ID: 961192116

View in Genome Browser
Species Human (GRCh38)
Location 3:124970674-124970696
Sequence CTTTCATCACTGATGAAAGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961192113_961192116 16 Left 961192113 3:124970635-124970657 CCCTCTCTCTCCTGGACTTAAAA 0: 1
1: 0
2: 2
3: 41
4: 389
Right 961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG 0: 1
1: 0
2: 0
3: 16
4: 240
961192114_961192116 15 Left 961192114 3:124970636-124970658 CCTCTCTCTCCTGGACTTAAAAG 0: 1
1: 1
2: 6
3: 88
4: 846
Right 961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG 0: 1
1: 0
2: 0
3: 16
4: 240
961192115_961192116 6 Left 961192115 3:124970645-124970667 CCTGGACTTAAAAGTAGTCTCTT 0: 1
1: 0
2: 2
3: 8
4: 135
Right 961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG 0: 1
1: 0
2: 0
3: 16
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961192116 Original CRISPR CTTTCATCACTGATGAAAGA CGG Exonic
902667368 1:17948889-17948911 CATTCATCAGTGATGCAGGAAGG + Intergenic
908572972 1:65428400-65428422 CCTTTCTCACTGTTGAAAGAAGG + Intronic
908626644 1:66051938-66051960 CTTTCATAGCTGATGAAGGTTGG + Intronic
909139821 1:71849222-71849244 CATTCATGATTCATGAAAGAAGG + Intronic
910145544 1:84077034-84077056 TTTTCATTACTGACAAAAGATGG - Intergenic
910285492 1:85549669-85549691 CTTCCATCAGTGATGAAGAAAGG + Intronic
910520095 1:88110997-88111019 CTTACATCACAGTTGTAAGAGGG - Intergenic
913967635 1:143390517-143390539 CTTCCATCATTGTTGAGAGATGG + Intergenic
914062009 1:144216107-144216129 CTTCCATCATTGTTGAGAGATGG + Intergenic
914117141 1:144750247-144750269 CTTCCATCATTGTTGAGAGATGG - Intergenic
915284530 1:154844324-154844346 TTTTCATGTCTAATGAAAGAAGG - Intronic
917101034 1:171445547-171445569 CTTTAATCAATGAAGAAAGAAGG + Intergenic
917108554 1:171520433-171520455 ATATAATCACTGATGAAAGTGGG - Intronic
917778276 1:178362249-178362271 CTTAAATCCCTGATAAAAGAGGG - Intronic
919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG + Intronic
919924218 1:202184058-202184080 TTTTGATAAGTGATGAAAGAGGG + Intergenic
923132201 1:231086218-231086240 CTTTTATAACTGATTAAAGTAGG + Intergenic
924458672 1:244238822-244238844 CTTTCTTCACTAATGGAAGAAGG - Intergenic
924870638 1:248040310-248040332 CTTTTATCTCTGAGGAGAGAAGG + Intronic
924902692 1:248418396-248418418 ATTTCATTGCTGATGAAAGTGGG - Intergenic
1068013389 10:51482788-51482810 GTTTCATCATTCATGAAATAGGG + Intronic
1068810602 10:61251598-61251620 CTTTCCTCACCAATGAAAGAGGG + Intergenic
1069656634 10:70094610-70094632 AATTCGTCACTGATGAAAGCAGG + Intronic
1072759704 10:98046395-98046417 CTTTCCTCACTCATAAAAGGAGG - Intergenic
1073853250 10:107645518-107645540 ACTCCATCATTGATGAAAGATGG - Intergenic
