ID: 961183446

View in Genome Browser
Species Human (GRCh38)
Location 3:124894624-124894646
Sequence TGTTTTCTCATATCACCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961183441_961183446 27 Left 961183441 3:124894574-124894596 CCTCTTTCCGCTGGAGCAAAGCA 0: 1
1: 0
2: 2
3: 10
4: 96
Right 961183446 3:124894624-124894646 TGTTTTCTCATATCACCTAAAGG 0: 1
1: 0
2: 1
3: 16
4: 211
961183440_961183446 28 Left 961183440 3:124894573-124894595 CCCTCTTTCCGCTGGAGCAAAGC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 961183446 3:124894624-124894646 TGTTTTCTCATATCACCTAAAGG 0: 1
1: 0
2: 1
3: 16
4: 211
961183442_961183446 20 Left 961183442 3:124894581-124894603 CCGCTGGAGCAAAGCAATCACAA 0: 1
1: 0
2: 1
3: 27
4: 162
Right 961183446 3:124894624-124894646 TGTTTTCTCATATCACCTAAAGG 0: 1
1: 0
2: 1
3: 16
4: 211
961183444_961183446 -9 Left 961183444 3:124894610-124894632 CCTCTTTTCCTGGATGTTTTCTC 0: 1
1: 0
2: 4
3: 77
4: 497
Right 961183446 3:124894624-124894646 TGTTTTCTCATATCACCTAAAGG 0: 1
1: 0
2: 1
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961183446 Original CRISPR TGTTTTCTCATATCACCTAA AGG Intronic
900850603 1:5139650-5139672 TGTTTACTCATATCCTCTGAGGG + Intergenic
903904804 1:26677332-26677354 TGTTTTCTCTTGTCACGTCAAGG - Intergenic
907785724 1:57610726-57610748 TGAGTTCTCATAAGACCTAATGG - Intronic
907938168 1:59061302-59061324 TGTTTTCTCAGATCACTCCAGGG - Intergenic
908199352 1:61778333-61778355 TATTTTGTCATATCACATATTGG - Intronic
909410673 1:75347223-75347245 TGCTTCCTCATATCACCCACAGG + Intronic
909566067 1:77054757-77054779 TGCCTTCTCATCTCACCCAAAGG + Intronic
910046270 1:82921066-82921088 TGGTTTCACATACCACCCAAGGG + Intergenic
912010190 1:104949862-104949884 TATTTTCACATATCAGCCAAAGG + Intergenic
912722222 1:112029881-112029903 CGTTTTATCATATCACCTTTGGG + Intergenic
913022135 1:114798653-114798675 TTTTTCCCCATATCACCTAATGG + Intergenic
915881963 1:159681933-159681955 TGTTTCCTCATATGACAAAAGGG + Intergenic
916335789 1:163669832-163669854 TGTTTTCTCATTTTACATATTGG + Intergenic
916833072 1:168513007-168513029 TGTTTGCTGATGTCACCTGATGG + Intergenic
917908469 1:179613935-179613957 TGTTTTCCCATATGGCCAAAAGG + Intronic
918174467 1:182030358-182030380 TCTTTCCTCATATCCCCGAACGG - Intergenic
918705055 1:187649867-187649889 TCTTTTCTCTTATAAGCTAAGGG - Intergenic
919267384 1:195287358-195287380 TTTTTTCTTATAACACCTCAAGG - Intergenic
919351674 1:196464096-196464118 TGTTTTCTCATCTAACTTAAGGG - Intronic
922625275 1:227034348-227034370 TATATTATCACATCACCTAAAGG - Intronic
922633926 1:227144661-227144683 TTTAATCTCATATAACCTAAAGG + Intronic
923882129 1:238115176-238115198 GGTTATCTCATATAACCAAAGGG - Intergenic
1066141927 10:32512913-32512935 AGTTTTCTAATATCAACTATTGG + Intronic
1067197183 10:44132268-44132290 TGTTTGCTAATTTCCCCTAAAGG + Intergenic
1068042280 10:51840276-51840298 TTTTTTCTCTTTTCAACTAAGGG + Intronic
