ID: 961187635

View in Genome Browser
Species Human (GRCh38)
Location 3:124929750-124929772
Sequence ACCAATACTCAGAAGGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961187627_961187635 29 Left 961187627 3:124929698-124929720 CCGACTGTACCTGTGAAGTAGAC 0: 1
1: 0
2: 0
3: 3
4: 105
Right 961187635 3:124929750-124929772 ACCAATACTCAGAAGGGTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 140
961187628_961187635 20 Left 961187628 3:124929707-124929729 CCTGTGAAGTAGACATAAGTGCC 0: 1
1: 0
2: 2
3: 11
4: 104
Right 961187635 3:124929750-124929772 ACCAATACTCAGAAGGGTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 140
961187630_961187635 -2 Left 961187630 3:124929729-124929751 CCACATTTGACAGAAGAGCCCAC 0: 1
1: 0
2: 4
3: 54
4: 606
Right 961187635 3:124929750-124929772 ACCAATACTCAGAAGGGTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 140
961187629_961187635 -1 Left 961187629 3:124929728-124929750 CCCACATTTGACAGAAGAGCCCA 0: 1
1: 0
2: 1
3: 20
4: 188
Right 961187635 3:124929750-124929772 ACCAATACTCAGAAGGGTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 140
961187626_961187635 30 Left 961187626 3:124929697-124929719 CCCGACTGTACCTGTGAAGTAGA 0: 1
1: 0
2: 0
3: 11
4: 99
Right 961187635 3:124929750-124929772 ACCAATACTCAGAAGGGTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961187635 Original CRISPR ACCAATACTCAGAAGGGTTA AGG Intronic
901164507 1:7208390-7208412 CCCAATACTCAATAGGGTAAAGG - Intronic
902989252 1:20174768-20174790 CCCAACACTCATAAGGGTCAGGG - Intronic
903671898 1:25040957-25040979 ACAAATGCTCAGAAAGCTTAAGG + Intergenic
905937106 1:41833478-41833500 AACAATGCTCAGAAAGGCTAAGG + Intronic
906843299 1:49162739-49162761 ACCAAAACTCAGAAAGGTTAAGG - Intronic
907744019 1:57194565-57194587 ACCAAGACTCAGAAAGGGAAAGG - Intronic
907756520 1:57315828-57315850 ACCAAGGCCCAGAAGGTTTAAGG - Intronic
909124969 1:71656315-71656337 ACCAAGGCTCAGAAATGTTAAGG - Intronic
912594206 1:110857928-110857950 ACCAATGCTCAGAATTTTTAAGG + Intergenic
920213147 1:204343421-204343443 ACCAAGGCTCAGAGAGGTTAAGG + Intronic
920432211 1:205926299-205926321 ACCAAGACTGGGAAAGGTTAAGG + Intronic
922516485 1:226211984-226212006 ACCGATGCTCAGAGAGGTTAAGG + Intergenic
923843549 1:237701685-237701707 GACAAGACTCAGAAGGGTGAGGG - Intronic
1068398137 10:56490845-56490867 CCTAAGACTCAGAAAGGTTAAGG + Intergenic
1069626938 10:69874030-69874052 ACTGATGCTCAGAAAGGTTAAGG + Intronic
1072640520 10:97207734-97207756 ACCACGGCTCAGAAAGGTTAGGG - Intronic
1072748270 10:97957522-97957544 ACCAAGGCTCAGCAAGGTTAGGG + Intronic
1074334260 10:112553317-112553339 ACTAAGACTCAGAAAGGCTAAGG - Intronic
1075258817 10:120945583-120945605 TCAAATACTCAGTAGGTTTATGG - Intergenic
1077267710 11:1660332-1660354 ACCAGCAATCAGAAGGGTAAAGG + Intergenic
1079805043 11:24920778-24920800 ATGAGTACTCAGAAGGGTTGTGG + Intronic
1079990583 11:27242229-27242251 GCCAATTCTCAGAAGGATGATGG + Intergenic
1080320166 11:30999076-30999098 GCCACTATTCAGAAGGGTCAAGG + Intronic
1080778338 11:35407250-35407272 AGCACTACTCAGAAGGGACAGGG - Intronic