1074692889 10:116022555-116022577 CTCTTATCACTGATGGAAAATGG - Intergenic
1075898266 10:126017246-126017268 CTGTCTTCACTGTTGAAAAAAGG + Exonic
1077581068 11:3417707-3417729 CTTTCCTGACTGATGCAGGATGG - Intergenic
1077760307 11:5088365-5088387 GTTTCTTCACAGGTGAAAGAGGG - Intergenic
1078428468 11:11269700-11269722 CTTTCATTACTCATAACAGAGGG + Intergenic
1078846610 11:15124381-15124403 TTCTCATCACCAATGAAAGAGGG - Intronic
1081959268 11:47122325-47122347 TTTTCATCATGGATGAAACAAGG + Intronic
1084941742 11:72616824-72616846 GTGTCCTCACTCATGAAAGAAGG - Intronic
1085363353 11:75913583-75913605 CTATCATCCCTGATGCATGAAGG - Intronic
1086013380 11:82133379-82133401 CTTACATAACCGATGTAAGATGG - Intergenic
1087221283 11:95549201-95549223 CTTTGGTACCTGATGAAAGATGG + Intergenic
1087329372 11:96760573-96760595 TTTTCCTCACTTATGAAAAAGGG + Intergenic
1089442183 11:118527013-118527035 CATACATCACTGATGAATAAAGG - Intergenic
1089656480 11:119950663-119950685 CTTTCATCAGAGATGGCAGAAGG + Intergenic
1091266158 11:134272650-134272672 GTTTCCTCACTGATAAAGGAGGG + Intergenic
1091381644 12:66099-66121 GTTTCGTCACGGATGAAGGAAGG + Intergenic
1091635702 12:2194867-2194889 ATTTCATCACTGTTGAAAATAGG + Intronic
1094698574 12:32846118-32846140 CTTTCATATGTAATGAAAGAGGG + Intronic
1095271351 12:40223755-40223777 ATTTCCTCACTAGTGAAAGAAGG + Intronic
1096255926 12:50062448-50062470 GGTTCTTCACTGAGGAAAGAAGG + Intronic
1097312732 12:58138642-58138664 CTTTCACCATTGTTGAAAGTGGG + Intergenic
1100783290 12:98052357-98052379 ATTTCATTAAGGATGAAAGAAGG + Intergenic
1101138653 12:101772194-101772216 CTTTCATCACTCAGGAAAAGGGG + Intronic
1101370866 12:104129026-104129048 CTTATATCACTTATGGAAGATGG - Intronic
1105942856 13:25165624-25165646 ATCTCATCACTGAGGAAAGCTGG - Intronic
1106911216 13:34465406-34465428 CTTTCATAAATAATGAAAGAAGG - Intergenic
1107297521 13:38926741-38926763 CTTTCCTCAGTGAGGAAATAAGG + Intergenic
1107384031 13:39888976-39888998 CTTTCATCTCTGAAGGTAGAGGG + Intergenic
1108035098 13:46282849-46282871 TTTTCATCACACATGACAGAAGG - Intergenic
1110583278 13:77157871-77157893 CTTTCTTCATTTCTGAAAGAGGG - Intronic
1111227807 13:85297748-85297770 CTTTCATCATTGATTAAAGCAGG - Intergenic
1112569374 13:100580005-100580027 CCTTCAGCGCTGAGGAAAGAGGG + Intronic
1112672556 13:101657350-101657372 ATATCATCATTGATTAAAGAGGG - Intronic
1113122604 13:106940604-106940626 CTTTCCTAACTGATGAGAAAGGG - Intergenic
1113178093 13:107589899-107589921 CTGACATCTCAGATGAAAGATGG + Intronic
1114241071 14:20868847-20868869 CTTTCTACACTGTGGAAAGAAGG - Intergenic
1114341672 14:21752056-21752078 CTTTCAGCACTGATGATACTGGG + Intergenic
1116472209 14:45298517-45298539 TTTTCATCTCTGATAAAAAAGGG + Intergenic
