ID: 961187248

View in Genome Browser
Species Human (GRCh38)
Location 3:124926467-124926489
Sequence CCCAATCTTTCATGTTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961187248_961187256 6 Left 961187248 3:124926467-124926489 CCCTCCAAACATGAAAGATTGGG 0: 1
1: 1
2: 1
3: 10
4: 141
Right 961187256 3:124926496-124926518 GGTCTTAGATACAGCCTCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 126
961187248_961187255 5 Left 961187248 3:124926467-124926489 CCCTCCAAACATGAAAGATTGGG 0: 1
1: 1
2: 1
3: 10
4: 141
Right 961187255 3:124926495-124926517 AGGTCTTAGATACAGCCTCTGGG 0: 1
1: 0
2: 0
3: 9
4: 125
961187248_961187254 4 Left 961187248 3:124926467-124926489 CCCTCCAAACATGAAAGATTGGG 0: 1
1: 1
2: 1
3: 10
4: 141
Right 961187254 3:124926494-124926516 GAGGTCTTAGATACAGCCTCTGG 0: 1
1: 0
2: 1
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961187248 Original CRISPR CCCAATCTTTCATGTTTGGA GGG (reversed) Intronic
904844953 1:33404020-33404042 CTAAATCTTTGATGTATGGATGG - Intronic
910361835 1:86420459-86420481 AACAATCTCTCATGTTTGTATGG - Intergenic
913675018 1:121132277-121132299 CTCAATTTTTAATGTTGGGAGGG + Intergenic
914026858 1:143919909-143919931 CTCAATTTTTAATGTTGGGAGGG + Intergenic
914665242 1:149827342-149827364 CTCAATTTTTAATGTTGGGAGGG + Intergenic
914670523 1:149866479-149866501 CTCAATTTTTAATGTTGGGAGGG - Intronic
916072165 1:161176783-161176805 CCCAATCTGTCCTGTTGGGGTGG - Intronic
917216954 1:172688992-172689014 CCCAAACCTTCATTTTTGAAGGG + Intergenic
919293661 1:195666496-195666518 GCCAATCATTCATTCTTGGAAGG - Intergenic
921201150 1:212807714-212807736 CCTTATCTTTCATTTTTGAAAGG + Exonic
924581702 1:245329523-245329545 CCCAACCCTCCATGTGTGGAAGG + Intronic
1062984227 10:1752490-1752512 CCCCATCCTTCCTGTGTGGATGG - Intergenic
1063903962 10:10764217-10764239 CCCAATAATTCATATTTGAAAGG + Intergenic
1064833281 10:19495406-19495428 CCCAATTTTTCTGGCTTGGAAGG - Intronic
1065185073 10:23163534-23163556 CCCAAACTCTCTTGTTTGGGTGG - Intergenic
1067156552 10:43785889-43785911 CCCAATTTTGGGTGTTTGGATGG + Intergenic
1077812188 11:5649342-5649364 CCCAAACTTTCATTTCTGAAGGG + Intergenic
1080893759 11:36431951-36431973 CTCAGTCTTTGATGTCTGGACGG + Intronic
1083136964 11:60688219-60688241 CCCAATCCTTCATCTTTACATGG - Intergenic
1085225952 11:74921351-74921373 CCCCATCTTTCATCTTTGCATGG - Intronic
1086331193 11:85755971-85755993 CCCAATCTTTTCTTTTGGGAGGG + Intronic
1087004133 11:93452428-93452450 GCAACACTTTCATGTTTGGATGG + Intergenic
1089191880 11:116659612-116659634 CCACATCTCGCATGTTTGGAAGG - Intergenic
1089803732 11:121063460-121063482 CCCAGTCTTGGATGTTTGGGTGG + Intronic
1094392731 12:29970260-29970282 CCAAATCATACATGATTGGATGG - Intergenic
1094623040 12:32098558-32098580 CTCAAAGTTTCATGTTTGGAAGG - Intergenic
1096339984 12:50789761-50789783 CCCAATCTTTTTTTTTTGGTGGG - Intronic
1097383360 12:58920920-58920942 ACCACTCTTTCATCTGTGGATGG - Intergenic