1071614196 10:87059631-87059653 TTCTTTCTCCTATTACCTAAGGG + Intronic
1072188271 10:93061814-93061836 TGTTTCCTCATCTCACCAATAGG + Intronic
1077507523 11:2937689-2937711 TGATTTCTCATCTCCCCAAATGG - Intergenic
1078796115 11:14593154-14593176 TGTTTTCTCATTTGAGATAAGGG - Intronic
1078828341 11:14953362-14953384 AGTTTGCTCATATCAGCTCATGG - Intronic
1079012494 11:16840899-16840921 TGTATTCTCTTGTAACCTAAGGG - Intronic
1081290274 11:41316494-41316516 TGTTTTTATATATCACCTACAGG + Intronic
1085965814 11:81524640-81524662 TTTTTTCTCATATGTGCTAAAGG + Intergenic
1087413384 11:97821518-97821540 TGTATTCTCATATAGCCTCATGG + Intergenic
1087919639 11:103851481-103851503 TAGATTCTCATATCACCAAATGG - Intergenic
1091595758 12:1878186-1878208 TTTTTTCTCATATTACCCACTGG + Intronic
1093316493 12:17657513-17657535 TATTTTCTCATCTCTCATAACGG - Intergenic
1093378064 12:18455687-18455709 TGTTTTCTCACATGGCCAAAGGG + Intronic
1094775216 12:33718967-33718989 TGTTTTTACATATCAACAAATGG - Intergenic
1095611615 12:44135117-44135139 TATTTTCTCATATAACCTCCAGG + Intronic
1096427501 12:51516597-51516619 ACTTTTCTCATATCAATTAATGG - Intergenic
1099088983 12:78280624-78280646 TGTTTTCTCATATGACTCATTGG - Intergenic
1099089048 12:78281247-78281269 TGTTTTCTCATATGACTCATTGG + Intergenic
1099326314 12:81219338-81219360 TCTTTTCTCATATCTGCTTAAGG + Intronic
1101311209 12:103581160-103581182 TGTTTTATCATACAAGCTAAGGG + Intergenic
1101529056 12:105557863-105557885 TGTCCTCTCATATCTCCTATTGG - Intergenic
1102424465 12:112830755-112830777 TGTTTTTTAATATCACAAAAGGG - Intronic
1104476708 12:129076409-129076431 TTTTTTCTCTTATGACCTACTGG + Intronic
1105409465 13:20160175-20160197 TGTTTTCTCAAGTCTCCTACGGG + Intronic
1106921271 13:34566160-34566182 TGTTTTCTTATATAACTCAAGGG - Intergenic
1107110276 13:36690116-36690138 TTTTGTCTCACATCACCCAATGG + Intronic
1109560965 13:64049787-64049809 TGTTTTCCCCCACCACCTAACGG + Intergenic
1113305155 13:109069601-109069623 TGTGTGCTCATATGACCTCATGG + Intronic
1115646937 14:35375039-35375061 TGTTTTGCCAAATTACCTAAGGG + Intergenic
1116185075 14:41590076-41590098 TGTGTTCTCATATGACAGAAAGG + Intergenic
1116582086 14:46654592-46654614 TCTGTTCTCATATCTCTTAATGG - Intergenic
1117427591 14:55616970-55616992 TGCTTTTTAATATCACTTAAAGG + Intronic
1118542681 14:66846240-66846262 TGTCTTCTCAATTCTCCTAAGGG + Intronic
1118928440 14:70215900-70215922 TTTTTACTCAAATCACCCAATGG - Intergenic
1119884067 14:78125567-78125589 TGTTTTCTCATAACACAACAGGG - Intergenic
1120602023 14:86522366-86522388 TGTTTTCTCCTAGGAGCTAAAGG + Intergenic
1121937971 14:98037851-98037873 TCTCTTCTCATATCTCTTAATGG + Intergenic
1126905260 15:53358299-53358321 TGTTTCTTTATATCACCTGAAGG + Intergenic
1129915201 15:79263922-79263944 ATTTTTCTCATATCAGTTAACGG + Intergenic
1130009189 15:80134897-80134919 TCAGTTCTCATATCACCAAACGG - Intronic