1116487375 14:45466873-45466895 CTTTGAATACTGATAAAAGAAGG + Intergenic
1116766629 14:49079866-49079888 ATATCATTACTGAAGAAAGATGG + Intergenic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1119405966 14:74399891-74399913 ATGGCATCCCTGATGAAAGAGGG + Intergenic
1120028856 14:79616832-79616854 CTTTCCTCATCTATGAAAGAAGG - Intronic
1125020652 15:34983018-34983040 CTTTTACCACAGAGGAAAGATGG - Exonic
1126587899 15:50307827-50307849 TTTCCAGAACTGATGAAAGATGG - Intronic
1127780338 15:62307611-62307633 CTTCCAACACTCCTGAAAGATGG + Intergenic
1127830417 15:62745308-62745330 CTTTGATCACTAAAAAAAGATGG + Intronic
1131307722 15:91259986-91260008 CGTTCGTCACTGATGAGATAAGG - Intronic
1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG + Intergenic
1133957151 16:10454023-10454045 CTTGCAAAACTGATAAAAGATGG - Intronic
1134350501 16:13433501-13433523 CTTTCTTCACCCATGAAATAAGG - Intergenic
1135715621 16:24763638-24763660 ATTTCATGAATGATGAATGAAGG - Intronic
1137364197 16:47846505-47846527 TTTTCATTTCTGATGACAGATGG - Intergenic
1138108065 16:54301320-54301342 CTGTCATCAGTGATTAAAGGGGG - Intergenic
1138157022 16:54715288-54715310 CATTCATGAATGATGAAAGTTGG - Intergenic
1138157024 16:54715292-54715314 CTTTCATCATTCATGAATGTGGG + Intergenic
1140675153 16:77320673-77320695 ATTTCATCACTGAAGATACATGG - Intronic
1140767938 16:78177424-78177446 CTCCCATGACTCATGAAAGATGG + Intronic
1141332211 16:83121389-83121411 CTTTCTTCATTGATTAAGGAGGG + Intronic
1142975565 17:3641789-3641811 CTTGCATCTCTGAGGAAACATGG + Intronic
1146081089 17:29781208-29781230 CTCTTTTCACTGCTGAAAGATGG + Intronic
1147113056 17:38278152-38278174 GTTTCTTCACTCATGAAATAGGG + Intergenic
1147586519 17:41656418-41656440 CTCTCATCATTGCTGAGAGAGGG - Intergenic
1148416566 17:47511082-47511104 GTTTCTTCACTCATGAAATAGGG - Intergenic
1152508201 17:80767029-80767051 CTTTCATCAGAAATGAAAGAGGG + Intronic
1156950236 18:42887536-42887558 CCTTCATTACTGGTGGAAGAGGG + Intronic
1157228710 18:45892955-45892977 CTCTAATCACTGAAAAAAGAAGG + Intronic
1164919709 19:32079741-32079763 GATTCATCACTAATGAAAGGTGG + Intergenic
1164919871 19:32081273-32081295 CTTTCAACACTAATCAAAAAAGG - Intergenic
1168083768 19:54029921-54029943 CTTTCCTCACTGGAGAGAGAGGG + Intergenic
1202701421 1_KI270712v1_random:167985-168007 CTTCCATCATTGTTGAGAGATGG + Intergenic
925649641 2:6076137-6076159 CTTCCAACACTGGTAAAAGAGGG + Intergenic
926658186 2:15433275-15433297 CTTTCCTCACTAGTGAAAGAGGG + Intronic
928896572 2:36272002-36272024 ATTTCATCATTGAAGAAAGAAGG + Intergenic
930087824 2:47510398-47510420 CTTTCATAACTGATACAGGAGGG + Intronic
930148858 2:48036951-48036973 CTTTCATTACTTATGTTAGAAGG - Intergenic
931102859 2:59021781-59021803 ATTTCAGCCCAGATGAAAGAAGG - Intergenic