1099194071 12:79594296-79594318 CACCATATTTCAGGTTTGGAGGG - Intronic
1103060672 12:117855909-117855931 CCCATTTTTTCATGTTTGCTTGG + Intronic
1103420144 12:120774113-120774135 CCCAGACTTTCTTATTTGGAAGG - Intronic
1103691501 12:122778581-122778603 CCAAATCTGTCATTTTTGGTGGG + Intronic
1104732627 12:131116463-131116485 CCCAAACCCTGATGTTTGGAAGG + Intronic
1106167715 13:27263425-27263447 CCCAGTATTTCAGATTTGGAGGG - Intergenic
1106385219 13:29278002-29278024 CCCAATAAATCATGTTTGAATGG + Intronic
1106805560 13:33303000-33303022 TGAAATCATTCATGTTTGGAAGG + Intronic
1110833879 13:80062729-80062751 CCCAAACCTTCATTTTTGAAGGG + Intergenic
1111782501 13:92746087-92746109 CCCAATCTTACAGGTTTTGTTGG - Intronic
1113035944 13:106048980-106049002 GCCAATCTGGCAGGTTTGGAGGG - Intergenic
1113097706 13:106683490-106683512 CTGAATGTTTCCTGTTTGGATGG - Intergenic
1114299967 14:21366943-21366965 CCCATTCTTTTTTTTTTGGATGG + Intronic
1115032680 14:28815515-28815537 CCCACTTCTTCATTTTTGGAAGG + Intergenic
1117463701 14:55971846-55971868 CCCTCTCTTTCACTTTTGGAAGG - Intergenic
1120250539 14:82057805-82057827 TCCAAACTTTCATTCTTGGAGGG + Intergenic
1122503155 14:102214758-102214780 ACCAATATTTCATGTTAGGAAGG - Intronic
1124916486 15:33979617-33979639 CCAAATCTTTCATTTTTTAAAGG - Intronic
1128597774 15:68967276-68967298 CCCAATCTTTTCTGCTTGTACGG + Intronic
1135008009 16:18845190-18845212 CCCAATCTTTCATGTATGGAAGG - Intronic
1135061389 16:19274083-19274105 CCCAAACTTTCATTTCTGAAGGG + Intergenic
1140492830 16:75354192-75354214 GCCAAGCTTTGATGTTTGGTAGG + Intronic
1141525273 16:84607053-84607075 CCCCATCCTTCATGGTTAGATGG - Intronic
1147023440 17:37558897-37558919 CCAAATCCTTCATGTTAGAATGG - Intronic
1147144470 17:38477246-38477268 CCCAGGATTTCATGTATGGAGGG + Intronic
1149367469 17:55960147-55960169 CCCAATGGCTCATGTTGGGAAGG + Intergenic
1149650456 17:58273128-58273150 CCCAATCTTGCAAGTCTGAATGG - Intronic
1151180557 17:72324485-72324507 CTCCATCTTTCATGTTGGAATGG + Intergenic
1156716198 18:40013962-40013984 CCCAATCTATAATGTAAGGAAGG + Intergenic
1157572926 18:48724761-48724783 CACATTCATTCATGTCTGGAGGG + Intronic
1157813915 18:50717463-50717485 CCCACACTTCCATGTTGGGAAGG + Intronic
1158869923 18:61676343-61676365 CCCAGTCTTTGATAATTGGAGGG + Intergenic
1164238333 19:23359014-23359036 CCAAATTTTTCCTGTTTGTAGGG + Exonic
1164831438 19:31324516-31324538 CCCATTCTTTTGGGTTTGGAAGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
925540753 2:4964978-4965000 CACAATCTGTCATGTTTTTATGG - Intergenic
926510800 2:13775063-13775085 CCCAATCTTTTATACTTGTATGG + Intergenic
932936382 2:76107831-76107853 TCCATTCTTTCTTGTTTGAATGG + Intergenic
933271766 2:80240387-80240409 CTCAATCTTTAATGTTTCCACGG + Intronic
933757201 2:85649137-85649159 CCCAAGGCTTGATGTTTGGAAGG - Exonic
938976350 2:136481908-136481930 GCCAAAATTGCATGTTTGGAAGG + Intergenic
940096835 2:149986318-149986340 CCTAACCTTTCATCTTTGGTTGG - Intergenic