1131837415 15:96405047-96405069 TGTTATCACATAATACCTAAGGG - Intergenic
1133361225 16:5175365-5175387 TGTCTTTTTATATCACCTACTGG + Intergenic
1137281368 16:46979585-46979607 TGTTTTCTCACATATCCTCAAGG - Intergenic
1137415733 16:48277069-48277091 TGTTTCTTCATTTCACCAAATGG + Intronic
1139247401 16:65459157-65459179 TGTTTTCTCATATCTCAGGAAGG - Intergenic
1141081790 16:81059507-81059529 TGATTACTCATATCACAGAACGG + Intronic
1142882469 17:2892518-2892540 TGTGTTCTCATAGCATCTACTGG + Intronic
1144887186 17:18471357-18471379 TGTTCTCTCATTTCACATCAGGG + Intergenic
1145145030 17:20472938-20472960 TGTTCTCTCATTTCACATCAGGG - Intergenic
1146353906 17:32118430-32118452 TGTTCTCTCATTTCACATCAGGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148935285 17:51160189-51160211 TGTTTTCATATACCAGCTAATGG + Intronic
1150984105 17:70175871-70175893 TGTTTACTCAAATCATATAAAGG - Exonic
1151116211 17:71738337-71738359 TCTTTACTCATGTCCCCTAAAGG - Intergenic
1151204735 17:72497969-72497991 TCTTTTTTCATATCATTTAAGGG - Intergenic
1152897994 17:82924530-82924552 TGTTCTATCATATGACATAAAGG - Intronic
1153428997 18:4994542-4994564 TGTTTTCTCATATGAAATATTGG + Intergenic
1158666166 18:59434552-59434574 TGTTTTCTCAGAGCACCTCTGGG - Exonic
1159882874 18:73876097-73876119 TTTTCTCTCATATCATCTGATGG + Intergenic
1160504983 18:79422005-79422027 CGGTTTCTCAAATCACCTAAAGG - Intronic
1161625640 19:5325014-5325036 TGATTTCTCTTTTCACCTAAGGG + Intronic
1167139975 19:47643641-47643663 TGTTTTCTCAGCTAACCTACAGG - Intronic
1167941788 19:52952929-52952951 TGTTTTCTCATTTCACGTGAGGG - Intronic
1168430348 19:56274142-56274164 AGTTTTCTCATCTCAGTTAAGGG - Intronic
925954159 2:8945081-8945103 TGGTGCCTCATATCACCTTAAGG + Intronic
927930967 2:27043890-27043912 TGTTGTCTTACCTCACCTAAAGG + Intronic
928810358 2:35217215-35217237 TGTTTTCTCCTCTCTCCTATTGG - Intergenic
929401010 2:41581729-41581751 TGTGATCTAATATCACCTACAGG - Intergenic
930406563 2:50964814-50964836 TGTTTTCTTAAATGACTTAATGG - Intronic
932594619 2:73086370-73086392 TGCTTCCCCATATCTCCTAATGG - Intronic
932716593 2:74104737-74104759 TGGTTTCTCCTTTCATCTAATGG - Exonic
933666340 2:84968233-84968255 TGTTTTTTCAAATAAGCTAATGG - Intergenic
934715031 2:96538187-96538209 TGTGTTCCCATTTCACCTACGGG - Intronic
935868873 2:107423306-107423328 TGGTTTCCCATCTGACCTAAGGG + Intergenic
936951091 2:117978139-117978161 CGTTTTCTCAAGTCACCAAATGG - Intronic
940283513 2:152011013-152011035 TGTTTTCTTTGATCACCCAAGGG - Intronic
940415620 2:153416746-153416768 TGTTGTATCATATCACATAGAGG - Intergenic
940647973 2:156411716-156411738 TGTTTTCTGCTATGACCTTAAGG + Intergenic
941012967 2:160322171-160322193 TGTTTTCTCATATGCACAAATGG - Intronic
941687812 2:168465345-168465367 TGTATTCTCACATCACGGAAGGG + Intronic
944286344 2:197954168-197954190 TGTTTTTCCATACCAGCTAAAGG + Intronic