1081663851 11:44904904-44904926 CCCAGCCCTCAGAAGGGTTAAGG - Intronic
1081721827 11:45294966-45294988 ACCACTATTTTGAAGGGTTAGGG + Intergenic
1081864712 11:46353198-46353220 ACCAAGGCTCAGAAAGGTCAGGG + Intronic
1082018170 11:47508450-47508472 ACCAATACACAAAAGGGTAAGGG + Intronic
1084180303 11:67442735-67442757 ACCGAGACCCAGGAGGGTTACGG - Intronic
1085354303 11:75821768-75821790 ACCAATACTCAAAACTGTCAAGG - Intronic
1085972243 11:81607144-81607166 ACCAATTCTCAAAAGAGATATGG + Intergenic
1087213466 11:95468627-95468649 ACTAATACTTAGAGGGATTAAGG + Intergenic
1091032551 11:132203971-132203993 ACCGATACTCAGAGGAGTCAAGG - Intronic
1091354012 11:134921817-134921839 ACCAAGGCTCAGAAGGGGTGAGG + Intergenic
1093081224 12:14813835-14813857 ATCAATTCTAAGAAGGATTAAGG - Intronic
1094575608 12:31682418-31682440 GCCACTACTCAGAAGGGGGAGGG + Intronic
1097514819 12:60591921-60591943 ACTAAAACTCAGAAAGATTAGGG + Intergenic
1098828263 12:75327242-75327264 ACCAAAACTCATAAAGGTTTGGG - Intronic
1105719262 13:23098055-23098077 TCCAAGACTCAGAAAGGTAAAGG - Intergenic
1106441033 13:29770584-29770606 ATCAATACTCAAAAGGGAAATGG + Intronic
1107583294 13:41815575-41815597 ACCAAAACCCAGAAGGGGCAAGG + Intronic
1108372722 13:49787012-49787034 ACTAATACAAAGAAGGGTGAAGG + Intronic
1110209475 13:72954600-72954622 TCCCATACTGAGTAGGGTTAAGG + Intronic
1110778847 13:79441248-79441270 GCAAATACTCAGAAGAGCTAAGG - Intergenic
1115328828 14:32171430-32171452 ACCAACACTGAGAAGGGGCAGGG + Intergenic
1115921464 14:38378826-38378848 ACATATACTAAAAAGGGTTAAGG - Intergenic
1121786603 14:96666202-96666224 CCCACCACTCAGAAGGGTAAAGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1127199590 15:56629583-56629605 ACCACTACTCAAAAGGTATATGG + Intergenic
1127658563 15:61078590-61078612 ACCAATGCTCAGAGAGGATAAGG + Intronic
1128025200 15:64430232-64430254 GCCATTACTCAGGAGGGTTGAGG - Intronic
1129258476 15:74348172-74348194 ACTGAGACTCAGAGGGGTTAAGG - Intronic
1129675776 15:77631990-77632012 ACCAATACTCAGAATGGGAGGGG + Intronic
1135904166 16:26495500-26495522 ACAGAGACTCAGAAGGGTGAAGG + Intergenic
1136955261 16:34777094-34777116 ACAAATACACAGAAGAGTTAGGG + Intergenic
1137575800 16:49599450-49599472 ACCAAGACTCAGAGAGGTTAAGG + Intronic
1143556267 17:7663047-7663069 ACCAAAACTCAGAAATATTATGG - Intronic
1144722631 17:17482649-17482671 ACCAAAACTCAGAAGCCATAAGG - Intronic
1147756848 17:42774144-42774166 ACAAATAGTCAAAAGGGTTTAGG - Intronic
1150501283 17:65653320-65653342 ACCAATACATAGGAGGATTAAGG + Intronic
1150625713 17:66839897-66839919 AGCAAGGCCCAGAAGGGTTAAGG + Intronic
1151219397 17:72601110-72601132 ACAAACACTCAGAAGGGTGAAGG - Intergenic
1152612885 17:81324211-81324233 TCCAACACTCAGAAGAGCTAAGG + Intronic
1154461521 18:14594038-14594060 ACCTATGCTCAGTAGTGTTATGG - Intergenic
1166520720 19:43478498-43478520 ACCAAGACTCAGAGAAGTTAAGG + Intronic
927400055 2:22700644-22700666 ACCTATACTCATATTGGTTATGG + Intergenic
928021749 2:27710804-27710826 ACTAAGACTCAGAAAGGTTAAGG + Intronic
930472117 2:51829960-51829982 AACAATTCTCAGAATGGTGATGG + Intergenic
932753497 2:74388253-74388275 ACCTATACTCAGGAGGCTGAGGG + Intronic
