ID: 961192356

View in Genome Browser
Species Human (GRCh38)
Location 3:124972532-124972554
Sequence ATGGGGATGCAGACTTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961192356_961192364 10 Left 961192356 3:124972532-124972554 CCATCCAAAGTCTGCATCCCCAT 0: 1
1: 0
2: 0
3: 16
4: 293
Right 961192364 3:124972565-124972587 CACAGCAACCAGAGGAATTATGG 0: 1
1: 0
2: 1
3: 16
4: 175
961192356_961192362 2 Left 961192356 3:124972532-124972554 CCATCCAAAGTCTGCATCCCCAT 0: 1
1: 0
2: 0
3: 16
4: 293
Right 961192362 3:124972557-124972579 TCAATTGCCACAGCAACCAGAGG 0: 1
1: 0
2: 1
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961192356 Original CRISPR ATGGGGATGCAGACTTTGGA TGG (reversed) Intronic
900173909 1:1283763-1283785 AAGGGGCTGCAGCCTGTGGAGGG - Intronic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
903277774 1:22232778-22232800 CTGGGGCTCCAGCCTTTGGAAGG + Intergenic
903958532 1:27041586-27041608 ATGGGGATGAAGAGATTGAAAGG - Intergenic
904337746 1:29809219-29809241 ATGGGAATGATGACTTCGGAGGG - Intergenic
905458727 1:38106763-38106785 CTGGGGCTGCAGCCTTGGGAAGG + Intergenic
905839302 1:41161370-41161392 ATTGGGATGCAGACTCTGATAGG + Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906903727 1:49865592-49865614 TTGAGGATGATGACTTTGGATGG - Intronic
907733005 1:57086098-57086120 CAGGGGATGCAGAATTTTGAAGG + Intronic
907756284 1:57313814-57313836 TTGGAGGTGCAGCCTTTGGAAGG + Intronic
909497068 1:76290397-76290419 ATGGGCATGCAGTCATTGAAAGG - Intronic
910631622 1:89361712-89361734 ATGGGGTTGCATATATTGGATGG - Intergenic
910640616 1:89457416-89457438 ATGGGGTTGCATATCTTGGATGG + Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911674973 1:100648087-100648109 TTGAGGTTGCTGACTTTGGATGG - Intergenic
911701345 1:100956401-100956423 AGGGAGTAGCAGACTTTGGAAGG + Intronic
912699630 1:111867471-111867493 AAGGTGAGGCTGACTTTGGAAGG + Intronic
913189802 1:116403982-116404004 ATGGGCATTCTGACTTTGGTTGG + Intronic
913401623 1:118440783-118440805 ATAGGGATGGAAAATTTGGAAGG - Intergenic
916056816 1:161073741-161073763 ATGGGAATGCAGCCTCCGGATGG + Exonic
917227582 1:172800914-172800936 GTGGGGATCCATACTGTGGACGG - Intergenic
917554238 1:176067507-176067529 AGGAGGATGCAGAATTTGGCTGG + Intronic
917624168 1:176829366-176829388 CTGGGAATGCAGACTGTGGGAGG - Intronic
919658812 1:200223103-200223125 ATGCCGAGGCAGACTTTGCAGGG - Intergenic
919783909 1:201245077-201245099 ATGGAGATGAGGCCTTTGGAAGG + Intergenic
919897515 1:202018472-202018494 GAGGGGATGCAGACTCTGGTGGG - Intergenic
920206424 1:204295684-204295706 ATGAGCAGGCAGCCTTTGGAAGG - Intronic
920259963 1:204682573-204682595 ATGGTAATGCAGACATTAGAAGG + Intronic
920683230 1:208089259-208089281 ATGAGGATTCAGGCTATGGATGG - Intronic
921931211 1:220755672-220755694 CTGGGAGTGCAGACTCTGGATGG + Intronic
922205577 1:223443377-223443399 ATGATGGTGCAGACTTTGGGTGG - Intergenic
922223761 1:223627926-223627948 GTGGGGAGGCAGACGTGGGAGGG + Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923097741 1:230788865-230788887 ATGGAGATCCAGAGTTTGGAAGG + Intronic