944335818 2:198532995-198533017 TGGATGCTCATATCATCTAAAGG - Intronic
944909324 2:204293961-204293983 TATTTTCTCCTCTCACCTCAAGG + Intergenic
945494099 2:210489241-210489263 TCTTCTCTCCTATCTCCTAATGG + Intronic
945942959 2:215968115-215968137 TGTTTTCTCATCTAACAGAAGGG - Intronic
946687414 2:222284467-222284489 TGTTTTGACATCTCAGCTAATGG + Intronic
946784538 2:223228596-223228618 TCCTTTCTCTTGTCACCTAAGGG - Intergenic
947231134 2:227887766-227887788 TACTTTCTCATATCACCAAAAGG - Intronic
948884188 2:240874786-240874808 TCATTTCTCACATCACCCAAAGG - Intronic
1169650598 20:7862523-7862545 TGTTTTCACTTAACACCAAATGG - Intergenic
1169833978 20:9857218-9857240 TGTTTTTTGATATTACCCAAAGG + Intergenic
1178339680 21:31775331-31775353 TGTTTTCTGAAATGATCTAATGG - Intergenic
1183268749 22:36847575-36847597 TGTTTTTTCATGGCACCCAATGG + Intergenic
949121236 3:387209-387231 TGGTTTCTCAGATCCTCTAAAGG + Intronic
949802691 3:7920886-7920908 TGTCTTCTCATATCACAGGAGGG + Intergenic
950213582 3:11141648-11141670 TGGTCTCTTATATCACCTACTGG - Intronic
950339314 3:12228775-12228797 TGTGTTTTCATATCTCCTAAAGG + Intergenic
951124465 3:18967646-18967668 TGTTTCCTCATATCACTTTAGGG + Intergenic
952350866 3:32536055-32536077 TCTCTTCTCATGTCACCAAATGG - Intronic
952645688 3:35655714-35655736 AGTTTTCTTATGTCACCTCAAGG + Intronic
952916980 3:38253954-38253976 TGTCTACTCATAAAACCTAAAGG - Exonic
953233165 3:41082630-41082652 AGTTTTCTCATCTCAACAAAGGG - Intergenic
953560512 3:43987041-43987063 TGATTTCTTCTATCACCTATTGG + Intergenic
955207802 3:56912420-56912442 AGTTATCACATAGCACCTAATGG + Intronic
955391408 3:58524855-58524877 TGTTTGCTCAGATCACAGAAGGG - Intronic
955451973 3:59078349-59078371 TCTTTTCTCACATCACACAATGG + Intergenic
956812982 3:72882373-72882395 TGTTAACTCATATAATCTAAGGG - Intergenic
960408434 3:117291372-117291394 TGTTTTCTAATAACCCCTAGTGG - Intergenic
960578960 3:119257478-119257500 TGTTTGCTCATTGCTCCTAAAGG + Intergenic
960996817 3:123345639-123345661 TGTTTCCTCACATGTCCTAAGGG + Intronic
961183446 3:124894624-124894646 TGTTTTCTCATATCACCTAAAGG + Intronic
961267953 3:125662097-125662119 TGTTGTTTCATATCACAGAATGG - Intergenic
961268449 3:125668720-125668742 TGCTTTTTTATATCACCAAATGG - Intergenic
962089483 3:132228045-132228067 TTTTTTTTCATATCACATCAGGG - Intronic
966720814 3:183061268-183061290 AGTCTTCCCATTTCACCTAAGGG - Intronic
967463353 3:189773869-189773891 TGTGTTCTCTTACCTCCTAAGGG - Intronic
967542641 3:190685367-190685389 TGGTTTCTCACATCACATAAAGG - Intergenic
968274729 3:197431683-197431705 TAATTTCTCACATGACCTAATGG - Intergenic
971381958 4:26107327-26107349 TGTTTTCTCAAATCCTCTCAGGG + Intergenic
972050611 4:34728184-34728206 TGTTGACTCATAACACCTATGGG - Intergenic
972097804 4:35370135-35370157 TGTGTTCTCACATGACATAAGGG + Intergenic
974668733 4:65000703-65000725 TGTTTTATCATATGATTTAATGG - Intergenic
977121939 4:93113062-93113084 TATTTGCTCATAACAGCTAATGG - Intronic
