ID: 961187740

View in Genome Browser
Species Human (GRCh38)
Location 3:124930717-124930739
Sequence AAGCAGTTATAGGTGTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961187740 Original CRISPR AAGCAGTTATAGGTGTGCCC TGG (reversed) Intronic
900177767 1:1298359-1298381 AAGAAGCTCAAGGTGTGCCCTGG - Exonic
900348802 1:2225099-2225121 AAGTAGCCATAGGTGTGCCATGG - Intergenic
903514835 1:23903186-23903208 AAGCAGTTATTGCTGCGGCCAGG - Intronic
915106609 1:153538596-153538618 AAGCAGGTATGGGCGTCCCCAGG - Intronic
915730851 1:158053135-158053157 ATGCAGTTATAGGTGTGATATGG - Intronic
916821813 1:168406296-168406318 AAGCAGTAATTGGTGGACCCTGG + Intergenic
918740867 1:188128757-188128779 AAGCACTCAGAGGTGTGCCTAGG - Intergenic
921047512 1:211487993-211488015 AAGCAGTGCAGGGTGTGCCCAGG + Intronic
923512431 1:234664062-234664084 AAGCAGATAAAGGTGTTTCCTGG + Intergenic
1071071813 10:81702962-81702984 ACGTAGTTATATGTGTGCCATGG - Intergenic
1072851171 10:98893742-98893764 AGGCAGTTAGAGATGTTCCCAGG - Intronic
1075433850 10:122416590-122416612 AAGCTGTTATGGGTTAGCCCAGG + Intronic
1076380949 10:130024120-130024142 AGGCAGCTATAAGTGTGCCGGGG - Intergenic
1076803184 10:132842033-132842055 AAAGAGTGAAAGGTGTGCCCAGG - Intronic
1079934758 11:26603130-26603152 AATCAGTTTTATGTTTGCCCAGG - Intronic
1083728750 11:64642278-64642300 AAGCAGGTTTAGGTGAGGCCAGG + Intronic
1084725355 11:70938258-70938280 AAGGGGTTAAAGTTGTGCCCAGG - Intronic
1090415073 11:126535015-126535037 CAGCAGTGACAGGTGTGGCCTGG + Intronic
1091132881 11:133161125-133161147 ACACAGTCAAAGGTGTGCCCTGG - Intronic
1091231705 11:133991890-133991912 ACGCAGGTAAAGGTGTGCCATGG - Intergenic
1096226036 12:49867494-49867516 AAGGAGCCATAGGTGTGCCCGGG + Exonic
1105957553 13:25298891-25298913 AAACAGTTATAGATGTGGCTGGG + Intergenic
1109417698 13:62064515-62064537 ACACAGGTATACGTGTGCCCTGG - Intergenic
1117999574 14:61510613-61510635 AAGCAGTTAGAGATGCGGCCTGG + Intronic
1121855431 14:97265248-97265270 AAAAAGTTATACGTGTGTCCTGG - Intergenic
1128826694 15:70724669-70724691 AGGCAATTATAAGTGTGCCTTGG - Intronic
1129475786 15:75783815-75783837 AAACAGTCATAGGGCTGCCCTGG - Intergenic
1129728894 15:77918274-77918296 AAACAGTCATAGGGCTGCCCTGG + Intergenic
1130259444 15:82344110-82344132 AAACAGTCATAGGACTGCCCCGG + Intronic
1130269234 15:82435058-82435080 AAACAGTCATAGGACTGCCCCGG - Intronic
1130281822 15:82525075-82525097 AAACAGTCATAGGACTGCCCCGG - Intergenic
1130473189 15:84241238-84241260 AAACAGTCATAGGACTGCCCCGG - Intronic
1130480604 15:84355303-84355325 AAACAGTCATAGGACTGCCCCGG - Intergenic
1130484799 15:84392739-84392761 AAACAGTCATAGGACTGCCCTGG - Intergenic
1130491108 15:84432456-84432478 AAACAGTCATAGGACTGCCCCGG + Intergenic
1130502692 15:84511256-84511278 AAACAGTCATAGGACTGCCCCGG + Intergenic
1130595474 15:85245828-85245850 AAACAGTCATAGGACTGCCCCGG - Intergenic
1130735001 15:86538793-86538815 AATCAGGAATAGGTGAGCCCTGG + Intronic
1131188110 15:90292590-90292612 AAACAGTCATAGGACTGCCCTGG - Intronic
1131317521 15:91352991-91353013 AAGCAATTATTGCTATGCCCAGG + Intergenic
1137553315 16:49455050-49455072 AAGCAGTTGTTGGGGTCCCCTGG - Intergenic
1138446851 16:57070047-57070069 CAGCAGTTCTGGGTGTGGCCTGG + Intronic
1139321330 16:66116847-66116869 AAGGAGTGATTGATGTGCCCTGG - Intergenic
1140604409 16:76517223-76517245 AAGCGGTTTTAGCTGTGCGCGGG + Intronic