924802674 1:247338844-247338866 ATGGGGAAGTAGACTTTGTACGG + Intergenic
1063232179 10:4076017-4076039 ATTGGGGTTCAAACTTTGGATGG + Intergenic
1064154257 10:12890499-12890521 CTGGGGATGCACACTTGGCAAGG + Intergenic
1066436861 10:35403662-35403684 ATGGTGATGCAGGATATGGAAGG + Intronic
1068385289 10:56318214-56318236 TTGGAGATGTAGCCTTTGGAAGG + Intergenic
1069620381 10:69833870-69833892 TTGGGGAGGCAGACCGTGGAGGG + Intronic
1069636586 10:69929018-69929040 AAGGGGGTGAAGACTTTGCAAGG + Intronic
1070252403 10:74784491-74784513 ATGGGGATGAAGACTGTGAAAGG - Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070791592 10:79192730-79192752 ATGAGGATGCAGGCTCAGGAAGG + Intronic
1070996182 10:80785169-80785191 ATTGGGATGGAAACTTTGGGGGG + Intergenic
1071480298 10:86060445-86060467 GTGGGCACCCAGACTTTGGAGGG + Intronic
1071536419 10:86435604-86435626 ATAGAGATGCAGATTTTGGTGGG - Exonic
1073547610 10:104364942-104364964 ATGGGAATAGAGACTGTGGAGGG - Intronic
1073584111 10:104692201-104692223 GTGGGGATGCAGAGTGTGGGAGG + Intronic
1074363189 10:112838888-112838910 ATGGTGATACTGACTTTGCAGGG + Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1075007142 10:118839337-118839359 ATGGTGACTCAGACTTAGGAGGG + Intergenic
1075138884 10:119813752-119813774 TTGGGGACGCTGAGTTTGGAGGG + Intronic
1077418969 11:2440612-2440634 ATGGGGGTGCAGATTGTGGAGGG - Intergenic
1077485068 11:2834858-2834880 GTGGGGAGGGAGACTTGGGATGG - Intronic
1079615576 11:22488560-22488582 TTGGAGATGGAGCCTTTGGAAGG + Intergenic
1079847361 11:25488544-25488566 ATGGTGGTGCAGAATATGGAAGG + Intergenic
1081736012 11:45404761-45404783 ATGGGGATGAGAGCTTTGGATGG - Intergenic
1083248143 11:61446092-61446114 ATGGGGGTTCAGTCTGTGGATGG + Exonic
1083785471 11:64943282-64943304 CTAGAGATCCAGACTTTGGAAGG - Intronic
1083901494 11:65645643-65645665 ATGGGGCTGGAGCCTGTGGAGGG + Intronic
1083993614 11:66261310-66261332 GTGGGGATGGAGTCTTTGGGTGG + Intronic
1084468450 11:69341047-69341069 TTTGGGATGCAGATTTGGGATGG + Intronic
1085101712 11:73806260-73806282 ATGAGGATACAGATTATGGAAGG - Intronic
1085808515 11:79658813-79658835 ATGGAGATGGAGACTTTAGGAGG - Intergenic
1088170896 11:106995408-106995430 AAGGGGTTGGAGATTTTGGAGGG - Intronic
1093115933 12:15211075-15211097 ATGTGGATGCAGAGCTTGCATGG - Intronic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1096058052 12:48671697-48671719 ATGGGGATACATACTTTGTTAGG - Intronic
1096520729 12:52183213-52183235 ATGGGGATGGAGACTTCCGAAGG - Intronic
1098055075 12:66496595-66496617 CTGGAGATTCAGACTTTGAAGGG - Intronic
1098367961 12:69725408-69725430 ATGGACTTGCAGATTTTGGAAGG + Intergenic
1098384671 12:69906358-69906380 ATGCGACTGCAGACTGTGGAAGG + Intronic
1100530213 12:95455492-95455514 GTGGGGATCCATACTATGGATGG + Intergenic
1100940628 12:99719670-99719692 ATGGTGGTGCAGAATATGGAAGG - Intronic
1101615512 12:106332803-106332825 TTGGAGATGGAGACTTTGGGAGG - Intronic
1101835210 12:108290242-108290264 ATGAGGCTGCAGAGTTGGGAAGG - Exonic
1101884860 12:108653805-108653827 TTGTGGATGCAAACTTTTGAGGG - Intronic
1104038416 12:125114327-125114349 TGGGAGAAGCAGACTTTGGAGGG - Intronic