931164160 2:59727982-59728004 CATTGATCACTGCAGAAAGATGG - Intergenic
931917293 2:66969985-66970007 CTTTCCTCACTGATAAAATAAGG + Intergenic
934172333 2:89551432-89551454 CTTCCATCATTGTTGAGAGATGG + Intergenic
934282646 2:91625784-91625806 CTTCCATCATTGTTGAGAGATGG + Intergenic
934504274 2:94879092-94879114 GTTTCATCTCTGATGCCAGATGG + Intergenic
935103901 2:100021749-100021771 CTTTCATCAATGAAAAAAGTGGG + Intronic
935882914 2:107584348-107584370 CATCCATCACTGGAGAAAGATGG + Intergenic
936755371 2:115703274-115703296 CTTACATTACAAATGAAAGATGG + Intronic
939699160 2:145367922-145367944 TTTTCATCAATGAGGAAAGAAGG + Intergenic
942059272 2:172213142-172213164 CTCTCATCACTAATGAAATGAGG - Intergenic
943685303 2:190811634-190811656 CTCTGAGCAATGATGAAAGAAGG + Intergenic
943974483 2:194455383-194455405 CTTTAATCAATGTTGAAAAATGG + Intergenic
944974373 2:205031449-205031471 CTTTCATCTCAAATTAAAGAAGG + Intronic
945454093 2:210029026-210029048 TTTACATAACTGATGAAAGGAGG - Intronic
946954539 2:224914667-224914689 CTTTCATCCTTTATGAAAGATGG - Intronic
1171356304 20:24548003-24548025 TTTTCTTCACTGAAGGAAGAAGG + Intronic
1172650518 20:36498769-36498791 CTATCATCACTCAAGAATGAGGG - Intronic
1175581860 20:60105925-60105947 ATTTCATCACTGAGAAATGATGG + Intergenic
1176283562 20:64328734-64328756 GTTTCGTCACGGATGAAGGAAGG - Intergenic
1176671511 21:9739219-9739241 TTTTCATTATTGATGAAAAAAGG - Intergenic
1177302044 21:19260059-19260081 CTTTCATGATTAATGAGAGAGGG + Intergenic
1178187633 21:30241754-30241776 CTTTCTTCATTTATGAAAGTAGG - Intergenic
1180216488 21:46326683-46326705 CTTTCAAAAGTGAGGAAAGAGGG + Intronic
950261084 3:11543858-11543880 ATTTCATCTCTGCTGAAGGATGG + Intronic
950956151 3:17055368-17055390 CCTTCATCACTGATAAGGGATGG + Intronic
951808182 3:26670148-26670170 CTTTCATCACAGAAGAAATGAGG + Intronic
953693275 3:45137928-45137950 CTTTAATCCCTGCTGAGAGATGG - Intronic
954814316 3:53268683-53268705 GTTTCACCAGTGATGAATGAGGG + Intergenic
955115835 3:56000667-56000689 CTTCCAGCACTGATTAAAAATGG - Intronic
955353204 3:58209342-58209364 CCTTCCTCACTGATGAAACCCGG - Intronic
955840116 3:63103675-63103697 CTTTCATCAGGGATGTCAGAGGG + Intergenic
956634056 3:71345718-71345740 CTTTCAGCACTGCTGAGAGCAGG + Intronic
956666587 3:71647963-71647985 CTATCATCACTGAAGATAGGTGG - Intergenic
957028418 3:75212044-75212066 CTTTGATCACTCAAGTAAGATGG - Intergenic
957729451 3:84114357-84114379 CTCTCATTACTCATTAAAGATGG + Intergenic
957894472 3:86403425-86403447 TTTACATCACTGTTGCAAGATGG + Intergenic
959447038 3:106453213-106453235 CTTCCCTCACTGATGTGAGAAGG - Intergenic
961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG + Exonic
961847440 3:129778412-129778434 GTTCCATCACTGATGAAATAAGG + Intronic
