergenic
1046730514 8:117720582-117720604 AAGGAGGAGGAGGAATGAAATGG + Intergenic
1046823182 8:118657971-118657993 ACAGGAAATCAGGAATGAGATGG - Intergenic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1047198471 8:122743113-122743135 ATGGGGTAGCAGGGATGAGTGGG + Intergenic
1047242095 8:123099903-123099925 AAAGGGAGGGAGGAATGGGAGGG + Intronic
1047629560 8:126692183-126692205 AAGGGAAAGAAGGAAAGAAAAGG - Intergenic
1047965174 8:130041165-130041187 GAGGGGAAGAAGGAATGAGGAGG - Intergenic
1047994551 8:130321385-130321407 AAGAAGAAGCAGGCATGTGAGGG + Intronic
1048007622 8:130431978-130432000 AAGGGGAGGAAAGAAGGAGAGGG + Intronic
1048298952 8:133237602-133237624 AAGAGGAAGCAGGAGAGGGAAGG + Exonic
1048437908 8:134434767-134434789 GAGGGGAAGGAGGGATGAGGTGG - Intergenic
1048464778 8:134656287-134656309 TAGAGGAAGCAGGAGTGAGGAGG - Intronic
1049346332 8:142141076-142141098 AAGAGGAAGCAGGAGGGAGAAGG - Intergenic
1049582154 8:143417673-143417695 AAAGGAAAGCAGGATGGAGATGG - Intergenic
1049686332 8:143940722-143940744 CAGGGGCAGTAGGAATGAGGTGG - Intronic
1050238770 9:3612558-3612580 AAGGGAAGGGAAGAATGAGAAGG - Intergenic
1050475922 9:6041012-6041034 AAGGAGAAAGAGGAATGAGGAGG - Intergenic
1050807768 9:9703199-9703221 AAAGGGAAGCAGGCACAAGACGG - Intronic
1050989798 9:12135956-12135978 TAGGTGAAGCAGGATTGAGCTGG - Intergenic
1051185187 9:14452836-14452858 AACTGGAAGCAGGGAGGAGAAGG + Intergenic
1051373061 9:16374658-16374680 AAGCTGACGCAGGAATGAGAAGG + Intergenic
1051916799 9:22217869-22217891 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
1052063368 9:23987392-23987414 AAGGGGAGGGAAGAATGGGAAGG + Intergenic
1052076901 9:24154039-24154061 AATGTGAGGCTGGAATGAGAAGG + Intergenic
1052246168 9:26337755-26337777 ATGAGGAAGCAGGACAGAGAAGG - Intergenic
1052255641 9:26453223-26453245 GAGGGGAAGAAGGAAAAAGAAGG + Intergenic
1052358776 9:27531377-27531399 AAGGGGAAGCTGTAATGAAGTGG - Intergenic
1052484654 9:29081579-29081601 TAGGGGAATCAGGCAGGAGAAGG + Intergenic
1052547640 9:29900686-29900708 AAGGGGAAGAAAGCCTGAGATGG - Intergenic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1053016957 9:34667327-34667349 AAGGGAAGACAAGAATGAGAGGG - Intergenic
1053040115 9:34863047-34863069 AAGGGGAAGGAAGAGTGGGATGG + Intergenic
1053476970 9:38389156-38389178 AAGGGGAAGGAAGACAGAGAGGG + Intergenic
1054739257 9:68788186-68788208 AAGGGGAAAAAGGAATGTGTGGG + Intronic
1054909456 9:70440768-70440790 AAGGGGAGGAAGGAAAGGGAAGG + Intergenic
1055000990 9:71448171-71448193 AAGGTGAAGAAGGATTAAGAGGG + Intergenic
1055073800 9:72193864-72193886 AAGGGGAAGGAAGAGTGGGAAGG - Intronic
1055098561 9:72439818-72439840 CAGGGGAAGAAGGAATAATAAGG - Intergenic
1055302110 9:74892460-74892482 AAGTTGAAGGAAGAATGAGAAGG + Intergenic
1055688688 9:78806900-78806922 AAGATGAAGCAGGAGTAAGAAGG + Intergenic
1055766174 9:79666109-79666131 AGTGAGAAGCAGGAATGAGGTGG + Intronic
1056108536 9:83371836-83371858 CAAGGGAAGGAGGAATGGGAAGG + Intronic
1056397923 9:86198331-86198353 AAGGGGGAGCAGGCATGTCACGG - Intergenic
1056456268 9:86763956-86763978 AAGGGGAAGTAGAAAAGGGAAGG + Intergenic