977272999 4:94941119-94941141 TATTTTCTTTTATCACCTAAAGG - Intronic
977334948 4:95686257-95686279 TTTTTTATCTTATAACCTAATGG - Intergenic
977726900 4:100306445-100306467 TGTTTTCTCATATTTGCTAATGG - Intergenic
978545762 4:109871205-109871227 TGTTTTCTGACATTGCCTAATGG + Exonic
980596658 4:134963257-134963279 TGTATTCTCATGTGATCTAACGG + Intergenic
983549984 4:169008258-169008280 TGTTGTCTCATCTCTCCTGATGG - Intronic
984184086 4:176521156-176521178 CATTTTCTCATATCTCCTATTGG + Intergenic
984848981 4:184136635-184136657 TGTTTTCTCATATCATTTTGAGG + Intronic
985334931 4:188882406-188882428 TGTTTGCTCTAAGCACCTAATGG + Intergenic
986642288 5:9884003-9884025 TGTTTTCTCCTTTCCACTAAGGG - Intergenic
986715205 5:10518575-10518597 TGTTTTCTCACATAACCACAGGG - Intronic
987569737 5:19640927-19640949 TTTTTTCTCATTCCAGCTAAGGG - Intronic
988029875 5:25750506-25750528 TATTTTACCATATGACCTAATGG + Intergenic
988247223 5:28702266-28702288 TGTTTTCTCAAATCTCCTTTTGG + Intergenic
989691363 5:44148702-44148724 TGTTTTCTGATATAACTCAATGG - Intergenic
993346158 5:86785529-86785551 TGTTTTCTCATACATCCTAAAGG - Intergenic
994585390 5:101702341-101702363 ATTTTTCTCATATATCCTAAAGG + Intergenic
995152965 5:108872956-108872978 TGTTATATCATATCACCTGTTGG + Intronic
996530280 5:124521177-124521199 TGTTCTTTCAAATCACCCAATGG - Intergenic
997285901 5:132678272-132678294 TGTTCTCTAATACCACCGAAGGG + Intronic
997965857 5:138355425-138355447 TTTTTTCACATCTCACCTTAAGG - Intronic
999036495 5:148357337-148357359 TGTGTTCCTGTATCACCTAATGG - Intergenic
1004733170 6:18378594-18378616 AGTTTTATCATATCATTTAAGGG - Intergenic
1005108890 6:22256273-22256295 GTTCTTCTCATATAACCTAAAGG + Intergenic
1005355581 6:24980351-24980373 TATTTTCCCATATCACCAAGAGG + Intronic
1008498386 6:52155617-52155639 TGTTTTCTCATAACTCCAAGAGG + Intergenic
1009461010 6:63913123-63913145 CATTTTTTCATATCCCCTAAAGG + Intronic
1009534945 6:64870097-64870119 TGTTTTCTTAGATCACCGGATGG + Intronic
1012744834 6:103072731-103072753 TGTATTCTTATCTCACTTAAAGG - Intergenic
1013945782 6:115720503-115720525 TGTTTTCTCATAGCATCTTTAGG - Intergenic
1014208591 6:118684194-118684216 TGTTTTCTAATGTAACCTAGGGG - Intronic
1014844187 6:126256084-126256106 TGCTTTCTCACATGACCTACAGG + Intergenic
1015075554 6:129152343-129152365 TGTTTTATCATATCTACTAGAGG + Intronic
1016379995 6:143467482-143467504 TGTTTTCTCATAGCAGGAAATGG - Intronic
1016599266 6:145838357-145838379 TGTGTTCTCATATCAGGGAAGGG + Intergenic
1021091997 7:16495143-16495165 TGTTTGCTCATATTAGCTTATGG - Intronic
1021217219 7:17931706-17931728 TGTTTTCTCTGATTTCCTAAGGG - Intronic
1022609413 7:31854212-31854234 TGCTATCTAATATCACCTGAGGG - Intronic
1027635610 7:80669052-80669074 TTTTTTCTCATTTGTCCTAATGG - Intronic
1027888523 7:83939859-83939881 AATTTTATCATAACACCTAAGGG + Intergenic
