ID: 961188780

View in Genome Browser
Species Human (GRCh38)
Location 3:124939823-124939845
Sequence TGATTTAGGAGGAGACTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961188772_961188780 10 Left 961188772 3:124939790-124939812 CCAGAACAAGTCTGGTGTGTTTG 0: 1
1: 0
2: 0
3: 11
4: 146
Right 961188780 3:124939823-124939845 TGATTTAGGAGGAGACTGGGGGG 0: 1
1: 0
2: 0
3: 17
4: 281
961188771_961188780 17 Left 961188771 3:124939783-124939805 CCTGAGGCCAGAACAAGTCTGGT 0: 1
1: 0
2: 2
3: 20
4: 221
Right 961188780 3:124939823-124939845 TGATTTAGGAGGAGACTGGGGGG 0: 1
1: 0
2: 0
3: 17
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961188780 Original CRISPR TGATTTAGGAGGAGACTGGG GGG Intronic
900727046 1:4223497-4223519 TTATTTAGGAATAGAATGGGAGG + Intergenic
900906737 1:5564608-5564630 TGACGGAGGAGGAGACAGGGAGG + Intergenic
902042083 1:13499930-13499952 TTATTTAGGAATAGAATGGGAGG - Intronic
902276621 1:15344674-15344696 TGATTTACTAGTAAACTGGGTGG + Intronic
902935396 1:19761329-19761351 TGATTTAGAAGGAGGCCGTGAGG - Intronic
903394323 1:22987858-22987880 TTATTTAGGAATAGAATGGGAGG - Intergenic
903396395 1:23004765-23004787 TCATTTAGGAATAGAATGGGAGG - Intergenic
903972080 1:27125562-27125584 TGGTGTAGGAAGAGCCTGGGGGG - Intronic
905451559 1:38060243-38060265 TGGTCTTGGAGGAGCCTGGGTGG + Intergenic
906105434 1:43289132-43289154 TGAAGTGGGAGGAGTCTGGGAGG + Intergenic
907808011 1:57840863-57840885 AGATTTAGGAGGGGCCAGGGTGG - Intronic
908072317 1:60475204-60475226 TGTTTTAGGAAGAGTCAGGGAGG - Intergenic
908715855 1:67068469-67068491 AGATTTGGGAGGAGCCAGGGTGG + Intergenic
909260415 1:73481745-73481767 TGGTTTAGGATGAGTTTGGGGGG - Intergenic
910653046 1:89590609-89590631 AGATTTGGAAGGAGACTGGTGGG + Intronic
912562953 1:110563432-110563454 TCATGGAGGAGGAGACTGTGTGG + Intergenic
912580240 1:110714529-110714551 TGATTTTGGGGGAGTGTGGGGGG - Intergenic
912696666 1:111847309-111847331 TGATTGAGGAGGAGGGAGGGAGG + Intronic
915646882 1:157278933-157278955 AGTTTTAGGAGTAGACTGAGAGG + Intergenic
918170857 1:181996059-181996081 AGCTTTAGGAGAAGACTGAGAGG - Intergenic
918245088 1:182652038-182652060 TGAATGAGGAGGAGAATGAGGGG + Intronic
919978943 1:202630486-202630508 AGGTTTAGGAGGAGATGGGGTGG + Intronic
920803382 1:209209915-209209937 TGAGTAAGGAAGGGACTGGGTGG + Intergenic
921763288 1:218941274-218941296 AGATTTGGGAGGGGACGGGGTGG + Intergenic
923536084 1:234852969-234852991 TTATTTAGGAATAGAATGGGAGG + Intergenic
924444782 1:244119073-244119095 CCATTTAGGAGCAGAATGGGAGG + Intergenic
1063167602 10:3478274-3478296 TAAATTTGGAGGAGGCTGGGAGG + Intergenic
1064138171 10:12768266-12768288 TTATTTAGGAGTAAAATGGGAGG + Intronic
1064302627 10:14136255-14136277 ATATTTAGGAGTAAACTGGGAGG - Intronic
