ID: 961182419

View in Genome Browser
Species Human (GRCh38)
Location 3:124887165-124887187
Sequence CATCCGTCCCGCAGCACTCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961182407_961182419 18 Left 961182407 3:124887124-124887146 CCGGCTCACGGCGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 961182419 3:124887165-124887187 CATCCGTCCCGCAGCACTCACGG 0: 1
1: 0
2: 0
3: 3
4: 65
961182405_961182419 30 Left 961182405 3:124887112-124887134 CCGCGCGCAGCTCCGGCTCACGG 0: 1
1: 0
2: 0
3: 28
4: 472
Right 961182419 3:124887165-124887187 CATCCGTCCCGCAGCACTCACGG 0: 1
1: 0
2: 0
3: 3
4: 65
961182411_961182419 -5 Left 961182411 3:124887147-124887169 CCCGCGCCCCGCCGCCACCATCC 0: 1
1: 0
2: 4
3: 52
4: 598
Right 961182419 3:124887165-124887187 CATCCGTCCCGCAGCACTCACGG 0: 1
1: 0
2: 0
3: 3
4: 65
961182409_961182419 5 Left 961182409 3:124887137-124887159 CCCGCGCTGGCCCGCGCCCCGCC 0: 1
1: 0
2: 5
3: 94
4: 711
Right 961182419 3:124887165-124887187 CATCCGTCCCGCAGCACTCACGG 0: 1
1: 0
2: 0
3: 3
4: 65
961182410_961182419 4 Left 961182410 3:124887138-124887160 CCGCGCTGGCCCGCGCCCCGCCG 0: 1
1: 0
2: 7
3: 54
4: 495
Right 961182419 3:124887165-124887187 CATCCGTCCCGCAGCACTCACGG 0: 1
1: 0
2: 0
3: 3
4: 65
961182412_961182419 -6 Left 961182412 3:124887148-124887170 CCGCGCCCCGCCGCCACCATCCG 0: 1
1: 1
2: 3
3: 45
4: 563
Right 961182419 3:124887165-124887187 CATCCGTCCCGCAGCACTCACGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961182419 Original CRISPR CATCCGTCCCGCAGCACTCA CGG Exonic