940471828 2:154111231-154111253 CCCAAACTTTCATTCTTGAAGGG + Intronic
947682890 2:232051925-232051947 TCCAATCTTTTATATTTGGGGGG - Intronic
1171177678 20:23065665-23065687 AACAATCCTTCATGTTTGGAGGG + Intergenic
1172347872 20:34218392-34218414 CCCAATCTCTCCTTTTTAGAAGG - Intronic
1173756432 20:45520863-45520885 CCCAAACTTTCATTCTTGAAGGG + Intergenic
1174178510 20:48659715-48659737 CCCAATCTCTTTTGTTAGGAGGG + Intronic
1174241983 20:49143822-49143844 CCCAATGTTTCTAATTTGGAAGG + Intronic
1176031135 20:63012634-63012656 TCCAGTCTTTTATGTTGGGAAGG - Intergenic
1178170487 21:30034693-30034715 CCCAACCTTTCATGTCTTTAGGG + Intergenic
1179458775 21:41519282-41519304 CACCATCTTTCATTGTTGGAGGG - Intronic
950624998 3:14238783-14238805 CCCAAACTTTCATTTTTGAAGGG - Intergenic
955288286 3:57666337-57666359 CCCATTCTGTCATGTTTTGGAGG + Intronic
956351379 3:68340762-68340784 CCCTGTCTTACATGTTGGGATGG + Intronic
961187248 3:124926467-124926489 CCCAATCTTTCATGTTTGGAGGG - Intronic
962124478 3:132601294-132601316 CCCAATCCTTTATGTTTTTATGG + Exonic
962708477 3:138067029-138067051 CCCAATCTTACTTGTGTGCAGGG - Intronic
969313156 4:6366086-6366108 ACCAATCTTAAATGTTTGAAGGG + Intronic
970164125 4:13218275-13218297 CCCAATCCTTAAGGTTTTGATGG - Intergenic
971004304 4:22356784-22356806 CCCACTCTTTCGTGGCTGGAAGG - Intronic
972700010 4:41485146-41485168 CCCCATGTTTCTTATTTGGATGG + Intronic
974664056 4:64935471-64935493 CCCAATCCTTTATATCTGGATGG + Intergenic
975316225 4:72956372-72956394 GCCTATCTTTCATGTTTTAAGGG - Intergenic
975764311 4:77651177-77651199 CTCAATCTTTTATCTTTGGAAGG + Intergenic
979752489 4:124296021-124296043 TCCAATTTTTCATTTTTGGATGG + Intergenic
980141766 4:128925761-128925783 CACTATGTTTCATTTTTGGATGG + Intronic
981129104 4:141138600-141138622 CCCAGTCTTCCATGTTTGTTTGG + Intronic
982549169 4:156775736-156775758 CCCAACCTTTCACATTTGAAGGG - Intronic
983230752 4:165126563-165126585 CCCAAACTTTCATTTCTGAAGGG - Intronic
984549344 4:181142295-181142317 TCCCATCTTTCATTTTTTGAAGG - Intergenic
984714448 4:182913637-182913659 CACAATCTTTCCCATTTGGATGG + Intronic
987216926 5:15747284-15747306 CCCAAGCTTTCATGGTGGTACGG + Intronic
989740245 5:44762438-44762460 CCAAATCTTTCATCATTGGCAGG + Intergenic
989785959 5:45329872-45329894 ACCAGTCTTTCATGGTTGTAAGG - Intronic
992354178 5:75963677-75963699 TCGAATCTTTCATATTTGAAAGG - Intergenic
997626838 5:135336867-135336889 CTCAATCTTCCATTTTTGGGGGG + Intronic
1000747611 5:165054347-165054369 CCCAGTGTTTCCTTTTTGGAGGG + Intergenic
1001269179 5:170298176-170298198 CCCAGTCTTTGATGGTGGGAGGG - Exonic
1002345655 5:178546180-178546202 CCCCATATTTCATGTGTGCATGG - Intronic
1007276173 6:40675567-40675589 CACAAGCCTTCAAGTTTGGAGGG - Intergenic
1007813489 6:44503417-44503439 CCCAATTGTTGATGATTGGAGGG - Intergenic
1009881642 6:69573863-69573885 CCCGCTCTTTCTTCTTTGGATGG + Intergenic
1013537220 6:111074399-111074421 CCCAATCTTACATTTTTTTATGG + Intergenic
