ID: 961179797

View in Genome Browser
Species Human (GRCh38)
Location 3:124867572-124867594
Sequence GGAGAATGGGCTTGGTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961179797_961179802 -10 Left 961179797 3:124867572-124867594 CCAGTACACCAAGCCCATTCTCC 0: 1
1: 0
2: 0
3: 13
4: 205
Right 961179802 3:124867585-124867607 CCCATTCTCCCTTTCTTCTGGGG 0: 1
1: 1
2: 1
3: 41
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961179797 Original CRISPR GGAGAATGGGCTTGGTGTAC TGG (reversed) Intronic
900935984 1:5766573-5766595 GGGTAATGGGCTTGGTGTCCTGG - Intergenic
901527248 1:9831343-9831365 AGAGAATGGGCTGGGTTTGCAGG + Intergenic
902462433 1:16588309-16588331 GGAGAAGGCACTTGGTGTAGGGG - Intronic
903143768 1:21356491-21356513 GGGGAAAGAGCTTGGTGTTCTGG - Intergenic
905404310 1:37722883-37722905 GGAGGGTGGGCTTGGTGTGGAGG + Intronic
905522973 1:38614340-38614362 GGAGAAAGGGCTTGCTGGGCAGG - Intergenic
906987979 1:50707409-50707431 GCATAATGGGCTGGGTGCACTGG + Intronic
907351085 1:53831389-53831411 GGAAAATGGGCTGGGTGCAGTGG + Intronic
908463877 1:64372598-64372620 GCAGAATGGGCTGGGTGCAGTGG + Intergenic
908535516 1:65073065-65073087 GGAGAATGGGAAGGGTGAACAGG - Intergenic
909674678 1:78225981-78226003 TGAGAATGGGTTTGGTGGATTGG + Intergenic
912260866 1:108110723-108110745 GGAGAGTGGGCTGGGTGTGGTGG + Intergenic
912605138 1:110982163-110982185 GGAGAATGGGCCAAGTGTAGTGG + Intergenic
913053369 1:115136199-115136221 GCAGAATGGGCTTGGTGAAGAGG + Intergenic
915090011 1:153417631-153417653 GGACAATGGCCTTGGTGATCTGG - Intronic
915095473 1:153459445-153459467 GGACAATGGCCTTGGTGATCTGG + Intronic
917261209 1:173172197-173172219 GGAGCCTGGGTCTGGTGTACAGG + Intergenic
918238488 1:182601868-182601890 GGAGGAAGGGCTAGGTGTAGAGG - Intronic
918590202 1:186232494-186232516 GGAGAATAGTCTTTGTGTCCAGG - Intergenic
918612697 1:186511411-186511433 GGAGAATGAGCTTGATGAATTGG - Intergenic
922517069 1:226215429-226215451 GGAATATGGGCTTGGTGGAGAGG - Intergenic
922673399 1:227532381-227532403 GGAGAATGGGGGTGGTTTCCAGG + Intergenic
1063057144 10:2518289-2518311 GGAGGATGGGCCTGGGGTAAGGG - Intergenic
1064233272 10:13548897-13548919 GGAGAATGGGCCTGGTGGGAGGG - Intergenic
1064293124 10:14053528-14053550 GGAAAATGGGCAAGGTGTATTGG - Intronic
1066214064 10:33268485-33268507 GAAGAATGGGCTTGGAGAGCAGG + Intronic
1067302443 10:45024398-45024420 GGGGAATGCACTTGGTGTATTGG + Intergenic
1067498654 10:46782022-46782044 AGTGAATGGGCTTGGTACACAGG + Intergenic
1068742404 10:60488569-60488591 GGAGAATGGGCTGGGAGAAAGGG - Intronic
1070401818 10:76059411-76059433 GGAGAATTGGCTTGGGGTCTTGG + Intronic