1064321006 10:14304667-14304689 TGATTGAGGAGGAGATCTGGTGG - Intronic
1068494932 10:57775873-57775895 TGTTGTAGGAGGAGCCTGGTGGG - Intergenic
1069068924 10:63974426-63974448 TGATGTTGGAGGAGACTAGCAGG + Intergenic
1069427427 10:68301190-68301212 TGATTTAACAAGAGAATGGGCGG - Intronic
1069543494 10:69313014-69313036 TGAGTAAGGAGGAGGCTGGCAGG + Intronic
1069799233 10:71071983-71072005 TGATCTGGGAGGAGAGTGGCTGG + Intergenic
1070351545 10:75597452-75597474 TGAGCCAGGAGGGGACTGGGAGG + Intronic
1071417663 10:85456207-85456229 TTATTTGGGATGAGGCTGGGGGG + Intergenic
1072989295 10:100175612-100175634 TGATTTGGTAGGAGACTGACAGG - Intronic
1073500101 10:103929130-103929152 TTATTGAGGAGTAGAATGGGAGG + Intergenic
1075161788 10:120030828-120030850 TGATATTGGGGGAAACTGGGTGG - Intergenic
1078051512 11:7968968-7968990 TTATTTAGGAATAGAGTGGGAGG + Intergenic
1079991020 11:27247096-27247118 TTATTTATGAGGATACTGGAAGG + Intergenic
1082063552 11:47880832-47880854 TGGCTAAGGAAGAGACTGGGAGG - Intergenic
1086186280 11:84020957-84020979 TGATTTAGGAAGAAAGTGTGTGG - Intronic
1090025437 11:123163588-123163610 TGATTTAGTAGGGATCTGGGTGG - Intronic
1090405373 11:126473160-126473182 TGGATTAGGAGGGGACTAGGAGG - Intronic
1094415092 12:30207761-30207783 GGATTTAGGAGCAGACTGTCAGG - Intergenic
1095299059 12:40561093-40561115 TGAGTTAGGAGGAGAGGGGTAGG + Intronic
1097062910 12:56299556-56299578 TTATATAGGAGGAGCTTGGGTGG - Intronic
1098486084 12:71023566-71023588 TTATTTAGGAGTAAAATGGGAGG + Intergenic
1098566290 12:71940672-71940694 TTATTTAGGAATAGAATGGGAGG - Intronic
1100830016 12:98509058-98509080 TTTTTTAGGAGTAGAATGGGAGG - Intergenic
1101866614 12:108525010-108525032 GGACTTAGCAGGAGACTGAGGGG + Intronic
1104011881 12:124936812-124936834 TCATTTAGGAGGAGCCAGGGTGG - Intergenic
1104569741 12:129914756-129914778 TGATGGAGGAGGAGCCTGGCTGG - Intergenic
1105812906 13:24010491-24010513 TTATTTAGGAATAGAATGGGAGG + Intronic
1106425258 13:29622789-29622811 TGTTTTAGGAGGAAAAGGGGAGG + Intergenic
1107938243 13:45363021-45363043 TGATTGGGGTGGAGACAGGGAGG - Intergenic
1109085955 13:57972081-57972103 GGATTTGGGAGGAGCCAGGGAGG - Intergenic
1109590961 13:64481036-64481058 GGATAAGGGAGGAGACTGGGAGG - Intergenic
1110666435 13:78122881-78122903 TTATTTAGGAGTAGAATGGGAGG + Intergenic
1112222159 13:97502009-97502031 CTACTTAGGAGAAGACTGGGGGG - Intergenic
1112679226 13:101742749-101742771 TTATTTAGGAATAGAATGGGAGG - Intronic
1113421258 13:110173329-110173351 TGACTTGGGGGGACACTGGGAGG - Intronic
1113521878 13:110947228-110947250 TGCTTTAAGAGGGGACAGGGAGG + Intergenic
1113706015 13:112433471-112433493 TGCTTTAAGAGGGGACAGGGAGG - Intronic
1116133432 14:40890563-40890585 AGATTTAGGAGGAGCCGAGGTGG - Intergenic