1146618554 17:34377101-34377123 AGGCAGTGACAGTTGTGCCCTGG + Intergenic
1153621800 18:6986056-6986078 AAGCAATTAAAAGTGAGCCCTGG - Intronic
1158265432 18:55656283-55656305 AAGCAGTTCTAGGTGTTCAAAGG - Intronic
1158696432 18:59708170-59708192 AAGCAGTTATAGGAGTTCAAAGG + Intergenic
1160612818 18:80101739-80101761 AAGAAGTTATGGGTCTCCCCTGG - Intergenic
1162237148 19:9318360-9318382 AAGCAGTTGTGGGTGTTCCTTGG - Intergenic
1165283330 19:34816306-34816328 CAGCAGTAACAGGTTTGCCCAGG - Intergenic
1166205470 19:41265978-41266000 AAGCAGTTATTTGTGTACCCAGG + Intronic
929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG + Intronic
933151464 2:78920020-78920042 AAGCAGGTCTAGGTGTGCAGAGG + Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937868904 2:126773697-126773719 TAGCTGCTATATGTGTGCCCTGG + Intergenic
940445341 2:153770894-153770916 AAGCACCTAGAGGTGTGCCTAGG + Intergenic
945535421 2:211011674-211011696 AGGCACTTACAGGTGTGCTCTGG - Intergenic
1180743729 22:18072473-18072495 AACCAGTAATGGGTGTGCACTGG - Intergenic
1183029926 22:35096044-35096066 CAGCAGTTTTAGGCGTGTCCAGG + Intergenic
952834159 3:37590024-37590046 TAACAGGTAGAGGTGTGCCCTGG + Intronic
959838796 3:110950715-110950737 AAGCAGTTGAAGCTGTGACCTGG + Intergenic
961187740 3:124930717-124930739 AAGCAGTTATAGGTGTGCCCTGG - Intronic
967376450 3:188808727-188808749 ACACAGGTATATGTGTGCCCTGG + Intronic
969871429 4:10107360-10107382 AAGCAGTTATCGCTCTTCCCAGG - Intronic
970959545 4:21856641-21856663 GGGCAGCTGTAGGTGTGCCCGGG - Intronic
971945927 4:33277559-33277581 AAGCAGTTATGGGCCTGGCCCGG + Intergenic
972136001 4:35894977-35894999 AACCAGTTATTGGTGTGTTCAGG - Intergenic
976224001 4:82780950-82780972 CAACAGTTAGAGGTGGGCCCTGG + Intronic
980103430 4:128564519-128564541 AAGCACTTATAGATTTGCCATGG + Intergenic
985856001 5:2427990-2428012 AAGCAGTCATCTGTGTGGCCTGG + Intergenic
987625798 5:20398760-20398782 ACGTAGGTATACGTGTGCCCTGG - Intronic
1006776641 6:36597988-36598010 AAGAAATTATAGCTGTGGCCAGG - Intronic
1010911731 6:81566589-81566611 AAGCATTTTTTTGTGTGCCCAGG + Intronic
1021710849 7:23414210-23414232 AAGCACTTATGGGTGGGCACTGG - Intronic
1033104676 7:138510349-138510371 CAGCAGTTATATGTATGCACTGG + Intronic
1036701911 8:11018553-11018575 AAGAAGTTTTTGGTGTCCCCAGG + Intronic
1042580516 8:70273138-70273160 AAAAAATTATAGGTGTGCCTTGG - Intronic
1044859548 8:96509255-96509277 AAGCAGTAATAAGAGTGCGCAGG + Intronic
1045195962 8:99930818-99930840 AAGCAGATATATGTGTGCCATGG + Intergenic
1052802682 9:32984729-32984751 AAGGAGTTCAAGGTGTTCCCTGG + Exonic
1055332162 9:75196028-75196050 AGGCACTGATAGGTGTGCACAGG - Intergenic
1057753014 9:97807579-97807601 AAGCAGTTCTACATGAGCCCTGG + Intergenic
1060980179 9:127786952-127786974 AGGCAGTTATGGGTGAGGCCAGG + Intronic
1062124435 9:134851632-134851654 ATGGAGTTACAGGTGTGCACAGG + Intergenic
1187065506 X:15833338-15833360 AAGCAGTAAAAGGTGTGTCAGGG - Intronic
1188805977 X:34590478-34590500 AAGCACCTAGAGGTGTGCCTAGG + Intergenic
1192762120 X:74104690-74104712 AAGCACTTAGAGCTGTGCCTGGG - Intergenic
1193108590 X:77704985-77705007 GGGCAGCTATAGCTGTGCCCAGG + Intronic
1194174381 X:90628896-90628918 AGGCAGTTTTAGCTGTGCCCAGG - Intergenic
1194230006 X:91310010-91310032 AAGCAGTTAAAGATGTGTTCTGG + Intergenic
1196357885 X:114815333-114815355 AAGCAGTTTTAGTTGTGGCCTGG - Intronic
1200520600 Y:4206589-4206611 AGGCAGTTTTAGCTGTGCCCAGG - Intergenic