1056463049 9:86826602-86826624 AGGGAGAAGCAGGAAAGAAAAGG - Intergenic
1057231969 9:93326713-93326735 AGGAGGAAGCAGGAGTGAGAAGG + Intronic
1057747392 9:97762954-97762976 AAGGGGATGAAGGTCTGAGAAGG - Intergenic
1057888826 9:98852670-98852692 AAGCGGATGCAGGAGTTAGAGGG - Intergenic
1058106382 9:100976455-100976477 AAGGTGAAGCAGGCATCAGAGGG + Intergenic
1058341818 9:103906660-103906682 AATGGGCAGCACGAATGGGAGGG - Intergenic
1058625599 9:106929948-106929970 AAAGGGAAGGAGGGAGGAGAAGG - Intronic
1058780223 9:108325621-108325643 AAGGGGAAGGAAGAGTGGGAAGG + Intergenic
1058781087 9:108336209-108336231 CAGGGGAAGCAGGACTAAAAGGG - Intergenic
1058848255 9:108983925-108983947 AAGTGGAAACAGGAATTAAAGGG + Intronic
1058888803 9:109343417-109343439 AAGAGGATGCAGAAATTAGAGGG + Intergenic
1058916020 9:109566481-109566503 AAGGGGAGGAAGGCAGGAGAAGG - Intergenic
1058962169 9:110002008-110002030 CAGGGCAATCAGGAAGGAGAAGG - Intronic
1059408762 9:114118838-114118860 AAGGGGAGGAAGGAATGGCACGG - Intergenic
1059592146 9:115673117-115673139 AGGGGGAAAGAGGAATGTGAGGG + Intergenic
1059851400 9:118345203-118345225 AGGGTGAAGCAGGAGAGAGAAGG + Intergenic
1059994562 9:119896369-119896391 AAGGTGAAGAAGGAAAGACAAGG - Intergenic
1060115284 9:120935509-120935531 AAGGAGAAGCAGGACTGAGCAGG - Intergenic
1060489495 9:124072080-124072102 AGAGGGAAGCATGAATGAGTGGG + Intergenic
1060654410 9:125359203-125359225 AAGGGGATGCAGGGAGGGGAGGG - Intronic
1060769811 9:126324561-126324583 AAGAAGAAGAAGGAAGGAGAAGG + Intergenic
1060830263 9:126709346-126709368 CAGGAGAAGCAGGAAGGAGCAGG + Intergenic
1060855078 9:126908636-126908658 TATGGGAAGCAGGAAGGAGGTGG - Intergenic
1061726515 9:132584860-132584882 AAGGGGGAGGAGGAAGGAGGGGG + Intronic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1062182239 9:135196696-135196718 AACGGGAAGGAGAAATGGGAAGG - Intergenic
1062362864 9:136195766-136195788 ACGGGGAAGCAGGGCTCAGAGGG + Intergenic
1062638387 9:137503508-137503530 AAGGAGGAGGAGGAAGGAGAAGG + Intronic
1062638398 9:137503540-137503562 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638407 9:137503575-137503597 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638425 9:137503642-137503664 AAGGGGGAGGAAGAAGGAGAAGG + Intronic
1062638430 9:137503661-137503683 AAGGGGAAGGAAGAAGGAGAAGG + Intronic
1203757870 Un_GL000218v1:152382-152404 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203463096 Un_GL000220v1:60908-60930 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1203463554 Un_GL000220v1:66083-66105 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203717258 Un_KI270742v1:165058-165080 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203533959 Un_KI270743v1:13175-13197 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1203651482 Un_KI270751v1:128644-128666 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1185485829 X:481459-481481 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185485860 X:481573-481595 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185485877 X:481628-481650 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185485894 X:481683-481705 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185485970 X:481942-481964 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185485974 X:481955-481977 AAGGAGAGGGAGGAAGGAGAGGG + Intergenic