1116793392 14:49363884-49363906 AGATTTAGGGGGAGGATGGGGGG - Intergenic
1117243830 14:53863488-53863510 TCTTTGAGGAGGAGACTGGTAGG - Intergenic
1117321987 14:54633350-54633372 TGAGTGAGGAGGAGACTGCAGGG + Intronic
1117635574 14:57739657-57739679 AGATTTAGGAGGAGACAGTGTGG + Intronic
1118485991 14:66214980-66215002 AAATTTAGGAGGGGACAGGGTGG - Intergenic
1118533101 14:66728864-66728886 AGATTTAGGAGGGGTCGGGGTGG + Intronic
1118656404 14:67954677-67954699 GGATTTAGGAGATGAATGGGAGG + Intronic
1118751895 14:68813762-68813784 TGATTCTGGAGGAGAATGGATGG + Intergenic
1118997510 14:70850102-70850124 TGAGCAAGGAGGAGACTCGGAGG + Intergenic
1119607501 14:76033333-76033355 TGATGTAGCAGGATACTGGAGGG + Intronic
1120128553 14:80777219-80777241 TGATTTGGGAGGTGATTGGGAGG + Intronic
1120152807 14:81055952-81055974 AGATTTGGGAGGAGCCAGGGTGG + Intronic
1122546836 14:102527808-102527830 TGATGAAGGAGGAGCCTGAGGGG + Intergenic
1122773778 14:104108372-104108394 TGAGTCAGGAGGAGACGAGGGGG - Intronic
1124494540 15:30178374-30178396 AGGTTTAGGAGGAGATGGGGTGG + Intergenic
1124749030 15:32360271-32360293 AGGTTTAGGAGGAGATGGGGTGG - Intergenic
1126166798 15:45660304-45660326 TGATTTGAGAGGAAACTAGGGGG + Intronic
1127102118 15:55576969-55576991 TTATTTAGGAATAGAATGGGAGG - Intronic
1127901417 15:63343876-63343898 TTATTTAGGAATAGAATGGGAGG - Intronic
1129624199 15:77179578-77179600 TGTTTCTGGAGGAGACTGTGGGG + Exonic
1129731266 15:77934039-77934061 TGTTTGGGGAGGTGACTGGGTGG + Intergenic
1130346151 15:83047414-83047436 TGAATTAGGGGGAGAATGGTAGG + Intronic
1131055121 15:89370457-89370479 TGATGAAGGAGGAGTCTGTGCGG + Intergenic
1131828337 15:96337487-96337509 TGACTGAGGAGGAGACGGTGCGG - Exonic
1132800403 16:1749419-1749441 TGACTTTGGAGGAGGTTGGGAGG + Intronic
1132929091 16:2449508-2449530 TGACATAGGAGGAGGCTGTGGGG + Intronic
1133106919 16:3517665-3517687 TGATTAAGGGGGTGACTGGCAGG - Intronic
1133602820 16:7356489-7356511 TGATGGAGGAGGAGCCTGGCAGG + Intronic
1133701114 16:8309985-8310007 TGACTTCTGAGGACACTGGGTGG - Intergenic
1133943553 16:10329920-10329942 ACATGTAGGTGGAGACTGGGGGG - Intronic
1134523351 16:14928231-14928253 TGCTTAGTGAGGAGACTGGGGGG + Intronic
1134880864 16:17744808-17744830 TGAGTTAGGAGGAGGCAGGGAGG + Intergenic
1137567029 16:49539726-49539748 TTGCTTAGGAGGAGTCTGGGAGG + Intronic
1137613502 16:49834488-49834510 AGATTTAGGGGAAGAATGGGTGG + Intronic
1139760755 16:69182964-69182986 TGATTTAGGAGAGGGCTGGAGGG + Intronic
1139773970 16:69301959-69301981 TGCTTGAGGAGTAGACTTGGTGG + Exonic
1140093948 16:71859616-71859638 TGATCTAGGAGAAACCTGGGTGG - Intronic
1147619885 17:41858872-41858894 TCATTTAAGAGGAGGCTGGTGGG - Intronic