933526549 2:83447609-83447631 ACCAAAACTCATAAGTGGTAAGG + Intergenic
936727454 2:115337559-115337581 ACTAATACCCAGTAGGGTTTGGG + Intronic
937750799 2:125474480-125474502 ACCAAATCTCAGAGAGGTTAAGG - Intergenic
939791075 2:146578105-146578127 ACCAATACGCAGATGGATGAAGG + Intergenic
943924284 2:193752004-193752026 ATGAAAACTCAGAAGGGTGAGGG - Intergenic
944866023 2:203863034-203863056 AGAAATATTAAGAAGGGTTAGGG + Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
946157225 2:217814939-217814961 ACCAATACTTAGAAGTGTCCTGG + Exonic
1168924796 20:1570639-1570661 ACCACTACTTAGAAGGTTCAAGG - Intronic
1169091231 20:2862498-2862520 ACCACAACCCAGAATGGTTAGGG + Intronic
1169976480 20:11334587-11334609 ACAAAAACTCAGAGGGTTTAAGG - Intergenic
1173356511 20:42297261-42297283 ACCAATACTCAGAGGACATAAGG + Intronic
1173765432 20:45604410-45604432 ATCAATACTCACCAGGGATATGG + Intergenic
1174379342 20:50146673-50146695 ACCAAGGCTCAGAAGGGGAACGG + Intronic
1176728659 21:10467165-10467187 ACCAAGACTCTGAAAGGTTGAGG - Intergenic
1177114502 21:17069482-17069504 GCCAATCTTCAGAAGGATTAGGG + Intergenic
1177645705 21:23897978-23898000 ACTAATACTCAGAAAGCTCAAGG + Intergenic
1179245312 21:39628402-39628424 ACAAAGACTCGGAAGGGTGAGGG - Intronic
1180685895 22:17666495-17666517 ACCAGAACTAAGAAGGGTAATGG - Intronic
1180754881 22:18154559-18154581 CCAAATACTGAGAAGGGTGAAGG - Intronic
1182104064 22:27676470-27676492 ACCAATACTAAGCCGGGTGAAGG - Intergenic
949937416 3:9126758-9126780 ACAGAGACTCAGAAGGGTGAGGG + Intronic
950437567 3:12989722-12989744 ACCAGCACTCAGGAGGGTTGAGG - Intronic
951785524 3:26414429-26414451 GACAATACTCAGTAGGTTTATGG - Intergenic
952007261 3:28856204-28856226 ACCAGTACTCTGAAGATTTAGGG + Intergenic
957677763 3:83392838-83392860 TCCAACATTGAGAAGGGTTAAGG - Intergenic
959983459 3:112545777-112545799 AGTAATACTCTAAAGGGTTATGG + Intronic
961187635 3:124929750-124929772 ACCAATACTCAGAAGGGTTAAGG + Intronic
963945908 3:151145425-151145447 TCTGATACTCAGAAGGGTCAGGG - Intronic
971245036 4:24919730-24919752 ACTAATTCACAGAAAGGTTAAGG - Intronic
972071064 4:35019860-35019882 GTCAATACTCAGAACAGTTATGG + Intergenic
972602819 4:40587666-40587688 ACCAAGGCTCAGGAGGGTTAAGG - Intronic
974144408 4:57928914-57928936 ACTAATGCTTAGAAAGGTTATGG - Intergenic
974903843 4:68033242-68033264 ATCAATACTCACAACAGTTATGG - Intergenic
981231947 4:142367012-142367034 ACCCCTACTGGGAAGGGTTAAGG + Intronic
986298570 5:6460151-6460173 AGCCACACTCAGAAGGGGTAAGG - Intronic
989194899 5:38707198-38707220 ACCTGTACCAAGAAGGGTTAAGG - Intergenic
989231949 5:39096926-39096948 TCCAATACTAAGAAAGGTTAGGG + Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989688830 5:44117801-44117823 ATCAATACTCACAACAGTTATGG + Intergenic
990072268 5:51797825-51797847 ATGAATATTCAGAAGGGTGATGG - Intergenic
995155251 5:108903538-108903560 AAGAAAACTCAGAAAGGTTAAGG - Intronic
997729599 5:136157936-136157958 ACTAAATCTCAGAAAGGTTAAGG - Intronic
999110770 5:149119257-149119279 ACATATACTGAGAATGGTTAAGG - Intergenic
1004693757 6:18015010-18015032 ACCAATACTGACAATAGTTATGG - Intergenic
