ID: 961183682

View in Genome Browser
Species Human (GRCh38)
Location 3:124896223-124896245
Sequence CAATTATTTAATCATCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961183677_961183682 -7 Left 961183677 3:124896207-124896229 CCTAGCGAATCCACCCCAATTAT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 961183682 3:124896223-124896245 CAATTATTTAATCATCAATCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
961183674_961183682 14 Left 961183674 3:124896186-124896208 CCAAGAGGCCTCCATCAGCTTCC 0: 1
1: 0
2: 3
3: 36
4: 312
Right 961183682 3:124896223-124896245 CAATTATTTAATCATCAATCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
961183676_961183682 3 Left 961183676 3:124896197-124896219 CCATCAGCTTCCTAGCGAATCCA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 961183682 3:124896223-124896245 CAATTATTTAATCATCAATCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
961183675_961183682 6 Left 961183675 3:124896194-124896216 CCTCCATCAGCTTCCTAGCGAAT 0: 1
1: 0
2: 0
3: 10
4: 74
Right 961183682 3:124896223-124896245 CAATTATTTAATCATCAATCAGG 0: 1
1: 0
2: 0
3: 17
4: 236
961183673_961183682 15 Left 961183673 3:124896185-124896207 CCCAAGAGGCCTCCATCAGCTTC 0: 1
1: 0
2: 2
3: 29
4: 204
Right 961183682 3:124896223-124896245 CAATTATTTAATCATCAATCAGG 0: 1
1: 0
2: 0
3: 17
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961183682 Original CRISPR CAATTATTTAATCATCAATC AGG Intronic