1149043337 17:52216651-52216673 TGATGGAGGAAGAGACTGGTTGG - Intergenic
1149254335 17:54807835-54807857 TTATTTAGGAGTAAAATGGGAGG - Intergenic
1149968152 17:61188876-61188898 TGAGGTGGGAGGAGCCTGGGAGG + Intronic
1150156993 17:62861986-62862008 TTAGATAGAAGGAGACTGGGGGG + Intergenic
1150864595 17:68836341-68836363 TGATTTAGGAAGAGATGGGCAGG - Intergenic
1151476899 17:74349278-74349300 AGATTGATGAGCAGACTGGGCGG + Exonic
1152335976 17:79700466-79700488 TTTTTCAGGAGGAGACTGGCTGG - Intergenic
1153263011 18:3242180-3242202 AGATTTAGGAGGGGCCAGGGTGG + Intergenic
1153944075 18:10003518-10003540 TGGCTTGGGAGGAGACTGGCAGG - Intergenic
1157188334 18:45559623-45559645 ATATTTTGGAGGAGAGTGGGAGG - Intronic
1158449068 18:57547284-57547306 TGATTTGGGAGGGGCCAGGGTGG + Intergenic
1158759510 18:60368038-60368060 GGATTTAGTAGGAGAGAGGGAGG + Intergenic
1158937246 18:62375957-62375979 TGACTTAAGAGGAGACAGTGCGG - Intronic
1159696617 18:71565659-71565681 TGTTTGAGGAGGGGACTGGCAGG - Intergenic
1159698827 18:71597183-71597205 TGATTTGGAATGAGACTGGAAGG + Intergenic
1160757811 19:766811-766833 AAATTTAGGATGAGACGGGGAGG - Intergenic
1162180815 19:8867532-8867554 TGAATGGGGAGGAGAATGGGGGG + Intronic
1163822663 19:19505197-19505219 TGATTGAGGAGTAGTGTGGGTGG + Intronic
1164479831 19:28602776-28602798 CGATTTAGGAGGAGAAGGGGTGG - Intergenic
1165412398 19:35670212-35670234 TGAGTGAGGAGGAGGTTGGGGGG + Intronic
1166164839 19:40980127-40980149 AGATTTAGGAGGGGTCGGGGTGG - Intergenic
1166296692 19:41893379-41893401 TGAGGGAGGAGGAGGCTGGGGGG + Intronic
1166540402 19:43601480-43601502 TGACTTATGGGGAGACTGGTTGG + Intronic
1166907723 19:46124839-46124861 TCTTTAAGGAGGAGACTGGGTGG + Intergenic
1166921153 19:46230025-46230047 ACATTTAGAAGAAGACTGGGTGG - Intronic
1167668981 19:50838944-50838966 TGAGGGAGGAGGAGGCTGGGGGG + Intergenic
1168519189 19:57035149-57035171 TGATTGAGAAGGAGAAGGGGAGG + Intergenic
926283575 2:11469695-11469717 TTATTTAGGAACAGAATGGGAGG - Intergenic
927164241 2:20300742-20300764 TTATTTAGGAATAGAATGGGAGG - Intronic
928103000 2:28450292-28450314 TAACTGAGTAGGAGACTGGGAGG + Intergenic
932569249 2:72929352-72929374 TGAAAGAGGAGGAGACAGGGAGG + Intronic
932896432 2:75645265-75645287 TCATCCAGGAGGAGACAGGGAGG + Intergenic
933539506 2:83620342-83620364 TGTTTTAGGAGGGGCCTGGTGGG - Intergenic
933628716 2:84632350-84632372 TGGCTGAGGAGGAGAGTGGGGGG - Intronic
934534036 2:95118148-95118170 TGATTTTTGAGGAGACTGAAGGG - Intronic
937638183 2:124180772-124180794 TTATTTGGGGGGAGATTGGGGGG - Intronic
938686736 2:133745504-133745526 TGATTTAGGGAGACACTGTGAGG + Intergenic
940814873 2:158287263-158287285 AGATTTGGGAGGGGACAGGGTGG - Intronic
943112705 2:183625347-183625369 TGATAGAGGAGGGGACTGGTGGG + Intergenic