1070888702 10:79926328-79926350 GGAGAAATGGCTTGGTGGATGGG + Intergenic
1071617001 10:87083987-87084009 AGTGAATGGGCTTGGTACACAGG + Intronic
1072747021 10:97947697-97947719 GAAGCATGGTCTTGGTGTACTGG + Intronic
1074355144 10:112776279-112776301 GGAGAATTGGGGTGGGGTACTGG + Intronic
1076459918 10:130635153-130635175 TGAGAATGGGCTTTATGTCCTGG + Intergenic
1076751015 10:132543094-132543116 GGAGAAAGGGCTGGGTGTGAGGG - Intronic
1077345453 11:2047730-2047752 GGAGAATGAGTATGGTGTATGGG - Intergenic
1079142331 11:17820198-17820220 AGAGAAGGGGCTTGGAGTTCAGG - Intronic
1080026592 11:27621519-27621541 GGAGATTATGCTTGGTGTCCTGG - Intergenic
1081119541 11:39248454-39248476 GTAGAATGGGCTGGGTGTGGTGG - Intergenic
1083951710 11:65960108-65960130 AGAGAAGGGGCTGTGTGTACTGG - Intergenic
1084455988 11:69268562-69268584 GGTGAATGAGCTTGGTTTTCTGG + Intergenic
1084881555 11:72175016-72175038 GGTGGATGGGCTGTGTGTACAGG - Intergenic
1085175455 11:74482856-74482878 GGAGATTGGGCTGGGTGTGGTGG + Intergenic
1085556359 11:77426036-77426058 CAAGAATGGGCTTGGTGCAGTGG - Intronic
1086671069 11:89548559-89548581 GGAGAATGAGGAAGGTGTACTGG + Intergenic
1089477253 11:118774709-118774731 GGAGAATTGGCTGGGTGCAGTGG - Intronic
1089715215 11:120352920-120352942 GGGGAATGGGCTGGGAGTACAGG - Intronic
1090155415 11:124432526-124432548 GGAGAATGGACTTGTGGTTCAGG - Intergenic
1091682471 12:2537001-2537023 GGAGCATGGGCTTGGGGGCCAGG - Intronic
1092072990 12:5648480-5648502 GGATAATGGCCTGGGTGAACTGG - Intronic
1092875551 12:12844368-12844390 AGAGAATGGGCTGGGTGCAGTGG - Intergenic
1094364313 12:29663802-29663824 GGAGAATTGGCTGGGTGTGGTGG - Intronic
1095814001 12:46401410-46401432 TGAGAAGGGGCTTGGAGCACTGG + Intergenic
1095962547 12:47844595-47844617 AGAGAATGGGCTGGGTGGATAGG + Exonic
1096481527 12:51944361-51944383 GGAGAATGGGAGTGGTGTCCAGG - Intergenic
1097981044 12:65738339-65738361 AGAGATAGGGCTTGGCGTACAGG + Intergenic
1098207019 12:68121666-68121688 GGAGAATAGGTTTGGTGCTCAGG - Intergenic
1099200586 12:79672174-79672196 AAAGAATGGGCTCTGTGTACGGG - Intronic
1100602140 12:96121006-96121028 GGAGACTGGGCTGGGGGTAGGGG + Intergenic
1102162171 12:110778371-110778393 GGAGTTTGGGGTTGGAGTACAGG + Intergenic
1102220002 12:111187839-111187861 TGAGAATGGGCCTGGAGTGCTGG + Intronic
1105528218 13:21195433-21195455 GGAGAATTGGCCTGGTGCAGTGG - Intergenic
1106719863 13:32426984-32427006 AGAGAAGCGGCTTGGTTTACAGG + Intronic
1110914279 13:81001997-81002019 GGAGAATGTGCTTGGATTACAGG + Intergenic
1111467255 13:88630849-88630871 GTAGAATGGGGCTGGTGTAGAGG - Intergenic
1112255643 13:97828292-97828314 GGAGAACGTCCTTGGGGTACTGG - Intergenic
1118635597 14:67746203-67746225 GGGGACTGGGCTGGGTGGACAGG + Intronic
