ID: 961176704

View in Genome Browser
Species Human (GRCh38)
Location 3:124841644-124841666
Sequence GGTGCTGGGTAAATAGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961176704_961176709 -2 Left 961176704 3:124841644-124841666 CCAATAACTATTTACCCAGCACC 0: 1
1: 0
2: 1
3: 20
4: 216
Right 961176709 3:124841665-124841687 CCTACCACATGCCCCAGGACAGG 0: 1
1: 0
2: 0
3: 22
4: 215
961176704_961176707 -7 Left 961176704 3:124841644-124841666 CCAATAACTATTTACCCAGCACC 0: 1
1: 0
2: 1
3: 20
4: 216
Right 961176707 3:124841660-124841682 CAGCACCTACCACATGCCCCAGG 0: 1
1: 0
2: 2
3: 22
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961176704 Original CRISPR GGTGCTGGGTAAATAGTTAT TGG (reversed) Intronic
900002821 1:24417-24439 ACTGCTGGGTAAATATTTGTTGG + Intergenic
900022542 1:194942-194964 ACTGCTGGGTAAATATTTGTTGG + Intergenic
902404359 1:16174806-16174828 TGTGCTGGGTAGATAATAATGGG - Intergenic
905508509 1:38499954-38499976 GATGCTGGGTACAGAGTTGTGGG - Intergenic
906639126 1:47431071-47431093 GGTGGTGGGCAAATGGTTTTGGG - Intergenic
906876520 1:49544535-49544557 AGTGCTTGATAAATATTTATTGG - Intronic
907680083 1:56554955-56554977 GGTGCTTCATAAATATTTATTGG - Intronic
909112698 1:71499886-71499908 GATGCAGGTTAAACAGTTATTGG - Intronic
911797738 1:102095454-102095476 GGTGATGGGGCTATAGTTATGGG - Intergenic
912185593 1:107272097-107272119 GGTGCTCGATAAATATTTGTTGG - Intronic
912402275 1:109404753-109404775 GGTGCTTAGTAATTAATTATTGG - Intronic
912528538 1:110303367-110303389 GGTGCTCCATACATAGTTATTGG - Intergenic
913181992 1:116331013-116331035 GATGCTGGTTAAATATTTCTTGG + Intergenic
913277581 1:117154109-117154131 GGTGCTGAGTAAGTAGTAAAAGG + Intronic
914037712 1:144018975-144018997 GGTGCTCAGTAAATATTTGTTGG + Intergenic
914151742 1:145048957-145048979 GGTGCTCAGTAAATATTTGTTGG - Intronic
915098325 1:153480025-153480047 GGTGCTTAGTAAATATTTGTTGG - Intergenic
919711684 1:200735549-200735571 GGTGCTGGGTAAATACTTGTTGG - Intergenic
919780758 1:201219241-201219263 GGTGATGGGCAAATATTCATTGG - Intronic
920473183 1:206249929-206249951 GGTGCTCAGTAAATATTTGTTGG + Intronic
924441040 1:244085640-244085662 GGTGATGGGAAAATAGTTCTTGG + Intergenic
1067723349 10:48747134-48747156 TTTGCTGGGTAAACATTTATTGG + Intronic
1068145988 10:53071369-53071391 GGGTCTGGGGAAAGAGTTATAGG + Intergenic
1070699046 10:78585527-78585549 AGTGCTCGATAAATAGTTTTGGG - Intergenic
1072430785 10:95369040-95369062 GTTGCTGGGTGAGTAGTTCTTGG - Intronic
1072587572 10:96796426-96796448 GGTGGGGGGAAACTAGTTATGGG - Intergenic
1072680767 10:97504681-97504703 AGTGCCTGGTAAATAGTTGTTGG + Intronic
1073598319 10:104821922-104821944 GGTGCTGTGTACAAGGTTATTGG + Intronic
1074964754 10:118480229-118480251 GTTGCTGAGTAGATGGTTATAGG + Intergenic
1075710629 10:124528741-124528763 GGTGCTTGGTAAATATCTACGGG - Intronic
1081683509 11:45025534-45025556 TGTGCTCAGTAAATATTTATTGG - Intergenic