962106360 3:132394596-132394618 ATTACATCACTTATCAAAGATGG + Intergenic
962263632 3:133930268-133930290 CTTTCATCAGAGATTAAATATGG - Intergenic
963928689 3:150979064-150979086 TATTCATCCCTGATGAAGGAAGG - Intergenic
964673036 3:159247811-159247833 CTTGCATCATGGAAGAAAGAGGG + Intronic
965480049 3:169207123-169207145 CTTTCATCATTGAGGAAGAAAGG + Intronic
965718706 3:171636823-171636845 ATCTCATCACTGATCATAGAGGG + Intronic
966761276 3:183421019-183421041 CTATCATCTCTGATGAGAGTTGG + Intronic
969224570 4:5786920-5786942 TTTTCATCAATGAGGAAATATGG - Intronic
969938822 4:10709898-10709920 CTGACATCACTGATGCAGGAGGG + Intergenic
970716353 4:18930094-18930116 TTTTCATCAACTATGAAAGAGGG + Intergenic
970979364 4:22078581-22078603 CTGTCATCACTGTTGAATAATGG - Intergenic
971559818 4:28063760-28063782 CTCTCATCACTTATTAAAGAGGG + Intergenic
971760888 4:30763685-30763707 TTTTCATTAATGATGAAATAGGG + Intronic
974660110 4:64876649-64876671 CATTCATGATTCATGAAAGAAGG - Intergenic
975675604 4:76824495-76824517 GTTTCATTACTGAGGAAAAAAGG - Intergenic
977164042 4:93673040-93673062 CTTTCAGCCCTGATGAGAAATGG + Intronic
978124345 4:105118158-105118180 CTTTCAAAACTGGTGAAATAAGG + Intergenic
979884437 4:126008089-126008111 CTTAAATCACTGATTTAAGAAGG - Intergenic
981136778 4:141219973-141219995 CTTTCATCAGTAATGAAACTGGG + Intergenic
981887965 4:149700436-149700458 CTCTCATCACTGTGAAAAGAAGG + Intergenic
982150432 4:152449349-152449371 CTTTGAGGACTGATGGAAGAGGG + Intronic
982872506 4:160600651-160600673 TTTCCACCACTGATGAAATAAGG - Intergenic
983935345 4:173499142-173499164 CTTTCATCACCTCTGAAAAATGG - Intergenic
984762015 4:183370787-183370809 CTTTCATCATTAGTGACAGAAGG - Intergenic
984843514 4:184090693-184090715 CTTCCATCCCTGATAAAAGGAGG - Exonic
986340000 5:6780738-6780760 CGTCCATCAGTGATGAAAGAAGG - Intergenic
986484109 5:8217967-8217989 ATTTCCTCATTGATGAAACAAGG + Intergenic
987980288 5:25075474-25075496 CTTTCATCAATGGTGTATGAGGG + Intergenic
990492047 5:56312151-56312173 ATTTCATCACTTATATAAGAGGG - Intergenic
990616058 5:57509584-57509606 CTGTCATCACTTATGAAATGTGG + Intergenic
991446377 5:66704433-66704455 CTTTCAACAGAGATGAAGGATGG - Intronic
992127589 5:73657707-73657729 CTTTGATGAGTGAGGAAAGAAGG - Intronic
993486214 5:88489340-88489362 GTTTCAACAATGAAGAAAGAAGG - Intergenic
993861379 5:93140978-93141000 CTTTCATCTCTGAAGTAATAGGG + Intergenic
995380517 5:111527146-111527168 GTTTCATCACAGATGATAAAAGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996871717 5:128199847-128199869 TATTCATCACTGATGAGGGAAGG + Intergenic
1000605773 5:163326126-163326148 CTTTCCTCAATTATGAAAGATGG - Intergenic
1000633034 5:163612702-163612724 GTTTCATCACTGGTGAGAAAAGG + Intergenic