1119620174 14:76125947-76125969 CTGGAATGGGCTTTGTGTACTGG + Intergenic
1119659101 14:76437890-76437912 GGTGGAGGGGCTTGGTTTACAGG + Intronic
1121238742 14:92412642-92412664 GGAGGATGGGCGTGGTGTGGAGG - Intronic
1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG + Intronic
1125719835 15:41840039-41840061 GGAGGATGGGCCTGGGGTTCAGG + Intronic
1126506285 15:49407297-49407319 GGAGAATGGGCCAGTTGAACTGG - Intronic
1126987674 15:54331634-54331656 GGAGAAGGGGCATGAAGTACAGG + Intronic
1128522478 15:68384982-68385004 GGAGAAAGGGTATGGTGTCCAGG - Intronic
1129316577 15:74748977-74748999 GGAGCCTGGGCTAGGTGTAGGGG + Intronic
1130979141 15:88801152-88801174 AGTGAATGGGATTGGAGTACAGG - Intergenic
1131208042 15:90468350-90468372 GTTGAATGGGCTGGGTGTGCTGG - Intronic
1132341178 15:101079332-101079354 GGAGAATGGAGTTGGGGTATAGG + Intergenic
1138140274 16:54562330-54562352 GGAGAGAGGACTGGGTGTACCGG - Intergenic
1138546324 16:57722014-57722036 GGGGAATGGGCTGGGTTTCCAGG - Intronic
1139094458 16:63687894-63687916 GGAGAATGTTCTTTGTGCACTGG - Intergenic
1139325393 16:66148697-66148719 AGAGAATGGGCTTCCTGTCCCGG - Intergenic
1142806681 17:2375119-2375141 GGAGAATGGCCTTAGTGTTTTGG - Intronic
1143261930 17:5605934-5605956 GGAGAAAGGGCTGGGTGTGGTGG + Intronic
1149590838 17:57828803-57828825 AGAGAATTGGCTGGGTGTAGTGG - Intergenic
1150645238 17:66973750-66973772 GGTGCATGGGCTTGGTCTCCTGG + Intronic
1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG + Intronic
1151702162 17:75749238-75749260 GCAAAATGGGCTGGGTATACTGG + Intronic
1153755828 18:8281905-8281927 GGAGAATGCTTTTGGTGTAATGG - Intronic
1153900068 18:9610744-9610766 GGAGAATAGGCTGGGTGCAGTGG - Intronic
1154339719 18:13492840-13492862 GGAGAACGGGCTGGGTGCAGTGG + Intronic
1155111929 18:22724240-22724262 GGAATATGGGCTTGGTTTTCTGG + Intergenic
1155419003 18:25633460-25633482 TGAAAATGGGCTTGGTGCAGTGG - Intergenic
1156221589 18:35058021-35058043 GGAGCATGGGTTTGATGTAGAGG + Intronic
1157260437 18:46172039-46172061 GGAGAAGGGGCTGGGTGCGCTGG + Intergenic
1157622222 18:49023230-49023252 GGAGCCTTGGCTTGGTGTGCTGG + Intergenic
1158649966 18:59275658-59275680 AGAGAGTGGGCTTTGGGTACCGG + Intronic
1160918362 19:1508250-1508272 GGAGGATGGGCTTGGCGCCCGGG + Intronic
1162282398 19:9709789-9709811 GGAGAATGGGGTCCTTGTACAGG - Intergenic
1163951589 19:20592714-20592736 GCAGAATGGGCTGGGTGCAGTGG - Intronic
1163965027 19:20738381-20738403 GCAGAATGGGCTGGGTGTGGTGG + Intronic
1164628436 19:29745197-29745219 GGAGATTGCGATTCGTGTACTGG + Intergenic
1165028114 19:32976758-32976780 AGAGAATGGGCCGGGTGCACTGG + Exonic