1104266918 12:127242288-127242310 CTGTGGCTGCTGACTTTGGAAGG - Intergenic
1104653752 12:130557522-130557544 CTGGGGCTGCGGGCTTTGGAAGG - Intronic
1105032613 12:132894571-132894593 ATGGTGGTGCAGAATATGGAAGG - Intronic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105447522 13:20470537-20470559 AAGGGGAAGCAGATTTTGAATGG + Intronic
1106583104 13:31034385-31034407 ATGGGGATGCACACTGGGGCCGG - Intergenic
1107451983 13:40518097-40518119 AAGGGGATGCAGGGTTTAGAAGG - Intergenic
1108803585 13:54129216-54129238 ATGGTGGTGCAGAATATGGAAGG + Intergenic
1111679185 13:91423459-91423481 TGGGAGATACAGACTTTGGAAGG + Intronic
1113125373 13:106972513-106972535 CTGAGCATGCAGACTTTGCAAGG - Intergenic
1114615419 14:24065463-24065485 ATGCGAATGCAGGCGTTGGAAGG + Intronic
1114764026 14:25350149-25350171 ATATGTATGAAGACTTTGGAAGG + Intergenic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1116737260 14:48707809-48707831 ATAGGGACGCAGACTTGGAAAGG - Intergenic
1117733067 14:58743380-58743402 TTGGAGATGAAGACTTTGCAAGG + Intergenic
1118636195 14:67750820-67750842 TTGGGGATAAAGACTTGGGAAGG + Intronic
1118820796 14:69344487-69344509 AAGTGGATGCAGAGTTTAGAGGG + Intronic
1119442137 14:74635571-74635593 ATGTGGATGCAGAATTGGAAGGG + Intergenic
1119620906 14:76131277-76131299 TGGGGAATGCAGACTGTGGAAGG + Intergenic
1120169396 14:81233887-81233909 ATGCTGATGGAGTCTTTGGAAGG + Intergenic
1121009860 14:90513495-90513517 ATGGGGACGCTGACACTGGAGGG - Intergenic
1121858663 14:97295037-97295059 ATGAGGGTGCAGTCTTTGGCTGG - Intergenic
1123111012 14:105866857-105866879 ATGGGGATGGAGCCTTAGGCTGG + Intergenic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1124238685 15:28012385-28012407 ATGGGGAGGCAGCCTCTGGGAGG + Intronic
1126541417 15:49828586-49828608 TTGGAGATACAGACTTTGGGAGG - Intergenic
1126929263 15:53629857-53629879 GTGGGGATGCGGATTTTTGAGGG - Intronic
1128878674 15:71223490-71223512 ATGTGAATGAAGACTTTGCAGGG - Intronic
1130908000 15:88253457-88253479 ATGGGGATGCTGACTTTCCGGGG + Intronic
1132902080 16:2262354-2262376 ATGGGGATGCATCCTTTCCACGG + Exonic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1138056180 16:53836323-53836345 GTGGGGAAGCAGACACTGGAAGG - Intronic
1142141447 16:88474497-88474519 AGGGGGCTGGAGGCTTTGGAGGG - Intronic
1142607128 17:1088097-1088119 CTGGGGCTGCAGATTTGGGAGGG - Intronic
1143995512 17:11003291-11003313 ATGGGGATGCTGACATTGTGAGG + Intergenic
1144730148 17:17521352-17521374 CTGGGGATGCAGGCTGTGCAGGG - Intronic
1145253546 17:21310345-21310367 ATGGTTATGGAGTCTTTGGAAGG - Intronic
1145323031 17:21777616-21777638 ATGGTTATGGAGTCTTTGGAAGG + Intergenic
1147161061 17:38569614-38569636 ATGGGGATGGTGGCTTAGGAGGG - Intronic
1147605537 17:41771981-41772003 ATGAGGATGCAGGCTGGGGATGG + Intronic
1149185901 17:53997521-53997543 TTGGGGATACAGACTTTATAGGG - Intergenic
1150159491 17:62883781-62883803 AAGGGGTTGGAGCCTTTGGAAGG + Intergenic
1152248517 17:79199171-79199193 ATGGGAAGGCAGACTCTGGCTGG + Intronic
1152564994 17:81096414-81096436 ATGGGGGTGCCTGCTTTGGAGGG - Intronic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155119376 18:22802819-22802841 AAGGGGATGTAGATTTTTGATGG - Intronic
