ID: 961199937

View in Genome Browser
Species Human (GRCh38)
Location 3:125037620-125037642
Sequence TTGGTTAGTGCAGCCACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961199931_961199937 13 Left 961199931 3:125037584-125037606 CCACCTCTGCAGAGCAGCTAGAC 0: 1
1: 0
2: 1
3: 19
4: 172
Right 961199937 3:125037620-125037642 TTGGTTAGTGCAGCCACTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 101
961199930_961199937 19 Left 961199930 3:125037578-125037600 CCATGACCACCTCTGCAGAGCAG 0: 1
1: 0
2: 5
3: 51
4: 344
Right 961199937 3:125037620-125037642 TTGGTTAGTGCAGCCACTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 101
961199932_961199937 10 Left 961199932 3:125037587-125037609 CCTCTGCAGAGCAGCTAGACACC 0: 1
1: 0
2: 0
3: 33
4: 994
Right 961199937 3:125037620-125037642 TTGGTTAGTGCAGCCACTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 101
961199929_961199937 20 Left 961199929 3:125037577-125037599 CCCATGACCACCTCTGCAGAGCA 0: 1
1: 0
2: 1
3: 21
4: 178
Right 961199937 3:125037620-125037642 TTGGTTAGTGCAGCCACTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961199937 Original CRISPR TTGGTTAGTGCAGCCACTGC TGG Intronic
900473420 1:2865339-2865361 TTGGAAAGTGCAACCAGTGCAGG - Intergenic
901794648 1:11673291-11673313 TTGGTAGGTGCAGCCACAGTCGG - Exonic
907384026 1:54114172-54114194 TGGGCCAGGGCAGCCACTGCAGG - Intergenic
907544367 1:55246703-55246725 TTGGTTACTGAAGGCACTGGTGG - Intergenic
912252460 1:108025729-108025751 TTGATCACTGCAGCCACAGCTGG - Intergenic
915790310 1:158662682-158662704 TTGGTTAGTACAGCCTGAGCAGG - Exonic
915835222 1:159171287-159171309 CTGGCGAGTGCAGCCACTGCAGG - Intergenic
916649953 1:166825468-166825490 TTGTTTATTGCAGCCACTTCTGG - Intergenic
922150591 1:223000126-223000148 TTGGTTATTTCAGCAACTACAGG + Intronic
922575572 1:226658883-226658905 CTGGTTCGTGTAGCCCCTGCAGG - Intronic
923470899 1:234289915-234289937 TTGGTTTGTGCAGCAGCTCCTGG - Intronic
1063182899 10:3622049-3622071 TTGGGAAGAGCAGCCAGTGCAGG + Intergenic
1064313540 10:14234237-14234259 GTGGTTGGTTCAGCCACTGATGG - Intronic
1065871742 10:29961497-29961519 GTGGTTAGTGCAGGTAATGCTGG + Intergenic
1073131401 10:101191303-101191325 TTGGTTATTGCAGAGACTGTGGG - Intergenic
1073717351 10:106122239-106122261 TTGGGCAGTGCAGACAATGCTGG - Intergenic
1074674458 10:115832331-115832353 TAGGTTGGTGGAGCCTCTGCAGG - Intronic
1077733748 11:4765671-4765693 TTGCTGACTGCAGCTACTGCTGG + Intronic
1084119300 11:67059688-67059710 TAGATCAGTGCTGCCACTGCCGG - Intronic
1085014449 11:73163679-73163701 TTGGTTAATCCAGCCACTAAGGG + Intergenic
1090965883 11:131597411-131597433 TTGCTGAGTGCAGCCTCTGCAGG - Intronic
1091685453 12:2558323-2558345 CTGGTTAGGGCATCCACTGCTGG + Intronic
1094059693 12:26300580-26300602 CTGGTTGTTTCAGCCACTGCAGG + Intergenic
1101438366 12:104683473-104683495 TTGTTCAGTGTAGCCACAGCTGG - Intronic
1101726812 12:107394904-107394926 CTGTACAGTGCAGCCACTGCAGG - Intronic
