ID: 961183674

View in Genome Browser
Species Human (GRCh38)
Location 3:124896186-124896208
Sequence GGAAGCTGATGGAGGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961183674_961183682 14 Left 961183674 3:124896186-124896208 CCAAGAGGCCTCCATCAGCTTCC 0: 1
1: 0
2: 3
3: 36
4: 312
Right 961183682 3:124896223-124896245 CAATTATTTAATCATCAATCAGG 0: 1
1: 0
2: 0
3: 17
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961183674 Original CRISPR GGAAGCTGATGGAGGCCTCT TGG (reversed) Intronic