1082286459 11:50323014-50323036 GGTGCTCAGTAAATATTTTTTGG + Intergenic
1083725293 11:64624823-64624845 GGTGCTCAATAAATATTTATTGG - Intronic
1083851236 11:65368509-65368531 GGTGCTCAGTAAATAGTTGTTGG - Intergenic
1085779338 11:79394232-79394254 GGTGCTCTGTAAATACTTGTTGG - Intronic
1088645707 11:111914427-111914449 GGGGCTGGGAAAATGGTTTTTGG + Intronic
1089649365 11:119902334-119902356 GGTGCTGAGTAAACAGTTTTTGG + Intergenic
1089707450 11:120289976-120289998 GGTGCTTGGTAAATGTTTGTTGG + Intronic
1091376240 12:26480-26502 ACTGCTGGGTAAATATTTGTTGG + Intergenic
1093366893 12:18313250-18313272 TGTGCTTGATAAATATTTATAGG + Intronic
1094169063 12:27472564-27472586 GGGGCTGGATAAATAATAATTGG - Intronic
1095355998 12:41275957-41275979 GGAGTTGGGTAAATGGTTACAGG + Intronic
1095675646 12:44914684-44914706 GCTGCTCGGTAAATATTTAGTGG + Intronic
1099374141 12:81876098-81876120 GCTCCTGCATAAATAGTTATAGG + Intergenic
1101631791 12:106502160-106502182 GGTGCTGGGGAAGTAGCTACTGG + Intronic
1102620664 12:114192096-114192118 GGTGCTCAATAAATAGTTGTTGG - Intergenic
1106491321 13:30225330-30225352 GAAGCTGATTAAATAGTTATGGG - Intronic
1108604371 13:52022464-52022486 GCTGCTGGGTAAAGAGTGACTGG + Intronic
1109244705 13:59939628-59939650 GGTCCTGGGTAAATGGTTTGAGG - Intronic
1109891808 13:68623799-68623821 GGTGCTGGGTAATTGGTTCCCGG - Intergenic
1112683179 13:101790715-101790737 GGTGTTGGTTAAATAGTTCTGGG + Intronic
1113047293 13:106169744-106169766 GGTGCTGAGTAAAGAGTAAATGG - Intergenic
1114192029 14:20446992-20447014 GGTGCTGGATAAATTCTTGTTGG - Exonic
1115160864 14:30392109-30392131 GCTGCTGGGTGAATAATTCTAGG + Intergenic
1116201815 14:41807004-41807026 GGTGCTAGGTAAGTAGTAAAAGG - Intronic
1116385590 14:44325834-44325856 GGTGCTTGATAAATATTTATTGG - Intergenic
1116777045 14:49193348-49193370 GGTGCTTAGTAATTATTTATTGG + Intergenic
1118777420 14:68981533-68981555 GGTGCTCAGCAAATATTTATTGG - Intergenic
1119377668 14:74207671-74207693 GGTGCTCAGTAAACACTTATTGG - Intergenic
1120184988 14:81385080-81385102 GGTGCTGGGAATACAGTTATGGG - Intronic
1120359546 14:83480901-83480923 GGTGCTGAGTAAATATTTGAAGG - Intergenic
1120512353 14:85430736-85430758 CGTGCTCAATAAATAGTTATGGG - Intergenic
1121728442 14:96169885-96169907 GGTGCTTAGTAAATGGTTACAGG - Intergenic
1127353686 15:58177251-58177273 GGTGCCCAGTAAATAGTTATTGG - Intronic
1127697504 15:61465471-61465493 GGTGCCTGGCAATTAGTTATAGG + Intergenic
1128532786 15:68465935-68465957 GGTACTGGGTATATAGGAATGGG - Intergenic
1129229696 15:74190161-74190183 GATGATGGGTAAATAGATAGAGG - Intronic
1130441325 15:83956785-83956807 GGTGCTTGGTAAACACTTTTTGG + Intronic
1132450691 15:101966522-101966544 ACTGCTGGGTAAATATTTGTTGG - Intergenic
1132492422 16:239918-239940 GGTTCTGGAAAAATGGTTATGGG + Intronic
1134821018 16:17247492-17247514 GGTGCTTGGTAAATATTTGCTGG + Intronic
1136538212 16:30912962-30912984 GGTGCTGTGTTAATAGCTACTGG - Intergenic
