ID: 961183674 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:124896186-124896208 |
| Sequence | GGAAGCTGATGGAGGCCTCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 352 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 36, 4: 312} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 961183674_961183682 | 14 | Left | 961183674 | 3:124896186-124896208 | CCAAGAGGCCTCCATCAGCTTCC | 0: 1 1: 0 2: 3 3: 36 4: 312 |
||
| Right | 961183682 | 3:124896223-124896245 | CAATTATTTAATCATCAATCAGG | 0: 1 1: 0 2: 0 3: 17 4: 236 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 961183674 | Original CRISPR | GGAAGCTGATGGAGGCCTCT TGG (reversed) | Intronic | ||