1185485982 X:481985-482007 AAGGAGAGGAAGGAAGGAGATGG + Intergenic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185587919 X:1254207-1254229 AAGGGGTAGAAGGAATTACATGG + Intergenic
1185913792 X:4011645-4011667 AAGGAGGAGCAGGAAGGAGAAGG - Intergenic
1186034470 X:5406137-5406159 AAGATGAAGGAGGAAGGAGAAGG + Intergenic
1186210288 X:7243583-7243605 AAGGAGAGTTAGGAATGAGAGGG + Intronic
1186946255 X:14571049-14571071 AGGGGGGAGCAGGAAGAAGAGGG + Intronic
1187128871 X:16481671-16481693 GAGGGGAAGTGGGAAGGAGAGGG - Intergenic
1187200592 X:17130310-17130332 CAGGAGAAGCAGGAGTGAGGGGG - Intronic
1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG + Intergenic
1188400061 X:29733072-29733094 AAGGGAAGGGAGCAATGAGAAGG + Intronic
1188532827 X:31161639-31161661 AAGGGGATGGAGAAATTAGAAGG - Intronic
1189058777 X:37729246-37729268 ATGGGGAGGCAGGAGTAAGATGG - Exonic
1189109063 X:38268234-38268256 AAGAGGAAGCAAGAGGGAGAGGG - Intronic
1189123602 X:38422525-38422547 AAGAATAACCAGGAATGAGATGG - Intronic
1189430031 X:40938136-40938158 GAAGGGAAGGAAGAATGAGAGGG + Intergenic
1189615685 X:42780623-42780645 AAGAGGAAGAAGCAATGGGAAGG - Intergenic
1189858387 X:45247472-45247494 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190303299 X:49068515-49068537 AAGGGGTAGCAGGAATCCGGAGG - Intronic
1190455952 X:50628050-50628072 AAGAGGCAGGAGGAATGAGCAGG - Intronic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1190720006 X:53139862-53139884 AAGGGGGAGGAGGAAGGGGAAGG + Intergenic
1190727208 X:53197441-53197463 AAGGTGGAGGAGGAGTGAGATGG - Intronic
1191071008 X:56400117-56400139 AAGGGCAATCAGGCAGGAGAAGG - Intergenic
1191595727 X:62942156-62942178 AAGGGGAAGAAGGAGTAAGGTGG - Intergenic
1191750116 X:64533455-64533477 AAGTGGCAGCAACAATGAGATGG - Intergenic
1191920241 X:66248184-66248206 AAGTGAAACCAGGAATGAGGTGG - Intronic
1191927502 X:66329306-66329328 GAGAGGAAGCAAGAAAGAGAGGG - Intergenic
1192040906 X:67620425-67620447 AAGGGGAAGATGGAGTGAGATGG + Intronic
1192101416 X:68268738-68268760 AAGGGCAATCAGGCAGGAGAAGG + Intronic
1192412555 X:70947267-70947289 AAAGGGAAGCAGGCATCACATGG + Intergenic
1192576255 X:72245600-72245622 CAGGGGAAGCAGGAAGGAGGAGG + Intronic
1193226169 X:78986682-78986704 AAAGGGAAGCAGGCATGTCATGG + Intergenic
1193260838 X:79404434-79404456 AAGGGAAAGGAAGAGTGAGAAGG + Intergenic
1193337330 X:80306480-80306502 AAGGGGAAGGAAGACTGGGAAGG - Intergenic
1193418910 X:81259514-81259536 AAGTGGAAGCTGGAATGAACTGG + Intronic
1193621687 X:83760465-83760487 AAGGGTAAGCCAGAATGAAAAGG - Intergenic
1193815790 X:86102930-86102952 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
1194049027 X:89045301-89045323 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1194846552 X:98816484-98816506 AAGTGGGAACAGGAAAGAGAGGG + Intergenic
1194944858 X:100054909-100054931 CAGGGCAAGCAGGCAGGAGAAGG + Intergenic
1195101610 X:101560601-101560623 AAGTGGAAAAAAGAATGAGAAGG - Intergenic