1137537222 16:49336550-49336572 GGTGTTGTGGAAATACTTATGGG - Intergenic
1138361018 16:56426986-56427008 GGTGCTCTGTAAATATTTGTAGG + Intergenic
1138703064 16:58885480-58885502 GGTGCTAAGTAAATATTTACTGG - Intergenic
1138921109 16:61530270-61530292 GATGTTGGGGAAATAGTGATGGG + Intergenic
1140051099 16:71481926-71481948 GGTGCTGGGGAAAGAGCTAGGGG - Intronic
1142022467 16:87792307-87792329 GCTGCTTGGTAAATAGTCCTTGG - Intergenic
1143288630 17:5811466-5811488 TTTGCTGGGTAAAGACTTATAGG + Intronic
1146452325 17:32984501-32984523 GATGCTGGGAAAATAGACATGGG + Intronic
1147466310 17:40613763-40613785 GGAGCTCAGTAAATATTTATTGG + Intergenic
1147491960 17:40878061-40878083 GGTGCTGGGTAATGAGTGACAGG + Intronic
1148578480 17:48727581-48727603 GGAGATGGGTAAAAAGGTATTGG - Intronic
1150105860 17:62462035-62462057 GGTGCTCAGTAAATATTTATTGG + Intronic
1151149264 17:72069653-72069675 AGAGCTTGGGAAATAGTTATTGG - Intergenic
1151557608 17:74854542-74854564 GGTGATGGGGAGATGGTTATGGG - Intronic
1154225978 18:12504613-12504635 TGTGCTCACTAAATAGTTATAGG - Intronic
1155547888 18:26933658-26933680 GGTGCTCAGTAAATACTTCTTGG - Intronic
1155558274 18:27046484-27046506 GGTGCAGGGTATATAGTAACTGG + Intronic
1156156372 18:34307452-34307474 GGTGTTGGGGAAACAGTTAATGG + Intergenic
1156801160 18:41115702-41115724 GGTCCTGGGCATATAGTGATAGG - Intergenic
1159447687 18:68560273-68560295 GTTGCTGAGTAAATAGCCATAGG - Intergenic
1160634572 19:66025-66047 ACTGCTGGGTAAATATTTGTTGG + Intergenic
1161082805 19:2319859-2319881 GTGGCTGGGGAATTAGTTATCGG - Intronic
1162306891 19:9880282-9880304 GGTGCTCAGTAAATATTTCTGGG - Intronic
1165465839 19:35974255-35974277 GGTGCGGGGAAAATAATTCTAGG + Intergenic
1167599246 19:50444514-50444536 GGTGCTCGATAAATATTTGTTGG - Intronic
925653588 2:6119563-6119585 TCTGCTGGGTAAATTGTTCTCGG - Intergenic
926373139 2:12200578-12200600 GGTGCTTGGTAAATATTTTAGGG + Intergenic
927120686 2:19958378-19958400 GGTGCCAGGTAAATGGTTATTGG - Intronic
927122143 2:19975791-19975813 GGTGCTCAGTAAATATTTATTGG - Intronic
927471422 2:23380459-23380481 GTTGCTCAGTATATAGTTATTGG - Intergenic
928154563 2:28865153-28865175 GGTGCTTAGTACATATTTATTGG - Intronic
929954721 2:46447822-46447844 GTTACTGGGTAAAGAGTTCTAGG + Intronic
930933946 2:56923938-56923960 GGTACAGGGTAAAAATTTATAGG - Intergenic
931870750 2:66456834-66456856 GGTTCTGGGAAAATAGTGGTAGG - Intronic
932942751 2:76188271-76188293 GCTTCTGGGTAAATAAATATTGG - Intergenic
932967748 2:76497722-76497744 GGTGCTAGGAAAATAGCTGTGGG - Intergenic
933096380 2:78188279-78188301 GGTGCTGACTAAATACTTAAGGG + Intergenic
935471158 2:103462565-103462587 GTTGCTGGGAAAATATATATGGG - Intergenic
937726040 2:125167758-125167780 GGTGCTGGAGAATTAATTATTGG + Intergenic
938208185 2:129441427-129441449 GATGCTCAGTAAATAGTTTTTGG - Intergenic
940665225 2:156600923-156600945 GGTGGTGGGTGCTTAGTTATTGG - Intronic
942919981 2:181361280-181361302 GATGCTCAGTAAATCGTTATTGG - Intergenic