1013893918 6:115062052-115062074 CTCAATCTGACATGTTAGGAAGG + Intergenic
1015930411 6:138353860-138353882 CCAAATCATTCATGTTTAGATGG + Intergenic
1015979387 6:138823643-138823665 CCCAATCCTTTATGTTTTTATGG + Intronic
1018286408 6:162243855-162243877 CACAGTCCTTCATGATTGGAAGG - Intronic
1018854427 6:167665429-167665451 CCCAATCACTCATGTTTGTGTGG - Intergenic
1020396921 7:7727027-7727049 CCCAAACTTTCATTATTGAAGGG - Intronic
1021062320 7:16129371-16129393 CCCAATTTTTTGTGTTTGGATGG + Intronic
1021291433 7:18850398-18850420 CCTACGCTTTCATTTTTGGAAGG - Intronic
1023369401 7:39497995-39498017 CCCATTTTCTCATGTTTGGTGGG + Intergenic
1024353074 7:48387441-48387463 GCCTATCTTTGATGTTTGCATGG - Intronic
1025870297 7:65425070-65425092 CCCAATCTTTCATGGCTTGTAGG - Intergenic
1028360396 7:89960685-89960707 CCCAATCTTTCATTTCTGGAGGG + Intergenic
1031447733 7:121874531-121874553 CCCAATTTTTCAATTTTAGATGG + Intronic
1033561200 7:142533276-142533298 CCAAATCTTTCTTTTTTGGGGGG + Intergenic
1033575773 7:142683008-142683030 CCTAATCCTTCATGTTTAAATGG + Intergenic
1036490131 8:9217522-9217544 GCCTCTCTTTCTTGTTTGGAGGG + Intergenic
1040674920 8:49736948-49736970 CCCATTCTATCAGGTGTGGAAGG - Intergenic
1041702087 8:60801945-60801967 CCCCCTCTTTCATGTTAGGATGG + Intronic
1042963913 8:74330639-74330661 CCTAATCCTTCATTTCTGGAAGG - Intronic
1044512521 8:93098781-93098803 GCCATTCTTTGTTGTTTGGATGG - Intergenic
1045845393 8:106629097-106629119 GACAATCTCTCAAGTTTGGAGGG - Intronic
1047691131 8:127355658-127355680 CCCAATCTCTTATATTTGTAAGG + Intergenic
1048523058 8:135174864-135174886 CCCAATCTCTAATATTAGGATGG - Intergenic
1051707873 9:19899529-19899551 CCCAAGCTTTCATGATGTGAGGG - Intergenic
1054837210 9:69689316-69689338 CCTCATCTTTCATTTTTGAATGG - Intergenic
1058506306 9:105669701-105669723 CCCAACCTGTCATGACTGGATGG - Intergenic
1058583519 9:106483511-106483533 CCCAATCTTTTCTGTTGAGATGG + Intergenic
1059196247 9:112374003-112374025 CCCAAACTTTCATTTCTGAAGGG + Intergenic
1060754925 9:126205812-126205834 CTCCATCTTTCAGGTCTGGAGGG - Intergenic
1061396352 9:130345959-130345981 CTCACTCTTTCATCCTTGGAAGG - Intronic
1185716448 X:2346606-2346628 CCCCATTTTTCCTGTTTGTAGGG + Intronic
1186370518 X:8942138-8942160 CACAATGTTTCATTTTTGGGGGG - Intergenic
1186506207 X:10094691-10094713 CCCAGTCTTACATGCTTGCAAGG - Intronic
1187016134 X:15330995-15331017 CCCAACCTTTGATGTTTTAATGG - Intronic
1191874524 X:65781869-65781891 CCACCTCTTTTATGTTTGGAAGG + Intergenic
1194115503 X:89891729-89891751 ACAAATCTGTCATGTTTGAATGG + Intergenic
1194213638 X:91100148-91100170 ACCCATCTTTCAAGTTTGTATGG + Intergenic
1194371356 X:93076864-93076886 CCCATTTTTTCATTTTTGGTTGG - Intergenic
1198412236 X:136382555-136382577 CCCAAGCCTTCATTTTTGAAGGG + Intronic
1199386438 X:147228676-147228698 CCCAAACTTTCATTTCTGAAGGG - Intergenic
1200468297 Y:3548863-3548885 ACAAATCTGTCATGTTTGAATGG + Intergenic
1201978395 Y:19879761-19879783 CCCATTCTTCCATTTTTGGGAGG - Intergenic