1105450281 13:20493302-20493324 CTGGTTACTGCAGCCACCACCGG - Intronic
1111766024 13:92530409-92530431 TTTGTCAGTGCAGCCAGTGGAGG + Intronic
1118722509 14:68604438-68604460 CTGGCTGGTGCAGCCACTGGCGG - Intronic
1119495191 14:75071736-75071758 TGGGTGAGTGCAGCCACTGTGGG + Exonic
1122638407 14:103141630-103141652 ATGGTTACTGTAGCCACTGTTGG + Intergenic
1124567790 15:30832524-30832546 TTGTTTTGTGCAGTCACTCCCGG - Intergenic
1126374440 15:47981754-47981776 TTGTTTAGAGCACCCACTTCTGG - Intergenic
1132761101 16:1509043-1509065 TTGGCCAGTGGAGCCACTGATGG + Intronic
1138528727 16:57623376-57623398 TTGGTGAGTGGAGCCTCGGCAGG - Intronic
1139272499 16:65697428-65697450 TTGATTATTTCAGCCACTTCAGG - Intergenic
1139511028 16:67428701-67428723 GTGGTTAGGGCAGTCATTGCTGG - Intergenic
1142159429 16:88549125-88549147 CTGCCTCGTGCAGCCACTGCCGG - Intergenic
1142947090 17:3439013-3439035 TTGGTTATTGCAACCATGGCTGG - Intergenic
1145824526 17:27866862-27866884 ATGGTCAGGGAAGCCACTGCTGG + Intronic
1147925195 17:43941579-43941601 TCTGTTACTACAGCCACTGCTGG - Exonic
1149125645 17:53227951-53227973 TTGGTAAGTGCAGACATTGTGGG - Intergenic
1151924482 17:77184545-77184567 TTGGTGAGTGGAGCCCCTTCAGG + Intronic
1158888919 18:61855359-61855381 CTGTTTGGAGCAGCCACTGCAGG + Intronic
1164931499 19:32179338-32179360 ATGGCTGCTGCAGCCACTGCTGG + Intergenic
925386279 2:3463942-3463964 CTGGTGAGTGCAGCCTCTGTTGG + Intronic
926043631 2:9693831-9693853 TCGTTGTGTGCAGCCACTGCAGG + Intergenic
926903781 2:17786902-17786924 AGGTTAAGTGCAGCCACTGCTGG - Exonic
929842140 2:45478576-45478598 TTAGTTAGTGCAAGCATTGCAGG + Intronic
932417040 2:71579836-71579858 TTGGGCAGTGCAGCCATTGACGG + Intronic
933800789 2:85958848-85958870 TAGGGTGGTGCAGGCACTGCGGG - Intergenic
935835671 2:107050630-107050652 ATGGAGAGTGCAGCCACTGGGGG - Intergenic
942217954 2:173740801-173740823 ATGGTTATTTCAGCCACTGTTGG + Intergenic
1171092749 20:22301428-22301450 TTGTTTGGTGCAGCCACCACAGG - Intergenic
1174331358 20:49821554-49821576 TTTGTCAGTGCAGCCTCTGAGGG + Intronic
1175862542 20:62157952-62157974 GCGGTTGGTGCAGCCCCTGCAGG + Intronic
1181986744 22:26805221-26805243 CGGGTTAGTGCAGCCACTGCGGG + Intergenic
1182725538 22:32442301-32442323 ATGCTCAGGGCAGCCACTGCAGG + Intronic
1183887768 22:40899315-40899337 TTGGTTAGTGCCTTCAGTGCTGG - Intronic
954852537 3:53615824-53615846 TCAGTTAGGGCAGCCACTTCTGG + Intronic
961199937 3:125037620-125037642 TTGGTTAGTGCAGCCACTGCTGG + Intronic
961510128 3:127395780-127395802 TTGGCTAGTCCATCCCCTGCTGG + Intergenic
963271876 3:143292905-143292927 CTGGTTAATGCTGCCGCTGCTGG + Intronic
964084211 3:152797045-152797067 TAAGTTAGCGCAGCCACTGTGGG - Intergenic
964719078 3:159753935-159753957 GTGGTTAGTGCATGCACTGGGGG - Intronic
966220222 3:177544324-177544346 TTGGTTAGTACAGCTGCTCCTGG - Intergenic
968576936 4:1371063-1371085 TTGGTAAGTGGAGGCACTGTGGG + Intronic
969416931 4:7067145-7067167 TTGATTAGAGAAGCCACTGAGGG - Intronic
969635622 4:8368038-8368060 TTAGTAACTGCAGCCACCGCAGG + Intronic