944636240 2:201678527-201678549 GGTGCTGGTGAAATAGCTCTGGG + Intronic
945105083 2:206303924-206303946 GGTACTGGTTAAATAATTAATGG - Intronic
948077391 2:235175589-235175611 GGTCTTGGGTAGAGAGTTATGGG - Intergenic
948755905 2:240159441-240159463 GCTGCTGGGTAAATTGATCTCGG - Intergenic
1169028911 20:2393031-2393053 GGTGCTGAGTATATAGATGTGGG - Intronic
1169608821 20:7355270-7355292 GGTGCTCACTAAATATTTATAGG - Intergenic
1170418191 20:16166797-16166819 GGTGCTGGGTATAGAGGTCTTGG - Intergenic
1172400992 20:34651290-34651312 GGTGCTGGGGAAATACAAATTGG - Intronic
1173172394 20:40737945-40737967 GGTGCTCTGTAAATATTTATTGG + Intergenic
1173334483 20:42101630-42101652 GGGGCTCAGTAAATGGTTATTGG - Intronic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1175328320 20:58145248-58145270 GATGCTTGGGAAATACTTATTGG + Intergenic
1177014317 21:15765563-15765585 GGTGCTGGATACATACTTAGGGG - Intronic
1177378648 21:20308276-20308298 GGGGCTGGGAATATAGTTAAGGG - Intergenic
1177476356 21:21628777-21628799 GGTGCTGGGCAAAGAGTGATAGG + Intergenic
1178483468 21:33001413-33001435 TGCCCTGGGTAAATATTTATTGG + Intergenic
1181335084 22:22123271-22123293 GATGGTGGGTAAAAAGTTTTTGG - Intergenic
1181444931 22:22962546-22962568 TGTGCTAGGTAAATAATTCTAGG - Intergenic
1183037531 22:35151455-35151477 GGTGCTCAGTAAATATTTACTGG - Intergenic
1183238573 22:36638953-36638975 GGTGCTTAGTAAATATTGATGGG - Intronic
949429585 3:3960730-3960752 GGTGCTTGGGAAAGAGTCATTGG + Intronic
949940365 3:9149975-9149997 GGTGCTGGGGAAACAGTGGTGGG + Intronic
950723279 3:14899598-14899620 GGTGCTCAATAAATAGTTCTTGG - Intronic
951018458 3:17755969-17755991 CCTGCTGGGTAAATAGATTTTGG + Intronic
955179462 3:56653594-56653616 GGTGCTGGGTACACAATTCTGGG - Intronic
956479189 3:69656508-69656530 GTTGCTGTGTAAATAGGTTTTGG + Intergenic
957808186 3:85179930-85179952 CGTGCTTAGTAAATATTTATGGG - Intronic
958026604 3:88058156-88058178 GGTGGTGGGGAAATAGTTTCTGG + Intronic
959393929 3:105812264-105812286 GGTGCTCAGTAAATATTTGTTGG - Intronic
959855524 3:111151863-111151885 GGGGTAGGGTAAATAGGTATAGG - Intronic
961141430 3:124559748-124559770 GGTGCTGGGGAAATGGTTTGAGG - Intronic
961176704 3:124841644-124841666 GGTGCTGGGTAAATAGTTATTGG - Intronic
966260177 3:177967799-177967821 TTTGCTTGGTAAATAGTTCTAGG - Intergenic
967901874 3:194463083-194463105 GGTGCTTAGTAAATATTTATTGG - Intronic
968843644 4:3026902-3026924 GGTGCTCAATAAATATTTATTGG - Intronic
969935128 4:10672805-10672827 GGTGCTGGGTAGATGGAGATGGG - Intronic
970978619 4:22071158-22071180 GGTGATGGGGATATAGTGATTGG - Intergenic
971028360 4:22610385-22610407 GGTGCTCAGTAAATACTTCTTGG - Intergenic
972802901 4:42496044-42496066 AGTGCTGGGTAAATTGCTCTTGG + Intronic
973231263 4:47841669-47841691 AGTGCTCAGTAAATATTTATTGG - Intergenic
973345353 4:49048958-49048980 GGTGCTTAATAAATACTTATTGG + Intronic
977036459 4:91959467-91959489 GGAGCTGGGGAAATAATCATAGG - Intergenic