1002861634 6:1084762-1084784 CTTTCATTGCTAATGAATGAAGG + Intergenic
1004498844 6:16190781-16190803 CTTTCATTAATTATCAAAGAAGG + Intergenic
1004573164 6:16867715-16867737 CTTTCATCAAAAATGAATGATGG + Intergenic
1005227928 6:23664732-23664754 TATTCATCACTGATGAAACTGGG - Intergenic
1007128899 6:39450958-39450980 CTTTCACTACTGACGAAAAAAGG - Intronic
1007222911 6:40293336-40293358 CTTGCATCTCTGATGATAGGTGG + Intergenic
1007489932 6:42212331-42212353 GTTTCCTCACATATGAAAGAGGG + Intronic
1007923362 6:45630557-45630579 CTTTCATCACCCCTGAGAGAGGG + Intronic
1007964832 6:45994660-45994682 CTTTCACCACTCATGAGACATGG - Intronic
1008608259 6:53161871-53161893 CATTCACCACTGCTGAGAGATGG - Intergenic
1008828169 6:55724627-55724649 TCTTCAACACTAATGAAAGAAGG + Intergenic
1008951934 6:57171322-57171344 CTTTGATCTCTGATTAAAGGTGG + Intergenic
1009660766 6:66607479-66607501 CATCCATCACAGAAGAAAGATGG + Intergenic
1009949882 6:70383216-70383238 CATTCATCAGTGTTGTAAGAAGG - Intergenic
1010483939 6:76386838-76386860 TTTTCATCACTTATTAAAAAAGG + Intergenic
1012432178 6:99175450-99175472 CTGTCATCATTGATGGAGGATGG + Intergenic
1013900206 6:115146546-115146568 CTTTCTTCACTGGTAAAATAGGG - Intergenic
1015612660 6:135042237-135042259 TTTTCATCCCTTATGAAATATGG - Intronic
1015701012 6:136036226-136036248 CTTTCATCTCTTATCAGAGAGGG + Intronic
1017567402 6:155702223-155702245 CTATCATCAGTGAAGAGAGATGG + Intergenic
1020868353 7:13594382-13594404 CTTTTATCATTTATGAGAGAGGG + Intergenic
1021337458 7:19421068-19421090 CTTGCATTTCTTATGAAAGAGGG + Intergenic
1021416166 7:20387618-20387640 CTGTCATAACTGTGGAAAGAGGG + Intronic
1021646394 7:22793741-22793763 CTTTCCAAACTGATGAAACATGG - Intergenic
1022138671 7:27473321-27473343 TTTTCATCACTGGTGTATGAGGG + Intergenic
1022322910 7:29303753-29303775 CTTTCATGACTTCAGAAAGAAGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025935519 7:66032677-66032699 GTTTCTTCACTCAGGAAAGATGG - Intergenic
1025948815 7:66127198-66127220 GTTTCTTCACTCAGGAAAGATGG + Intronic
1026061503 7:67030709-67030731 GTTTCAGGACTGGTGAAAGAAGG + Intronic
1026716847 7:72796723-72796745 GTTTCAGGACTGGTGAAAGAAGG - Intronic
1030568992 7:111197626-111197648 CTTCCTTAACTGATGACAGATGG - Intronic
1031634661 7:124087094-124087116 ATTTCATAACTGATGAAATGAGG - Intergenic
1032891692 7:136201454-136201476 CTTTTGTTACTGATAAAAGATGG - Intergenic
1033276405 7:139974888-139974910 CTTTCCCCACTGATGAAATGGGG - Intronic
1033415372 7:141157059-141157081 CTTTCACCACTGCTAAGAGAAGG - Intronic
1033530489 7:142257965-142257987 CTTTCTTCCCTGAAGACAGAGGG - Exonic
1034383027 7:150715652-150715674 CATTCATCATTGCTGAAACAGGG - Intergenic
1035329616 7:158087805-158087827 CTTCCTCCCCTGATGAAAGAGGG + Intronic