945709953 2:213283458-213283480 TACTTGAGGAGGAGAGTGGGAGG + Intergenic
947054268 2:226083606-226083628 TGATTTGGGAGGGGCCAGGGTGG - Intergenic
948574939 2:238943854-238943876 TGACTTTGGTGGAGACTGGCAGG - Intergenic
1171332532 20:24353491-24353513 TGAGGTGGGAGGAGCCTGGGAGG - Intergenic
1172052873 20:32132534-32132556 TGAGCGAGGAGGAGAGTGGGAGG + Intronic
1172372292 20:34403925-34403947 TGTTTTAGTAGGAGGCTGGAAGG + Intronic
1173009551 20:39169425-39169447 TCATTCAGCATGAGACTGGGTGG - Intergenic
1173260450 20:41430380-41430402 TCAATTAGGAGGACACTGGAGGG - Intronic
1174761290 20:53209633-53209655 TGATTTGGAAGTAGAATGGGAGG - Intronic
1175472198 20:59238353-59238375 TGATTCCAGAGGAAACTGGGGGG - Intronic
1175568278 20:59998279-59998301 TGAGCTTGGAGGAGACTGGCAGG + Intronic
1177156945 21:17510376-17510398 GGATTTAGGAGGAGGAGGGGGGG - Intergenic
1177529350 21:22340198-22340220 AGATTTGGAAGGAGACAGGGTGG - Intergenic
1178448260 21:32665286-32665308 TTATTTAGGAGTAAAATGGGAGG - Intronic
1178681874 21:34679448-34679470 AGATTTGGGAGGGGCCTGGGTGG - Intronic
1179452512 21:41475558-41475580 TGAGTGAGGAGGTGACGGGGTGG + Intronic
1179668382 21:42928136-42928158 TTATTTAGGAGTAGAATGGGAGG + Intergenic
1179958071 21:44752102-44752124 TGAGGGAGGAGGAGGCTGGGAGG - Intergenic
1183077281 22:35435164-35435186 GGAATGAGGAGGAGGCTGGGAGG + Intergenic
1184049384 22:41992948-41992970 TGATTTAGCACCTGACTGGGTGG + Intronic
1184792249 22:46707427-46707449 GGAGTTGGGAGGAGACTGAGTGG - Intronic
950141814 3:10620921-10620943 TGAGTGAGGAGGACACAGGGAGG - Intronic
950514620 3:13456365-13456387 TTATTTAGGAATAGAATGGGAGG + Intergenic
951348404 3:21574669-21574691 GGATTTAGGGGGTAACTGGGTGG + Intronic
953858821 3:46524387-46524409 TAATTAAGGAGGAGGTTGGGGGG + Intronic
953885563 3:46712744-46712766 GGATGTCGGGGGAGACTGGGAGG - Intronic
954286189 3:49621057-49621079 TGACTTAGGATGAGACAGGAAGG + Intronic
954802299 3:53194277-53194299 TGCTTCAGGAGGACGCTGGGAGG - Intergenic
955319262 3:57962493-57962515 TCATTGAGTAGGAGGCTGGGAGG + Intergenic
960196669 3:114776996-114777018 TGATTTAGGGGGAAAATGGCTGG - Intronic
960681033 3:120247703-120247725 ATACTTAGGAGAAGACTGGGGGG - Intronic
961188780 3:124939823-124939845 TGATTTAGGAGGAGACTGGGGGG + Intronic
962180455 3:133200642-133200664 TGATATAAGAGCAGATTGGGTGG - Intronic
963564679 3:146913894-146913916 AGATTTAAGAGGAGTCTGTGAGG + Intergenic
963638004 3:147823734-147823756 TGAAATAGGAGGAGACTGCAAGG - Intergenic
963890665 3:150632746-150632768 TGAATGAGGAGGAGGTTGGGTGG - Intergenic
963957036 3:151265524-151265546 TGATTTGAGAGGAGATAGGGAGG - Intronic
967162895 3:186754927-186754949 TTATTTAGGAATAGAATGGGAGG - Intergenic
967457335 3:189703334-189703356 TGAGGCAGGAGGAGACTGGGAGG + Intronic