1155328675 18:24692078-24692100 ATGGGGATGCAGTGTTTGATGGG + Intergenic
1156165625 18:34416746-34416768 ATGGGAAGGAAGAGTTTGGAAGG + Intergenic
1160077629 18:75693333-75693355 ATGGGGATGGAGCATTTAGAGGG - Intergenic
1160951276 19:1668816-1668838 ATGGGGAAGGAGAATTTCGAAGG + Intergenic
1162129941 19:8520240-8520262 TTTGGGATGCAGATTTTGGAAGG + Intergenic
1163053236 19:14700659-14700681 ATGGGAACTCAAACTTTGGAAGG - Intronic
1163698230 19:18774660-18774682 ATGGGGATGGGGCCTTGGGAAGG + Intronic
1164109729 19:22144783-22144805 AGGGGAATGCAGACTGTCGATGG - Intergenic
1164869210 19:31629202-31629224 TTGGGGATGGGGACTTGGGAGGG - Intergenic
1165996414 19:39846934-39846956 AAGGGGATAGAGATTTTGGAGGG + Intergenic
1166459573 19:42974373-42974395 ATGGGGATGGAGAATTGGAATGG - Intronic
1166929640 19:46294362-46294384 ATTTGGATGCAGACTTAAGAAGG - Intergenic
1168128557 19:54301533-54301555 ATGAGGATGCTAACTTTAGAAGG - Intergenic
1168137288 19:54360142-54360164 ATGGTCATGCGGCCTTTGGATGG - Intronic
1168160789 19:54508943-54508965 ATGGTCATGCGGCCTTTGGATGG + Intronic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
926038758 2:9655892-9655914 CTGGGGCTGCAGACTGTGGTGGG - Intergenic
927752337 2:25680547-25680569 ATGGGGCTGGAGAGGTTGGAGGG + Intergenic
929383888 2:41382492-41382514 ATGGTGATGCAGGATATGGAAGG - Intergenic
929516884 2:42611554-42611576 ATTGAGATGCAGTCTTTGGGAGG + Intronic
929554126 2:42914208-42914230 GTGGGCATCCAGACTGTGGAGGG - Intergenic
929760840 2:44805133-44805155 ATGGGGAGGCATTCTTAGGAGGG + Intergenic
930013676 2:46956510-46956532 CTGGGGCTGCAGTCTTTGGGGGG + Intronic
931070483 2:58642677-58642699 CTGAGGATGAAGCCTTTGGAGGG + Intergenic
931122437 2:59234739-59234761 ATGGTGATGAAGTCTTTTGAGGG - Intergenic
933240800 2:79918312-79918334 ATGGGCCTGCAGACTTTTCATGG + Intronic
933551277 2:83779832-83779854 ATAGGTATTCAGAATTTGGAAGG - Intergenic
933894360 2:86797208-86797230 CTGGGGATGTAGCCTTGGGAAGG + Intronic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
934711096 2:96514648-96514670 GTGGGGCTGCAGGCTTTGGATGG + Intergenic
937518820 2:122686093-122686115 ATGGAGATGAAGAATTTGTAGGG - Intergenic
938775613 2:134538823-134538845 ATGGGGAAGGAGACCTGGGAGGG + Intronic
941537549 2:166741661-166741683 GTGGGGATCCATACTTGGGATGG + Intergenic
944743474 2:202634648-202634670 CTGGGGACTCAGACTCTGGAAGG - Intergenic
945164626 2:206929817-206929839 ATAGGGATTCAGTCTTGGGAGGG - Intergenic
948030581 2:234814320-234814342 TGGGGGATACAGGCTTTGGATGG + Intergenic
948322520 2:237082062-237082084 ATGGAGAAGAAGACTTTGAAAGG + Intergenic
1169084392 20:2817603-2817625 TTGGGGATGCAGACTGAGGCAGG - Intronic
1169986190 20:11447546-11447568 CTGGGGATGCAGTCATCGGAAGG - Intergenic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172867753 20:38112965-38112987 ATGGGCATGCCTACTTTGGGAGG - Intronic
1174149211 20:48474332-48474354 GTGGAGATGGAGACTTTGGTTGG - Intergenic
1174149242 20:48474542-48474564 GTGGGGCTGGAGACTTTGGGAGG - Intergenic