969669471 4:8581810-8581832 TTCATTGGTGCAGACACTGCGGG + Intronic
976354995 4:84106662-84106684 TTGGCTAATGAAGCTACTGCAGG + Intergenic
977694054 4:99947338-99947360 TTCGTTAGGGCAGCCCCTGAGGG - Intergenic
979945779 4:126829979-126830001 TTGGATAGTTCAGCCACAGTAGG + Intergenic
980020759 4:127707080-127707102 GTGGTTATTTCAGTCACTGCTGG + Intronic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
983370931 4:166856992-166857014 TTGGTTAGTGCAGCAGATGTAGG - Intronic
984024100 4:174522446-174522468 GTGCATGGTGCAGCCACTGCTGG + Exonic
987303246 5:16616253-16616275 TTGGTTCTTGCAGCCCCAGCAGG - Intronic
988589933 5:32540133-32540155 TTGGGTGATGCTGCCACTGCTGG + Intronic
988730717 5:33970163-33970185 TTGGTCACTGCAGCAGCTGCTGG - Intronic
989470551 5:41812621-41812643 TTTGTTTTTGCTGCCACTGCTGG + Intronic
993600935 5:89924289-89924311 ATCCTTATTGCAGCCACTGCTGG + Intergenic
995564807 5:113423082-113423104 TTGCTTTGTTCAGCCTCTGCTGG - Intronic
1000723881 5:164743867-164743889 TTGGTCATTGCAGACACTGAAGG - Intergenic
1001775638 5:174327299-174327321 GTGGTTAGTACAGTAACTGCAGG + Intergenic
1002755369 6:154516-154538 GTTGTTAGTGCAGACAATGCTGG - Intergenic
1003165249 6:3671768-3671790 TTGGTTTGTGCAGTCAGGGCAGG + Intergenic
1009700546 6:67172450-67172472 TTGGATAGGGTAGCCAATGCAGG + Intergenic
1009940374 6:70282468-70282490 GGGGTTAGTGCAGCTACGGCGGG + Intronic
1010838691 6:80622558-80622580 CTGCGCAGTGCAGCCACTGCTGG - Intergenic
1011863257 6:91787020-91787042 TAGGTGACTCCAGCCACTGCAGG + Intergenic
1015629558 6:135217784-135217806 TTGGTCAGTGCTGGCCCTGCTGG + Intronic
1016970115 6:149753951-149753973 TTTGTAAGTGGTGCCACTGCTGG + Intronic
1019463333 7:1172900-1172922 TGGGTGAGGGCAGCTACTGCTGG - Intergenic
1025241612 7:57281260-57281282 TAGGCTAGGGCAGCCCCTGCTGG + Intergenic
1027938269 7:84637135-84637157 TGGCCTAGTGCTGCCACTGCTGG - Intergenic
1033024112 7:137756142-137756164 TTGGTTATTAAAGCCTCTGCAGG - Intronic
1035185270 7:157121384-157121406 TTGGCAAATGCAGCCACAGCCGG - Intergenic
1042005694 8:64177706-64177728 TTGGTTAGTTTAGGCACTGAGGG - Intergenic
1042898064 8:73692733-73692755 ACGGTTAGTGCAGACCCTGCAGG - Intronic
1047312042 8:123700134-123700156 TTGGCTGGAGCAGCCACTGTGGG - Intronic
1048555652 8:135473381-135473403 TTGGTTAGTGTTGCTACTTCTGG + Intronic
1048722317 8:137340032-137340054 CTGGTTGGTGCAGGCACTGAAGG + Intergenic
1049279165 8:141735553-141735575 TTGCTGAGTCCTGCCACTGCTGG + Intergenic
1057169049 9:92949882-92949904 TTGGTTAGTTGAGCCTCTGCCGG - Intronic
1062013046 9:134277058-134277080 TTGAGGAGTGCAGACACTGCAGG - Intergenic
1062689850 9:137835595-137835617 TTGGTGGGTGCAGCCCCCGCCGG + Exonic
1190383493 X:49862256-49862278 TTGGTTAGTGCTGCCTCTTCTGG + Intergenic
1197375907 X:125681906-125681928 TTGGTGAGTCTTGCCACTGCTGG + Intergenic
1200005937 X:153084118-153084140 TTGGACAGTGCAGCCCCTGAGGG - Intergenic
1200361202 X:155608947-155608969 TCAGTTAGTTCAGCCACTGTGGG + Intronic