968516702 4:1018559-1018581 TGCTGGAGGAGGAGGCTGGGGGG + Intronic
968928336 4:3562016-3562038 TTATTCAGGAGTGGACTGGGAGG + Intergenic
969655330 4:8494175-8494197 TTATTTAGGAATAGAATGGGAGG - Intergenic
970039275 4:11777796-11777818 TCATTTAGGAGGAAATTAGGTGG + Intergenic
970092050 4:12420885-12420907 TTATTTAGGAATAGAATGGGAGG - Intergenic
971372366 4:26029131-26029153 AGATTCAGGAGTAGAGTGGGAGG - Intergenic
971484726 4:27147558-27147580 TGTTATGGGAGGAGACTGGTGGG - Intergenic
972102073 4:35432483-35432505 AGATTTGGGAGGAGCCAGGGTGG + Intergenic
972275735 4:37555918-37555940 TGTTTAAGGAGGAGACTCAGGGG - Intronic
973911682 4:55588164-55588186 TTATTTAGGAGTAAAATGGGAGG - Intronic
974931001 4:68361036-68361058 TTATTTAGGAATAGAATGGGAGG - Intergenic
977435569 4:96990121-96990143 TGACATAGGAGGAAACTGGTGGG + Intergenic
977868324 4:102058164-102058186 TTATTTACTAGGAGACTGGCTGG - Intronic
981688466 4:147481012-147481034 AGCTTTGGGAGGAGACGGGGAGG + Exonic
985080904 4:186262889-186262911 TTATTTAGGAATAGAATGGGAGG - Intergenic
985155871 4:186986847-186986869 AGATTTGGGAGGAGCTTGGGTGG - Intergenic
985897922 5:2760268-2760290 TGATCTGGGTGGAGCCTGGGTGG - Intergenic
986220185 5:5761962-5761984 TTATTTAGGAGTAGAATGGGAGG - Intergenic
986516076 5:8565220-8565242 TGATTTAGGAGCAGCATGGTAGG + Intergenic
986601658 5:9478865-9478887 AGATTTAGGAGGGGCCAGGGTGG + Intronic
986676377 5:10189187-10189209 TGACCTGGGAGTAGACTGGGGGG - Intergenic
987842313 5:23237351-23237373 TGGTTTAGGAGGACACTCTGTGG - Intergenic
989204669 5:38798721-38798743 TGTTTTAGGAATAGAATGGGAGG + Intergenic
989267027 5:39486670-39486692 TGTTTTAGGTTGAGAGTGGGTGG - Intergenic
989793680 5:45439826-45439848 TGATATTGAAGGAGACTGGCAGG + Intronic
990700267 5:58467341-58467363 TTATTTAGGAGTAAAATGGGAGG - Intergenic
994535427 5:101024665-101024687 AGATTTAGGAGGGGCCAGGGTGG - Intergenic
994723831 5:103411486-103411508 TGGTGTAGGAGAAGACTGAGTGG + Intergenic
995434839 5:112123788-112123810 TGACTTAGGAGAAGGCTGGTGGG - Intergenic
995801455 5:116000704-116000726 TGATACAGGAAAAGACTGGGAGG + Intronic
998697511 5:144657017-144657039 TGGTTTAGGTGGAGAGTGGCAGG + Intergenic
999674284 5:153983354-153983376 GATTTAAGGAGGAGACTGGGTGG - Intergenic
1003314211 6:4997237-4997259 TGTTTCTGGAGGAGACTGGCAGG + Intronic
1003747423 6:9018296-9018318 TGAGTTGAGATGAGACTGGGTGG + Intergenic
1004543590 6:16574686-16574708 TAATATAGGGGGAAACTGGGTGG - Intronic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005641069 6:27796877-27796899 TTATTTAGGAGTAAAATGGGAGG - Intergenic
1006202745 6:32311284-32311306 AGATTTAGGGAGAGATTGGGTGG - Intronic
1006341415 6:33449126-33449148 AGAGTCAGGAGGAGGCTGGGAGG - Intronic
