ID: 961182405 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:124887112-124887134 |
| Sequence | CCGTGAGCCGGAGCTGCGCG CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 501 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 28, 4: 472} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 961182405_961182419 | 30 | Left | 961182405 | 3:124887112-124887134 | CCGCGCGCAGCTCCGGCTCACGG | 0: 1 1: 0 2: 0 3: 28 4: 472 |
||
| Right | 961182419 | 3:124887165-124887187 | CATCCGTCCCGCAGCACTCACGG | 0: 1 1: 0 2: 0 3: 3 4: 65 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 961182405 | Original CRISPR | CCGTGAGCCGGAGCTGCGCG CGG (reversed) | Exonic | ||