1165240451 19:34462676-34462698 GAAAATTGGGCTTGGTGCACTGG + Intronic
1165423993 19:35735738-35735760 GAAGAATGGGTTTGGCGTGCAGG - Intronic
1165495655 19:36150875-36150897 GGAGGATGGGCTTGGTGGGGAGG + Intergenic
1165838813 19:38774669-38774691 GGGGAATTGGCTTGGTGGAGGGG + Intergenic
1165946731 19:39447704-39447726 GGATAATGGGCTTGGTGCAGTGG - Intronic
1166241127 19:41494677-41494699 GGAGATTGGGCTGGGTGCAGTGG + Intergenic
1168095887 19:54114735-54114757 GGAGAAGGGGCTGGGGGTCCAGG - Intronic
925670985 2:6309661-6309683 TGAGAATTTGCTTTGTGTACAGG - Intergenic
926372995 2:12199092-12199114 TGAAGATGGGCTTGGTGTGCAGG - Intergenic
927975514 2:27335559-27335581 GGAGAATGGGGCTGCTGTAGTGG - Intronic
928511310 2:32006677-32006699 TGAGAATGGGCTGGGTGTGGTGG + Intronic
928708465 2:33977736-33977758 GGAAAATGAGTTTGGTGAACAGG - Intergenic
928721192 2:34123642-34123664 GGAGAATGGGCATGGGGTGGAGG - Intergenic
930754677 2:54962388-54962410 GGTGAATGGGGGTGGTGGACAGG - Intronic
932324946 2:70852625-70852647 TGGTAATGGGCTTGGTGTAGAGG + Intergenic
933713657 2:85345089-85345111 GGAGGTCGGGCTTGGTGCACAGG - Intronic
937410716 2:121672632-121672654 GCAGAATGGGCTGGGTGTGGTGG + Intergenic
937761445 2:125608586-125608608 GGAGAAAGGGCTTGAGGAACTGG + Intergenic
938021257 2:127907552-127907574 TGAGAATGGGCTGGGTGTGGTGG + Intergenic
938937205 2:136137645-136137667 GGAGAAAGGGTATGGTGTAATGG + Intergenic
941904487 2:170707665-170707687 GGAGAAAGGGCTGGGTGCAGTGG - Intergenic
944100369 2:196019910-196019932 GGAGATTGGTCTTGCTGTGCGGG - Intronic
945022781 2:205590825-205590847 GCAGAGAGGGTTTGGTGTACTGG - Intronic
946494302 2:220180367-220180389 GCAGTATGGGGTTGGGGTACAGG - Intergenic
948255522 2:236565844-236565866 GCAGAAGGGGCTTGGTGTTGCGG + Intergenic
1172788315 20:37485088-37485110 GAGGAATGAGCTTGGTGCACTGG + Intergenic
1174107330 20:48171998-48172020 GGAGAATGGGATGGGTGTGGGGG - Intergenic
1176102685 20:63371741-63371763 GGAGAATGGGCTTGTGGTGCTGG + Intronic
1176299814 21:5094341-5094363 GGAGGACGGGCTTGGTGAAAGGG + Intergenic
1178796216 21:35746695-35746717 GGAGAAAGGGATTGGTAAACAGG - Intronic
1179857208 21:44167570-44167592 GGAGGACGGGCTTGGTGAAAGGG - Intergenic
1183964819 22:41435358-41435380 GGGGAATGGGCTGGGGGTATTGG - Exonic
952810679 3:37399754-37399776 GAAGACTGGGCTTTGTGCACTGG + Intronic
953787373 3:45921330-45921352 GGAGACTGAGCTGGGTGCACTGG - Exonic
954189096 3:48943494-48943516 AGAGAATGGTCTTGGCGTATGGG + Intronic
961179797 3:124867572-124867594 GGAGAATGGGCTTGGTGTACTGG - Intronic
961820296 3:129572468-129572490 GGAGAAGGGGCTTGGCTTAGGGG + Intronic
962560275 3:136599240-136599262 AGAGATTGGGCTAGGTGTGCTGG + Intronic