1006617364 6:35339639-35339661 TGATTTTGGAGGAGGCTAGAGGG + Intergenic
1006719450 6:36140695-36140717 ACCTATAGGAGGAGACTGGGGGG + Intronic
1008247950 6:49202376-49202398 TTATTTAGGAACAAACTGGGAGG + Intergenic
1009909962 6:69913856-69913878 TGCTTTAGGATCAGCCTGGGAGG - Intronic
1009950111 6:70385799-70385821 TGAGTTAGGAGGAGTCTCAGTGG + Intergenic
1010055239 6:71557023-71557045 AGATTTGGGAGGGGACGGGGTGG + Intergenic
1010111878 6:72246294-72246316 TGATTTTGGAAGTGAATGGGTGG + Intronic
1012887389 6:104860953-104860975 TGATTTAGGACGGCACTGGCAGG - Intergenic
1013336897 6:109172663-109172685 TGCTTTAGGAGGAAATTTGGAGG - Intergenic
1015134677 6:129854118-129854140 TTATTTAAGAAGGGACTGGGAGG + Intronic
1017128939 6:151091470-151091492 TGATGCAGGAGGAGAGTGTGCGG + Intronic
1018242072 6:161787575-161787597 TGAATTAGTAGCAGATTGGGAGG - Intronic
1018417954 6:163617643-163617665 TGATGGAGGTGGAGACTGGAGGG + Intergenic
1019233331 6:170586699-170586721 TTATTTAGGAATAGAATGGGAGG + Intergenic
1022195192 7:28058470-28058492 TGAACTTGTAGGAGACTGGGGGG - Intronic
1022370279 7:29764799-29764821 AGGGTTAGGAGGAGAGTGGGGGG - Intergenic
1023137952 7:37072259-37072281 TGTTGTAGGAGGAGCCTGGTGGG + Intronic
1024483760 7:49893167-49893189 GAATTTTGGTGGAGACTGGGTGG + Intronic
1024902501 7:54336465-54336487 GTATTTAGGATGAGACTGGAAGG - Intergenic
1026145916 7:67746671-67746693 TGATTTCAGAGGAGACCGGCAGG + Intergenic
1026401309 7:70016414-70016436 TGGTTTAGGAGGAGATTTGGGGG + Intronic
1028333588 7:89625248-89625270 TGTTTTAGCATGAGACTAGGGGG - Intergenic
1028419581 7:90617736-90617758 GGATTTAGGTGGGGAGTGGGTGG + Intronic
1029957226 7:104652659-104652681 AGATTGAGGAGGAGGCTTGGAGG + Intronic
1030423299 7:109337624-109337646 AGATTTAGGAGAATACTGGTGGG + Intergenic
1032435540 7:131897555-131897577 TGATGGATGAGGTGACTGGGAGG + Intergenic
1034157087 7:148964724-148964746 TGTTTTAGGAGGAAACAGGGAGG + Intergenic
1034198523 7:149266198-149266220 TGAGTTAGCAGCAGACTGGGGGG - Intronic
1034349986 7:150409276-150409298 TGCTTTAGGAGGAGAATCAGAGG + Intronic
1034477343 7:151293293-151293315 TCATTTAGGAGTAGAATGGCTGG - Intergenic
1035000827 7:155610994-155611016 GGATGTAGCAGGAGAGTGGGAGG - Intergenic
1035369940 7:158373059-158373081 TGATTTAAGAGGCCGCTGGGTGG - Intronic
1035993735 8:4522099-4522121 TGTTGTGGGAGGAGCCTGGGGGG + Intronic
1036708583 8:11062802-11062824 TGATTGCCGAGGAGGCTGGGAGG - Intronic
1036736760 8:11325893-11325915 TGATTTTTGAGAAGACTTGGGGG + Exonic
1039987159 8:42457356-42457378 AGATTGATGAGGAGAGTGGGAGG - Intronic
1040763568 8:50879034-50879056 AGATTTAGGAGGGGCCAGGGCGG + Intergenic
1044470734 8:92563475-92563497 TGTTTTATGAGTAGACTTGGAGG + Intergenic
1049085966 8:140478889-140478911 TGTTGTAGGAGGAAACTGGTGGG - Intergenic