1028238749 7:88393347-88393369 TCTTCTCTCACATCACCTATGGG - Intergenic
1028310609 7:89329150-89329172 TATTTTATCAAATCACCAAAAGG - Intronic
1028444192 7:90901016-90901038 TATTTTCCCTTATCTCCTAATGG + Intronic
1028632290 7:92948027-92948049 CCTTTTCTCATAGCACCAAATGG + Intergenic
1028833892 7:95352779-95352801 TGTTTTCTTCTATCAACAAAAGG + Intergenic
1029029700 7:97454593-97454615 CGTGTTCTCATATCACAGAAGGG - Intergenic
1031087797 7:117320906-117320928 TGCTTTCTAATATCACCAGAAGG - Intronic
1031334066 7:120504015-120504037 TTTATTCTTATATAACCTAAGGG - Intronic
1033110725 7:138572573-138572595 TGTTTTCTCATTCCTCCCAAAGG + Intronic
1034729466 7:153372674-153372696 TGTGTTCGCATATTACCTTAAGG + Intergenic
1036138864 8:6187841-6187863 TGTTTTCTCATATGTTCTAAAGG - Intergenic
1036600185 8:10253717-10253739 TATTTTCTCATATTACATTATGG - Intronic
1037559498 8:20060037-20060059 TGTTTTCTCCCTTCACCTAGAGG + Intergenic
1038216263 8:25564402-25564424 TGATCTCTGATGTCACCTAAAGG + Intergenic
1039196425 8:35036537-35036559 AGTTTTCCTGTATCACCTAAGGG + Intergenic
1039916508 8:41864316-41864338 AGTTTTCACATATAACCCAATGG - Intronic
1040127333 8:43752901-43752923 TTTTTTCTCATAGGACTTAAGGG - Intergenic
1041283266 8:56233091-56233113 TGTTTTCACAAATAAACTAAAGG + Intergenic
1041585720 8:59515640-59515662 TGTTTTCCCATAACACTTTATGG + Intergenic
1042208620 8:66354271-66354293 TGTTTTCTCAATTTTCCTAAGGG - Intergenic
1043882435 8:85560396-85560418 TATTTTATCATATCATCTATTGG + Intergenic
1044934531 8:97280029-97280051 TGTATTCTCAGATCAACTCATGG + Intergenic
1045314928 8:101035350-101035372 TGTATTCTTTTTTCACCTAAGGG + Intergenic
1047854860 8:128898576-128898598 TGTATTATCATATCATCCAAAGG + Intergenic
1048779126 8:137982017-137982039 TGTGTTCTCACATCAGCAAATGG - Intergenic
1052022444 9:23540799-23540821 TGTATTAACATACCACCTAAGGG - Intergenic
1054917357 9:70507549-70507571 TGTTTTTTCTTATCACCTACTGG + Intergenic
1055316390 9:75038576-75038598 TGTTTTCCCATACCACCTTGAGG + Intergenic
1055577315 9:77673194-77673216 AGTATTTTCATATCACCTATGGG - Intergenic
1056532677 9:87500637-87500659 TTCTTTCTCATAACACATAATGG - Intronic
1058158711 9:101544004-101544026 TGCTTTCTCATATCACCTCTTGG - Intronic
1059098644 9:111446954-111446976 TGTTTTCTCTTGTCGCCTAGCGG - Intronic
1060872476 9:127053932-127053954 TATTTTCTCATATCAACTCGGGG + Intronic
1186791768 X:13006617-13006639 TGTTTTCACATATCATTTAAGGG - Intergenic
1187638396 X:21259785-21259807 TGTTTTCTCATGCCATTTAAGGG + Intergenic
1188879026 X:35469370-35469392 TGTTTCCTCATAAAACCTATAGG - Intergenic
1192090334 X:68148382-68148404 TGTGTTATCATATCTCCTCAGGG + Intronic
1195533676 X:105986068-105986090 TGTTCTCAAATATCACCTCAGGG - Intergenic
1197710132 X:129660068-129660090 TGTGTCCTCATATGACATAAGGG - Intergenic
1198296075 X:135288032-135288054 TGTTATCTCATATCACTTAATGG - Intronic
1199312932 X:146342947-146342969 TATTTTCTCATATTTCGTAATGG - Intergenic