1195109201 X:101628808-101628830 AAGTGGAAAGAAGAATGAGAAGG - Intergenic
1195294851 X:103465994-103466016 AAGGGGCAGAAGGAAGCAGAGGG - Intergenic
1195418647 X:104648017-104648039 GAGTGGAAGCAGGTGTGAGAGGG - Intronic
1195671896 X:107477055-107477077 AAAGGAAAGCAGGAATGAATGGG + Intergenic
1195694768 X:107658787-107658809 AAGAGAAAGAAGGAAAGAGAAGG + Intergenic
1196214450 X:113034788-113034810 AAGGGGAAAGAAGAGTGAGAAGG - Intergenic
1196345072 X:114645446-114645468 AAGTGGAAGAAGGAGAGAGAGGG + Intronic
1196398684 X:115291478-115291500 AAGGAGAAGCAGGAACAAGGAGG + Intronic
1196417942 X:115492956-115492978 AAGGGGAAACAGGAATTTGGGGG - Intergenic
1196552569 X:117046091-117046113 AAGGGGAGGGAAGAGTGAGAAGG + Intergenic
1196731106 X:118942317-118942339 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1196913235 X:120505550-120505572 AAAGGGAAGGAGGGAGGAGAAGG - Intergenic
1197053971 X:122094546-122094568 AAGGGGAAGGAGAAATGGGAAGG + Intergenic
1197096739 X:122604903-122604925 AAGGGGAGGCAAGAGTGGGAAGG + Intergenic
1197181732 X:123544019-123544041 AAGTTGGAGCAGGAATGAGAGGG - Intergenic
1197361065 X:125504481-125504503 AAGGGGAAGGAAGAGTGGGAAGG - Intergenic
1197449488 X:126594274-126594296 AAGGGGAGGGAAGATTGAGAAGG - Intergenic
1197498667 X:127217887-127217909 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
1197619982 X:128736880-128736902 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1197627999 X:128824479-128824501 AAGGGAAAGCTGGAATCAAAAGG + Intergenic
1197665284 X:129216634-129216656 ACAGGGTAGCAGGAAGGAGAAGG + Intergenic
1197703438 X:129616837-129616859 AAGGAGAAGAAGGATTGGGATGG + Intergenic
1197816277 X:130501854-130501876 AATGAGAAGAAGGAATGAGAGGG - Intergenic
1197861711 X:130978107-130978129 AAGGGGAAGCAGACATGAGAGGG - Intergenic
1198160022 X:133999001-133999023 AAGGCAAGGCAGGAATGAGAGGG - Intergenic
1198311811 X:135432480-135432502 AAGAGGAAGGATGAAGGAGAAGG - Intergenic
1198841085 X:140858881-140858903 AAGGGGAAGGAAGAGTGAGAAGG + Intergenic
1198927399 X:141814578-141814600 AAGGGGAGGGAAGAGTGAGAAGG - Intergenic
1199097175 X:143757375-143757397 GAGGGGAAGCGAGAAAGAGACGG + Intergenic
1199526989 X:148803837-148803859 AAGGGAGAGTGGGAATGAGAAGG - Intronic
1199669137 X:150127531-150127553 AGGGGGTAGCAGGAATGGGGAGG - Intergenic
1199756935 X:150873721-150873743 AAGGGAGAAGAGGAATGAGAAGG + Intronic
1199805862 X:151299799-151299821 AAGAGTAAGCAGGATTGAGCAGG - Intergenic
1199845329 X:151688634-151688656 AAGAGGAGGCAAGAATGGGAAGG + Intergenic
1200542504 Y:4477212-4477234 AAGTGGAAGAAAGAGTGAGAAGG - Intergenic
1200704741 Y:6432629-6432651 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1200956770 Y:8957008-8957030 AAGGGCAATCAGGCAGGAGAAGG + Intergenic
1201029370 Y:9732079-9732101 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1201376943 Y:13332739-13332761 CAGGGGAATCAGGCAAGAGAAGG + Intronic
1201532945 Y:15012346-15012368 CAGGGCAATCAGGCATGAGAAGG - Intergenic
1201536056 Y:15049679-15049701 CAGGGGAATCAGGCAGGAGAAGG - Intergenic
1201916207 Y:19184049-19184071 AAGGAGAAGAGGGAAGGAGAAGG - Intergenic