1175029732 20:55940043-55940065 TAGGAGATGCAGTCTTTGGAAGG - Intergenic
1176098485 20:63354537-63354559 TGGGGGCTGCAGTCTTTGGAGGG + Intronic
1176117621 20:63439925-63439947 ATGGGGACACAGCCTTTGGCTGG - Intronic
1176332027 21:5558137-5558159 ATAGGGATGAAGACTGTTGAAGG - Intergenic
1176395730 21:6262814-6262836 ATAGGGATGAAGACTGTTGAAGG + Intergenic
1176441427 21:6726290-6726312 ATAGGGATGAAGACTGTTGAAGG - Intergenic
1176465689 21:7053359-7053381 ATAGGGATGAAGACTGTTGAAGG - Intronic
1176489250 21:7435137-7435159 ATAGGGATGAAGACTGTTGAAGG - Intergenic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1177636272 21:23790612-23790634 AAGGTGATGGGGACTTTGGAAGG + Intergenic
1178096706 21:29223058-29223080 GTGGTGATGCAGGCATTGGAGGG + Intronic
1178821227 21:35977064-35977086 ATGGGGAAGCAGGCTTGGGGAGG - Intronic
1179577721 21:42318214-42318236 GTGGGAATGCAGGCTCTGGAAGG - Intergenic
1179633139 21:42691009-42691031 ATGGGGCTGGTGACTTTGGATGG - Intronic
1179633171 21:42691165-42691187 AAGGGGCTGGTGACTTTGGATGG - Intronic
1179633248 21:42691599-42691621 ATGGGGCTGGTAACTTTGGATGG - Intronic
1179826636 21:43969570-43969592 ATGGGGATGCACACTGAGCAGGG - Intronic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1182737619 22:32542088-32542110 ATGGGGGAACAGACTGTGGAGGG + Intronic
1184760764 22:46542801-46542823 ATGGGGGTGCAGCCTGTGGGGGG - Intergenic
1185091608 22:48778704-48778726 ATGGGAGTGGAGACTCTGGAGGG + Intronic
949408459 3:3739134-3739156 TTGGGGATTCGGACTTTGGATGG + Intronic
950939634 3:16880120-16880142 AAAGAAATGCAGACTTTGGAAGG + Intronic
951762470 3:26161700-26161722 ATGGTGGTGCAGAATATGGAAGG + Intergenic
953850554 3:46463136-46463158 GTGGGGTTGAAGATTTTGGAGGG - Intronic
953927937 3:46991830-46991852 ATGGGGATGGCGTCTGTGGAAGG - Exonic
954090352 3:48279217-48279239 AAGGGGATGAAGGATTTGGAGGG - Intronic
954813265 3:53260974-53260996 ATGGGCATGCAGAGTCTGCAGGG + Intergenic
955032081 3:55231683-55231705 GCAGGGATGCAGACTTTGAAGGG - Intergenic
955123716 3:56088180-56088202 TTGAGGATCCAGACTTAGGAAGG - Intronic
956014111 3:64863070-64863092 ATGGGGATGAATACTTAGAAAGG - Intergenic
956153444 3:66267929-66267951 ACTGGGAAGGAGACTTTGGAGGG - Intronic
958653796 3:96975237-96975259 TTGGGGCTGTAGACTTGGGAGGG + Intronic
958682262 3:97346190-97346212 ATATGGTTGCAGACTTTGAAGGG - Intronic
960260177 3:115558553-115558575 ATGGGGGTGAAGAACTTGGAAGG + Intergenic
961192356 3:124972532-124972554 ATGGGGATGCAGACTTTGGATGG - Intronic
961596225 3:128019779-128019801 ATGGGTATACAGAGTATGGAGGG - Intergenic
963292198 3:143503473-143503495 GTGGCGAAGCAGGCTTTGGAGGG - Intronic
964299941 3:155276499-155276521 ATGGTGGTGCAGAATATGGAAGG + Intergenic
967126808 3:186431308-186431330 ATGAGGATTCCGTCTTTGGATGG - Intergenic
967148432 3:186626436-186626458 AAGGAGATGCAGATGTTGGATGG - Intergenic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
969718769 4:8881531-8881553 CTGGCGATGCAGGATTTGGAGGG - Intergenic
970001835 4:11372552-11372574 ATGGGGATGCATCCTTTCCACGG - Intergenic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