1004973935 6:20943844-20943866 CCCAGTACTCAGAAGGCTTAAGG + Intronic
1006206573 6:32349037-32349059 ACAAAATCTCAGCAGGGTTAGGG + Intronic
1006742740 6:36321032-36321054 ACCGAGACTCAGAGAGGTTAAGG + Intronic
1007543702 6:42674297-42674319 AATTATACTCAGAAGGGGTAAGG - Intronic
1008072493 6:47111982-47112004 ACACATGCTCAGCAGGGTTAGGG + Intergenic
1008421235 6:51301480-51301502 ACTAATGCTCAGAAGGTTTAGGG - Intergenic
1008848894 6:56000270-56000292 ACCAATACTGAGTAGAGTTTGGG + Intergenic
1009960298 6:70512291-70512313 ATCTTTACTCAGAAGAGTTAAGG - Intronic
1013990420 6:116248660-116248682 ACCACTACTCACAGGGATTATGG + Exonic
1014159746 6:118154234-118154256 ACCAAAACTTAGAGTGGTTAAGG - Intronic
1014725517 6:124967247-124967269 GCCAATACTTAGGAGGGTTAAGG - Intronic
1014980384 6:127939244-127939266 ACCCATTCTCAGAAGAGTTAAGG - Intergenic
1015876268 6:137825913-137825935 ACCAACACTCAAAAGGCTGAGGG + Intergenic
1016031484 6:139343222-139343244 GCCAGCACTCAGTAGGGTTAAGG - Intergenic
1017684175 6:156895407-156895429 ACCAGAACTCAGAAGAGCTATGG + Intronic
1022516094 7:30975848-30975870 ACCAATACTGAGACTGGGTATGG - Exonic
1027451558 7:78337227-78337249 ACCAGAACTCAGAAGGTTTCTGG + Intronic
1028235414 7:88355300-88355322 AACAATACTCAGAAGGATAAAGG + Intergenic
1030355086 7:108532773-108532795 ACTAATACTCATAAGGTTTGTGG + Intronic
1030783371 7:113628479-113628501 TCCAAGACTCAGAAGATTTAGGG - Intergenic
1035422678 7:158742384-158742406 AGGAATACGCAGAAGTGTTATGG - Intronic
1036130655 8:6106558-6106580 ACCAATACTAAGAAAGTTTTTGG + Intergenic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1042502424 8:69523854-69523876 ACCAGTACTCATAAGGGCTAGGG + Intronic
1043692155 8:83168261-83168283 ACAGTAACTCAGAAGGGTTAAGG - Intergenic
1048569974 8:135644119-135644141 TCAAATACTCAGAATGGTTATGG + Intronic
1049969246 9:807242-807264 ACCAAGGCACAGAAGGGTTAAGG + Intergenic
1051197935 9:14584190-14584212 ACCAAGGCTCAAAGGGGTTATGG - Intergenic
1051534614 9:18142878-18142900 ACAAATTCTCAGAAAGTTTAGGG - Intergenic
1053059857 9:35022428-35022450 ATCAATACCCACAACGGTTATGG + Intergenic
1053256564 9:36621339-36621361 ACCAATACTCGGAACACTTAGGG - Intronic
1057548362 9:96034681-96034703 ACCCAAACTCAGAAGGGGCAGGG - Intergenic
1058350146 9:104011566-104011588 ACCAAAAGTCAGAAGGGGAAAGG + Intergenic
1058801453 9:108548305-108548327 ACTAAAACTCAGAAGGATGAAGG - Intergenic
1058970411 9:110077180-110077202 ACCAAGGCTCAGAGAGGTTAAGG - Intronic
1192338113 X:70238772-70238794 ACCAAGGCTCAGAATGGTTAAGG - Intronic
1192379333 X:70599372-70599394 ACTCATACTCAGAAGGGTAGAGG + Intronic
1193300648 X:79885182-79885204 TCCAATTCTGGGAAGGGTTAAGG - Intergenic
1193418960 X:81260315-81260337 ACAAATGCTCAGATGGATTAAGG - Intronic
1194924142 X:99804211-99804233 GCTAATACTCAGCAAGGTTAGGG - Intergenic
1195916009 X:109936020-109936042 ACTGAGACTCAGAAAGGTTAAGG - Intergenic
1196742058 X:119033784-119033806 ACCAAGGCTCAGAGAGGTTAAGG + Intergenic
1197688884 X:129475912-129475934 ACCAAAACTCACAAAGATTATGG + Intronic
1201473471 Y:14357631-14357653 ATCAATACTCACAACAGTTATGG + Intergenic