980283684 4:130755423-130755445 GGTACTGGGTAAATATTCAAAGG - Intergenic
981610506 4:146589320-146589342 TGTACTCGGTAAATATTTATTGG + Intergenic
983621548 4:169766578-169766600 GGTGCTCAGTAAATATTAATTGG + Intergenic
984375653 4:178925562-178925584 TGTGCTGGATATAGAGTTATGGG - Intergenic
984612699 4:181858470-181858492 GGCACTGGATAAATAGCTATTGG - Intergenic
987105126 5:14631246-14631268 GGTGCTGGGTAAATACTGTATGG - Intergenic
988333301 5:29872025-29872047 GGCTCTGGGTAAATATTTTTTGG + Intergenic
990726795 5:58765176-58765198 GGTGCTGGCTAGAAAGTTAGGGG - Intronic
991371972 5:65927729-65927751 GGTTCTGCATAAATAGTGATAGG + Intronic
993839769 5:92863635-92863657 AATGCTTAGTAAATAGTTATAGG + Intergenic
995228271 5:109728103-109728125 GGTGCTCAGTAAATAATTGTAGG + Intronic
995604595 5:113838521-113838543 GGGGCTGGGCAAATATTTCTTGG - Intergenic
997358757 5:133281056-133281078 CGTGCTGGGTAAACAGTTGGTGG + Intronic
997377236 5:133405915-133405937 GGTGCTCAGTAAATATTTGTTGG - Intronic
1000429853 5:161138211-161138233 GGTGCTGAGTACATAGTGGTAGG - Intergenic
1000482928 5:161802392-161802414 GGTACTTAGTAAATAGTTGTTGG + Intergenic
1001755768 5:174167361-174167383 GGCGCTCAGTAAATAGTTACAGG - Intronic
1002073333 5:176693740-176693762 GGTGCTGGATACAGAGTTACAGG + Intergenic
1002834948 6:857938-857960 GGTGCTGAGTAACTATTTGTTGG - Intergenic
1004750721 6:18559276-18559298 GGTGCTGTGTTTATAGTTATAGG - Intergenic
1006183936 6:32169810-32169832 GGTGCTTAGTAAAGACTTATTGG + Intronic
1006398205 6:33800793-33800815 GCAGCTCGGTAAATATTTATTGG + Intronic
1006793723 6:36719452-36719474 GGTGCTGGATAAGTAGCTGTGGG - Intronic
1007513205 6:42390730-42390752 GGTGCTAGGAAAACAGTTGTGGG + Intronic
1007997804 6:46327193-46327215 GGTGATGGCTGAATAGGTATAGG + Intronic
1008505185 6:52223261-52223283 TGTGCTGGATAAAGAGTTCTTGG - Intergenic
1010102621 6:72127102-72127124 GGTGATGGGGAAATATTCATTGG - Intronic
1010488199 6:76441690-76441712 GGTGATTGCTAAATAGTTATTGG + Intergenic
1012261383 6:97091458-97091480 GGTGCTGGGTAGTCAGTAATGGG + Intronic
1012305510 6:97652408-97652430 TGTTCTTGGTAAATATTTATTGG - Intergenic
1012858689 6:104533206-104533228 GGTGCTTAGTAACTAGTTGTTGG - Intergenic
1017364892 6:153624105-153624127 GTTGCTGCGTAAATAATTGTGGG - Intergenic
1017425375 6:154315296-154315318 GGTGCTCAGTAAATATTTGTAGG + Intronic
1017617928 6:156264940-156264962 GGTGCTGTGGAAGTGGTTATAGG + Intergenic
1018864831 6:167738144-167738166 CTTGCTTGGTAAATATTTATGGG - Intergenic
1021068503 7:16207819-16207841 TTTACTGAGTAAATAGTTATAGG + Intronic
1022252399 7:28621250-28621272 GGTGGTGTGTAAAAAATTATAGG + Intronic
1022925915 7:35056089-35056111 GATGCTTGGTAAATATTTGTTGG - Intergenic
1025907022 7:65795155-65795177 GGTGCTCAGTAAATATTTCTTGG + Intergenic
1026318480 7:69248349-69248371 GATGCTCGGTAAATATTTGTTGG - Intergenic
1026851789 7:73728811-73728833 GGTGCTCAGTAAATATTTGTGGG + Intergenic