970940407 4:21626275-21626297 GTGGAGATGAAGACTTTGGGAGG + Intronic
971385337 4:26136515-26136537 AGAGGGAGGAAGACTTTGGATGG + Intergenic
972050490 4:34726347-34726369 ATGGGAATGCAGGCTTTTGCTGG + Intergenic
974537133 4:63187141-63187163 ATGGGGATCCATACTGGGGATGG - Intergenic
976739615 4:88344914-88344936 ATGGTGATGCAGGATATGGAAGG + Intergenic
976922689 4:90457874-90457896 ATGGGTCTGCAGGCTGTGGATGG - Intronic
977181770 4:93883838-93883860 TTGGGGAGGGAAACTTTGGAGGG - Intergenic
978293983 4:107181666-107181688 ATGGGGAGGGAAGCTTTGGAAGG - Intronic
982701121 4:158660491-158660513 ATGGGGATCCATACTGGGGATGG - Intergenic
985078715 4:186243684-186243706 ATGGTGGTGCAGAATATGGAAGG + Intronic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
986609254 5:9550483-9550505 ATGGAGATGAAGCCTCTGGATGG + Intergenic
986884798 5:12220109-12220131 ATGGGAATGCAGACTTTTGGGGG + Intergenic
987594017 5:19972394-19972416 ATTTGGATGCAGACTTTCAATGG - Intronic
987635717 5:20538232-20538254 AGGGGGATGCAGACGTGGGCAGG + Intronic
988528251 5:32005043-32005065 ATGTGGATGAGGACCTTGGATGG - Intronic
990910438 5:60846230-60846252 AAGGGGATGGAGACTTTTGGAGG + Intergenic
992765029 5:79990857-79990879 CTGGGGATGCAGAGTAGGGAGGG + Intronic
994055398 5:95408539-95408561 ATTTGGAGGCAGAGTTTGGAGGG + Intronic
994504720 5:100628287-100628309 ATGAAGAAGCACACTTTGGATGG - Intergenic
995054236 5:107741768-107741790 GAAGGGGTGCAGACTTTGGAGGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997587404 5:135051646-135051668 ATTGGGATTCAGACTTAGGTTGG + Intronic
997678516 5:135733054-135733076 ATGGTGGTGCAGAATATGGAAGG + Intergenic
999366789 5:151028674-151028696 GTGGGGATGTAGCCTTGGGAGGG - Exonic
999922073 5:156332148-156332170 GTGGGGACGCAAACTTTTGAAGG - Intronic
1000580010 5:163024994-163025016 ATGGGAATGCAGACCTAGGGTGG + Intergenic
1001126814 5:169027051-169027073 ATGGGTAGACAGACTTAGGATGG + Intronic
1001300229 5:170528240-170528262 AAGGGGCTGCAGACTGGGGAAGG - Intronic
1002703224 5:181142103-181142125 CTGTGGATGGAGTCTTTGGAAGG + Intergenic
1003049541 6:2766558-2766580 AAGGGGGTGCAGACTTGGGCTGG + Intronic
1003100091 6:3170416-3170438 ATGGTGGTGCAGAATATGGAAGG - Intergenic
1003673052 6:8177625-8177647 ATGGGGTTTCAGACTTAAGAAGG + Intergenic
1007161859 6:39797771-39797793 ATGAGGGTGCAGACTTCGTATGG + Intronic
1010275549 6:73964845-73964867 ATTGGGATGCCAACTTTGAATGG - Intergenic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1010793622 6:80093339-80093361 TTGGAGATGAAGACTTTTGAGGG + Intergenic
1013662463 6:112311349-112311371 ATGGAGATGCATATTTTTGATGG - Intergenic
1015697280 6:135995059-135995081 AAGAGGATGCAGAGTTGGGAGGG - Intronic
1015855610 6:137621587-137621609 GTGGGGAGGCAGATTATGGAGGG - Intergenic
1018829556 6:167432932-167432954 ATGGGGTGGCAGAGTGTGGATGG + Intergenic
1019778510 7:2926213-2926235 ATGGAGAGGCCGACATTGGAGGG - Intronic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1020542538 7:9477194-9477216 ATGGGAAGGCAGACTTAGAAAGG - Intergenic
1022472155 7:30688629-30688651 CTGTGGATGCAGACCTGGGAAGG + Intronic
1022499105 7:30871457-30871479 AGGAGGATGGAGACTTGGGAGGG + Intronic