1035329713 7:158088338-158088360 CTTCCTCCCCTGATGAAAGAGGG + Intronic
1035329733 7:158088453-158088475 CTTCCTCCCCTGATGAAAGAGGG + Intronic
1035329779 7:158088721-158088743 CTTCCTCCCCTGATGAAAGAGGG + Intronic
1035329832 7:158089027-158089049 CTTCCTCCCCTGATGAAAGAGGG + Intronic
1035329984 7:158089830-158089852 CTTCCTCCCCTGATGAAAGAGGG + Intronic
1035330030 7:158090064-158090086 CTTCCTCCCCTGATGAAAGAGGG + Intronic
1035330045 7:158090142-158090164 CTTCTTCCACTGATGAAAGAGGG + Intronic
1035330050 7:158090181-158090203 CTTCCTCCCCTGATGAAAGAGGG + Intronic
1037718009 8:21416103-21416125 CTTTAATGAGTGATGACAGATGG + Intergenic
1040957152 8:52991104-52991126 CTTTCACCTCTGCTGAAAGAAGG + Intergenic
1042326360 8:67532857-67532879 ATTTCATGAGTGAAGAAAGATGG + Intronic
1045664626 8:104471175-104471197 CTTGAATCAATGATGAAAGTTGG + Intergenic
1046723013 8:117642317-117642339 CTTTCCTCACTGATCTAAAATGG + Intergenic
1047536892 8:125728224-125728246 CATTCCTAACTGATGTAAGAAGG + Intergenic
1048045880 8:130772525-130772547 CATTCATGATTCATGAAAGAAGG - Intergenic
1048626198 8:136188089-136188111 TTTTCATCTCAGATGAGAGAGGG + Intergenic
1048794494 8:138137523-138137545 CTTTCATGGCTGATGAGAGCAGG - Intronic
1050103058 9:2138597-2138619 CTCTGATAACTTATGAAAGATGG + Intronic
1050209957 9:3242181-3242203 TTTTCCTCACTGGTGAAATAGGG + Intronic
1050368124 9:4891472-4891494 CTTAGATCACCCATGAAAGAAGG - Intergenic
1051053828 9:12959816-12959838 CTTTCATCAGTGCTGAAAAGAGG - Intergenic
1051457493 9:17276453-17276475 TTTTCCTCACTGATAAATGATGG + Intronic
1051758037 9:20426861-20426883 CTACAATCACTCATGAAAGATGG + Intronic
1054969390 9:71067891-71067913 GTTTCATCACTGGTGAAATCAGG + Intronic
1056032364 9:82566362-82566384 CTATCATCAGAGATGAGAGATGG - Intergenic
1056527652 9:87458143-87458165 GTTTCCTCACTTATGAAATAAGG - Intergenic
1057074872 9:92133293-92133315 TTTTGATAAGTGATGAAAGAGGG + Intergenic
1058372013 9:104280283-104280305 CTTTCCTCACTGATAAAATGTGG - Intergenic
1060884067 9:127138250-127138272 GTTTCCTCACTGATAAACGATGG - Intronic
1060960140 9:127674960-127674982 CCTTCCTCACTCATGAAACATGG + Intronic
1061962274 9:133994108-133994130 CTTTCCTCACCGAAGCAAGATGG + Intergenic
1187796505 X:23009224-23009246 CTTTCTTCACTGATTTAAAACGG - Intergenic
1193976267 X:88123231-88123253 CTTTCCTCACTGGTGTGAGATGG - Intergenic
1194760676 X:97792810-97792832 CTTTCATGATCCATGAAAGATGG - Intergenic
1195484974 X:105393881-105393903 GTTTCCTCACTTATGAAATAGGG - Intronic
1195954016 X:110309713-110309735 CTTTGCTCAATGATGAAGGATGG - Intronic
1197080874 X:122414539-122414561 CTTTAATGACTGGTGAAGGATGG - Intergenic
1197112042 X:122787840-122787862 CTTTCTTCACTTGTGAAATAGGG - Intergenic