1027422662 7:78032513-78032535 GATGCTGAATAAATAGTTGTTGG - Intronic
1027747526 7:82096070-82096092 GGTGTTTAGTAAATATTTATTGG - Intronic
1027867282 7:83663764-83663786 GGTGCTGGGGTGATAGATATAGG - Intergenic
1028877438 7:95839584-95839606 GGTGGTGGGTAAACAGCTTTTGG - Intronic
1031494585 7:122431231-122431253 GGTACTCAGTAAATATTTATTGG - Intronic
1032035022 7:128515237-128515259 GGTGCTCAGTAAATATTTATTGG + Intergenic
1032215453 7:129953581-129953603 GGTGCTAAATAAATATTTATTGG - Intergenic
1033355349 7:140594682-140594704 GGTGCGTGGTAAATATTTGTTGG + Intronic
1034747795 7:153538577-153538599 GGTCCTCAGTAAATAGATATTGG - Intergenic
1036437978 8:8753232-8753254 GGTGGTGGCAAAATAGTTCTGGG - Intergenic
1038317056 8:26494413-26494435 TGTGCTGGGTAAAAAATTCTTGG - Intronic
1039909718 8:41816178-41816200 GGTGCTATGAAAATAGTTAATGG - Intronic
1041683584 8:60620430-60620452 GGTACGGGGTAAACAGTTATTGG - Intronic
1042244633 8:66698281-66698303 GGTACTGAACAAATAGTTATTGG + Intronic
1042308987 8:67360954-67360976 GGTGTTAGGCAAAAAGTTATTGG + Intergenic
1042916974 8:73884925-73884947 AGTGGTGAGTAAATAGCTATTGG - Intergenic
1044634019 8:94304418-94304440 GGTGCTGAATAAATATTTGTTGG - Intergenic
1044865909 8:96571179-96571201 TGTGCTGGGTAGAGAGTAATGGG + Intronic
1046615799 8:116475862-116475884 GCTGCTGTTTAAATACTTATAGG - Intergenic
1048011365 8:130459105-130459127 GGTACTCAGTAAATATTTATTGG - Intergenic
1049885626 9:24530-24552 ACTGCTGGGTAAATATTTGTTGG + Intergenic
1055220467 9:73924110-73924132 GATGCTGGGTAACTACTGATGGG + Intergenic
1055771394 9:79720356-79720378 AGTGCTGTGTATATAGGTATGGG + Intronic
1056540449 9:87566520-87566542 GGAGGGAGGTAAATAGTTATTGG + Intronic
1058302004 9:103386883-103386905 GGTGTTCGATAAATATTTATGGG + Intergenic
1058369296 9:104246289-104246311 GGTGCTGGTTACAGAGTTATAGG - Intergenic
1058792680 9:108466714-108466736 GGTGTAGGTTTAATAGTTATGGG + Intergenic
1059085174 9:111293614-111293636 GGTTCTGTTTAAATAGTTTTGGG + Intergenic
1059086398 9:111307440-111307462 GGTGCTGGGAAATTAATTATAGG - Intergenic
1061721675 9:132555879-132555901 GGTGCTTGATAAATATTAATTGG - Intronic
1062221893 9:135420788-135420810 GGTGCTGGGTAATTTGTCCTGGG + Intergenic
1062633177 9:137476368-137476390 AGTGCTGGCTAACTAGTGATGGG + Intronic
1185708722 X:2285034-2285056 GGTTCTGGGGAAATAGTTTAGGG + Intronic
1186277603 X:7956933-7956955 GGTGCTGAATACACAGTTATTGG - Intergenic
1186821240 X:13290360-13290382 GGTTCAGGGTAAATAATTCTAGG + Intergenic
1189724927 X:43958879-43958901 GGTTCTGGGTAAATAATTCTGGG - Intronic
1195689133 X:107609687-107609709 GATGCTGGGTAGATGGCTATGGG - Intergenic
1195913978 X:109917401-109917423 GGTACTCGTTAAATAGTTTTTGG - Intergenic
1197069179 X:122273226-122273248 GCTGCTGATTAAATAGTTCTGGG - Intergenic
1197291781 X:124667287-124667309 TTTACTGGTTAAATAGTTATAGG + Intronic
1202080010 Y:21074602-21074624 GGTGCTGGGTAGATGGGTACAGG - Intergenic