964651266 3:159014326-159014348 AGAGAATGTGCTGGGTGTTCAGG + Intronic
964690496 3:159444302-159444324 GGAGAGTAGGCTGGGAGTACTGG - Intronic
964914714 3:161826586-161826608 GGAGAAAGGAATTGGTGTGCTGG - Intergenic
967227426 3:187305455-187305477 GGAGAATGGACTTGGAGGATGGG + Intergenic
968922014 4:3527237-3527259 GGAGAAGGGGCTGGGTGGATGGG - Intronic
969129483 4:4981099-4981121 GGAGTATGGGCTTGGAGTCAAGG + Intergenic
970474996 4:16413022-16413044 GGAGGATGGGCTTGGGATCCAGG - Intergenic
976782376 4:88775337-88775359 AGAGAATGGGGTTGGAGTTCGGG + Intronic
980242505 4:130195098-130195120 GGAGAAAGGGCTTGGGCTATAGG - Intergenic
981540362 4:145840061-145840083 TGAGAAAGGGCTTGGTGAAATGG + Intronic
981811787 4:148783845-148783867 GGAGAAGGGGCTGGGTGTGGGGG - Intergenic
983788177 4:171760183-171760205 GGAGAATGAGTTTGATGAACTGG + Intergenic
985902022 5:2803953-2803975 GCAGAGTGGGCTTGGTGGGCCGG + Intergenic
986245208 5:6000938-6000960 GGAGAAGGGGCGGGATGTACTGG - Intergenic
987914028 5:24188367-24188389 TTAGCATGGGCTTGGTTTACAGG - Intergenic
988428781 5:31094422-31094444 GGAAAATGGGCCTGGTGTGGTGG + Intergenic
989721035 5:44528344-44528366 TGAGCAAGGGTTTGGTGTACAGG - Intergenic
990812113 5:59739130-59739152 GGAGAAAGGGCTGGGTGCAGTGG + Intronic
991589157 5:68231005-68231027 GCTGAATGGGGTTGGTGTAGCGG - Intronic
993650237 5:90511115-90511137 GGGGAATGGGATGGGTGGACAGG - Intronic
997180971 5:131828559-131828581 GGAGATTGGGCTTCCTGTATTGG - Intronic
997705069 5:135942725-135942747 AGGGAATGGGCTGGGTGTCCAGG - Intronic
997771105 5:136555459-136555481 GGAGAAAGGTCTTAGTGTGCTGG + Intergenic
997845315 5:137280850-137280872 GGAGGAGGGGATTGGTGCACCGG - Intronic
999181598 5:149673765-149673787 GTAGAATGGGCTAGGTGTGGTGG + Intergenic
999441298 5:151602862-151602884 AGAGAGTGGGCTTGGTTTTCTGG + Intergenic
1000855043 5:166387716-166387738 GGAGAATGAGCTTGGTTAGCAGG + Intergenic
1002116829 5:176968863-176968885 AGAGAATGACCTTGGTATACTGG + Exonic
1005087186 6:22019179-22019201 GAAGAATGGGCCTGGTGTGATGG - Intergenic
1006227918 6:32556140-32556162 GGAGAATAGGCTGGGTGCAGTGG - Intronic
1006568729 6:34982557-34982579 ACAGAATGGCCTTGGTGTATGGG + Intronic
1007324141 6:41047570-41047592 TGAAACTGGGCTTGGGGTACAGG - Intronic
1008652592 6:53578085-53578107 GGAGAATAGGGTTGGTGTGATGG + Intronic
1010243522 6:73640601-73640623 GGCCACTGGGCTTGGTGTAGAGG - Intronic
1010426515 6:75734241-75734263 TGAGAATGGGCTGGGTGTGGTGG + Intergenic
1012988607 6:105901305-105901327 GGAAAATGGTCATGATGTACTGG - Intergenic
1016998493 6:149977874-149977896 GGAGACTAGGGTTGGTGTTCAGG - Intergenic
1017380090 6:153818140-153818162 GGAGAAGGGACTTGGTGTGTTGG - Intergenic