1023215323 7:37856275-37856297 TTGGAGATGGAGACTTTAGAAGG + Intronic
1026054184 7:66970530-66970552 ATGGGGATGCAGCCCTAGCAGGG - Intergenic
1026266159 7:68797738-68797760 ATGGGGAAACTGACTTTGGGAGG - Intergenic
1026977571 7:74507836-74507858 TTGGGTGTGCAGACTTAGGAGGG + Intronic
1027578934 7:79968323-79968345 CTGGGGCTGCAGACATTTGAAGG - Intergenic
1028478233 7:91274953-91274975 TTGGAGATGGAGCCTTTGGAAGG - Intergenic
1029600732 7:101561996-101562018 AAGGGGTTGCTGAGTTTGGAGGG + Intergenic
1029617166 7:101666214-101666236 CCCGGGATGCAGACTCTGGATGG - Intergenic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031777653 7:125921963-125921985 ATGGTGGTGCAGAATATGGAAGG - Intergenic
1032715413 7:134505097-134505119 ATGGTGATGACAACTTTGGAAGG - Intergenic
1033777376 7:144627637-144627659 ATGGTGGTGCACACTTTGGAAGG + Intronic
1034907026 7:154958260-154958282 ATGGAGATGCTGACTGTGGTAGG - Intronic
1035037197 7:155903034-155903056 ATGGGGAAGTGGACTTTGGCTGG + Intergenic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1037146942 8:15583877-15583899 ATGAGGATGTAGTTTTTGGAAGG + Intronic
1038201030 8:25412908-25412930 ATGAGTATGCAGATTCTGGAAGG + Exonic
1040337558 8:46423752-46423774 ACGGGGCTGCAGAGTTTTGAGGG + Intergenic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1042622133 8:70718000-70718022 ATGGAGATGAGGAATTTGGAGGG - Intronic
1044637069 8:94336661-94336683 GTGGGGATGGAGACTTGTGATGG + Intergenic
1046691786 8:117293822-117293844 ATTGGGATAAAGACTTTGGATGG + Intergenic
1047972501 8:130097389-130097411 ATGGGGATGCTGTCTGTGCAGGG - Intronic
1048698006 8:137050174-137050196 ATGGGGATGTGGACTTGGGAAGG - Intergenic
1048990695 8:139758537-139758559 ATGGGGATGCAGACACAGGGAGG + Intronic
1051894828 9:21975716-21975738 ATGGGGAGGGAGTCATTGGAAGG + Intronic
1052260136 9:26505514-26505536 GTGGGGAATCAGATTTTGGAAGG - Intergenic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1056179026 9:84063641-84063663 ATGGAGATGGAGACTCTGTAGGG + Intergenic
1056498786 9:87187921-87187943 ATGTGAATGCATATTTTGGAAGG + Intergenic
1056507482 9:87270901-87270923 GTGGGGATGAAGAGTTTGGAGGG + Intergenic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057210496 9:93198552-93198574 ATGGGGATGGCCACTGTGGAGGG + Intronic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057872711 9:98730417-98730439 GAGGGGATGCAGACTTCGGCTGG - Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061082527 9:128380470-128380492 ATGGCCATGCAGCCTTGGGAGGG + Intronic
1061391904 9:130321468-130321490 CTGGGAATGCAGAGTTGGGAAGG - Intronic
1062213275 9:135376032-135376054 ATGGGGAAGCTGAACTTGGACGG + Intergenic
1203430071 Un_GL000195v1:82196-82218 ATAGGGATGAAGACTGTTGAAGG + Intergenic
1186186946 X:7030011-7030033 ATGGGGATGGAGAATTGGAATGG - Intergenic
1192448160 X:71225626-71225648 TAGGGGATGCTGAGTTTGGAGGG - Intergenic
1201785854 Y:17778040-17778062 ATGGAAATCCAGACTTTGCATGG + Intergenic
1201815699 Y:18127948-18127970 ATGGAAATCCAGACTTTGCATGG - Intergenic
1201905702 Y:19083987-19084009 ATGGGGATACTGCCTTTGGTAGG - Intergenic