1050983772 9:12055305-12055327 TTATTTAGGAATAGAATGGGAGG + Intergenic
1051877371 9:21806506-21806528 TGCTGTAGGAGCAGAGTGGGTGG + Intronic
1053531530 9:38886865-38886887 TGACTTTGGAGTAGACTGTGTGG + Intergenic
1053803220 9:41777158-41777180 TTATTCAGGAGTGGACTGGGAGG + Intergenic
1054142042 9:61537966-61537988 TTATTCAGGAGTGGACTGGGAGG - Intergenic
1054191513 9:61988468-61988490 TTATTCAGGAGTGGACTGGGAGG + Intergenic
1054203754 9:62111293-62111315 TGACTTTGGAGTAGACTGTGTGG + Intergenic
1054461801 9:65469144-65469166 TTATTCAGGAGTGGACTGGGAGG - Intergenic
1054634608 9:67477072-67477094 TGACTTTGGAGTAGACTGTGTGG - Intergenic
1054646857 9:67599244-67599266 TTATTCAGGAGTGGACTGGGAGG - Intergenic
1055019627 9:71655898-71655920 TTTTTTAGGAGTAGAATGGGAGG - Intergenic
1057503862 9:95616909-95616931 TTATTTAGGAATAGAATGGGAGG - Intergenic
1059128785 9:111722096-111722118 TTTTTTGGGAGGAGACTGAGTGG + Intronic
1059421711 9:114196401-114196423 TCATGTAGGAGGAGGCTGAGGGG - Intronic
1059709581 9:116855255-116855277 TGAATTTGGAGCAGGCTGGGTGG - Intronic
1060656621 9:125376558-125376580 TGATTCAGGAGGAGAAGGGGTGG + Intergenic
1062228817 9:135469646-135469668 CTATTTAGGAAGACACTGGGAGG - Intergenic
1187550212 X:20295095-20295117 TGAAATGGGAGCAGACTGGGCGG - Intergenic
1188369231 X:29348582-29348604 TGATTTAGGAGGGGAGAGAGGGG + Intronic
1189085143 X:38014942-38014964 TTATTTAGGAATAGAATGGGAGG + Intronic
1192057709 X:67788998-67789020 TGATTTAGAAGGAAGCTGGGAGG + Intergenic
1192083075 X:68066962-68066984 TGAATCAGGATGAGACAGGGAGG + Intronic
1193172589 X:78353532-78353554 TCATTTAGTTGGAGACTGGGTGG + Intergenic
1193639890 X:84000337-84000359 TTATTTAGGAATAGAGTGGGAGG + Intergenic
1194216494 X:91135465-91135487 AGATTTGGGAGGAGCCAGGGTGG + Intergenic
1194234315 X:91363026-91363048 TTATTTAGGAATAGAATGGGAGG + Intergenic
1194541035 X:95172668-95172690 TTACTTAGGAATAGACTGGGAGG - Intergenic
1194943492 X:100041086-100041108 AGATTTAGGAAGAGCTTGGGTGG - Intergenic
1195438528 X:104874179-104874201 TGATTTAGAAGCAGAGTTGGGGG - Intronic
1195647800 X:107252432-107252454 TTATTTAGGAATAGAATGGGAGG - Intergenic
1196069605 X:111506157-111506179 AGATTGAGGAGGACAATGGGAGG + Intergenic
1197881742 X:131173786-131173808 TGATTAAGGGGGAAATTGGGAGG + Intergenic
1199119187 X:144030393-144030415 AGATTTAGGAGAAGCCTAGGTGG + Intergenic
1199160775 X:144608395-144608417 TTATTTAGGAATAGAATGGGAGG + Intergenic
1199373641 X:147082258-147082280 TGTTGGAGGAGGAGACTGGTGGG + Intergenic
1199746863 X:150777304-150777326 TTATTTAGGAGTAGAATGGGAGG + Intronic
1200285043 X:154812941-154812963 TTATTTAGGAATAGAATGGGAGG + Intronic
1201061388 Y:10049731-10049753 AGATTTAGGGGGAGAGTAGGTGG + Intergenic