1022496011 7:30853618-30853640 GGAGAATGGACTTGGGGTGAGGG + Intronic
1027682723 7:81240687-81240709 GGGGAATGGGCTGGGTGCAGTGG + Intergenic
1028515871 7:91677811-91677833 GGTGAATGTGCTTTGTGGACAGG - Intergenic
1029191060 7:98772652-98772674 GTGGAGTGGGCTTGGGGTACGGG - Intergenic
1029251434 7:99239521-99239543 GGAGCATGGGGGTGGTGTGCTGG + Intergenic
1029632030 7:101758585-101758607 GAAGAATGGGCTAGGTGTGGTGG + Intergenic
1032231947 7:130082023-130082045 GGATAATGGGCTGGGTGTAGTGG + Intronic
1033629417 7:143141986-143142008 GGAGCATGGGCTGGGTGTGGTGG - Intergenic
1034689011 7:152999258-152999280 GGAGAATGAGTTTGATGAACTGG - Intergenic
1035113705 7:156505666-156505688 GGCGAGTGGGCTGGGTGTCCTGG - Intergenic
1037694057 8:21208219-21208241 GGAGAAAGGGCTTGGGGGAATGG + Intergenic
1038486517 8:27939229-27939251 GGAGAAGGGGCATGGTGTTTGGG - Intronic
1039689982 8:39852550-39852572 GGAGAATGGGCTCCCTGTACGGG + Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041249286 8:55918909-55918931 CGAGAATGGGCTGGGTGCAGTGG + Intronic
1041539706 8:58969697-58969719 GGAGAATGATCTCGGTGTAGAGG - Intronic
1043983225 8:86664521-86664543 GGGGAAGGGGCTTGGGGTAGTGG + Intronic
1044726132 8:95195641-95195663 GGGGAGTTGGCTTGGTGTAGTGG + Intergenic
1046696977 8:117352068-117352090 GGAGAAAGGGCTGGGTGTAGTGG + Intergenic
1047039232 8:120974304-120974326 GGAGAATGGGCCAGGTGTGGTGG + Intergenic
1048866771 8:138767248-138767270 GTGGAATGGGCTTGGGGTAGGGG + Intronic
1049207608 8:141370731-141370753 GGAAACTGGGCTGGGGGTACAGG + Intergenic
1050555108 9:6783053-6783075 AGAGGATGGGCTTGGTGTGTAGG + Intronic
1052901025 9:33795217-33795239 GGAGAATGGCCTGGGTGTCTAGG - Intronic
1053850687 9:42287763-42287785 GGAGGATGGGCATGGGGCACTGG - Intergenic
1055442360 9:76348982-76349004 GTAGAATGGGCTGGGTGTGGTGG + Intronic
1057915278 9:99050586-99050608 GGAGGGTGGGCCTTGTGTACAGG + Intronic
1062031324 9:134363343-134363365 GGAAAATGGGGTGGGTGGACAGG - Intronic
1062193167 9:135257957-135257979 GGAGAATAGGCTGTGTGTGCTGG - Intergenic
1186904825 X:14099951-14099973 GGAGAATGGGCTGGGTGTTGGGG + Intergenic
1187016919 X:15338358-15338380 GGAAAATGGGCTTGATGTTGAGG + Intergenic
1188106396 X:26152477-26152499 GGAGAATGGTGCTGGTGTGCAGG + Intergenic
1190152026 X:47956993-47957015 GGGGAAGGGGCTTGGTTAACCGG + Intronic
1190160633 X:48029156-48029178 GGGGAAGGGGCTTGGTTAACTGG - Intronic
1190282030 X:48937300-48937322 GTAGACTGAGCTTGGGGTACTGG + Intronic
1197338790 X:125241164-125241186 ACAAAATGGGCTGGGTGTACTGG + Intergenic
1198775899 X:140178688-140178710 GGAGGATGGGCTTTGTAAACTGG + Intergenic
1199940003 X:152615989-152616011 TTAGCATGGGCTTGGTGTTCTGG - Intergenic