ID: 961200115

View in Genome Browser
Species Human (GRCh38)
Location 3:125038806-125038828
Sequence CTGGAGAAATGGAAAGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 985
Summary {0: 1, 1: 0, 2: 11, 3: 109, 4: 864}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961200108_961200115 12 Left 961200108 3:125038771-125038793 CCTGCTCTTATTCTTGGTGGAGA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG 0: 1
1: 0
2: 11
3: 109
4: 864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961200115 Original CRISPR CTGGAGAAATGGAAAGGAGA CGG Intronic
900423140 1:2564367-2564389 CAGGTGACAAGGAAAGGAGAGGG - Intronic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
901146093 1:7065539-7065561 CTGGAGGAGGGGACAGGAGATGG + Intronic
902235533 1:15055000-15055022 CTGCAGAACTAGCAAGGAGATGG - Intronic
902483021 1:16721687-16721709 CTCGAGAAATAGAAAGGTGCTGG - Intergenic
902561335 1:17279516-17279538 CTTGACCAAGGGAAAGGAGAGGG - Intronic
902615441 1:17621063-17621085 ATGGTGGAAGGGAAAGGAGAAGG + Intronic
902666083 1:17939509-17939531 CAGGACAAATGGCAAGGAAATGG - Intergenic
902688038 1:18091635-18091657 CTTGAAAAATGGGAAGGAGGGGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903670316 1:25031431-25031453 CTGGAGAGATGGAAAGATGGAGG + Intergenic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
903919715 1:26790963-26790985 CCTGAGAGGTGGAAAGGAGATGG - Intronic
905446498 1:38031193-38031215 CTGGAGAATGGGCAAGGAGGTGG + Intergenic
905514547 1:38552564-38552586 TAGGAGAAATGGAGAAGAGACGG - Intergenic
905732545 1:40306550-40306572 CAGGAGGTATGGAATGGAGATGG + Intronic
905782321 1:40722867-40722889 CTAGAGACATGCAAAGGGGAAGG + Intronic
905858517 1:41330712-41330734 CAGGAGAAAAGGAAAGGAGCAGG - Intergenic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906553461 1:46687203-46687225 CTGGAGAAATATAAAGTAGGGGG + Intronic
906644389 1:47463409-47463431 TTGGAGAAAGGAAGAGGAGAAGG + Intergenic
907443644 1:54493535-54493557 CTGGAGTAAAGGGAATGAGAGGG - Intergenic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908837480 1:68242354-68242376 CTGGAGAAAGCAAAAGGACAAGG + Intergenic
908930760 1:69313949-69313971 CAGAAGAAAGAGAAAGGAGAAGG + Intergenic
909040570 1:70644765-70644787 GTGGGGAGAAGGAAAGGAGAGGG - Intergenic
909094504 1:71270832-71270854 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
909394224 1:75151459-75151481 CTGGAGATAAGGCCAGGAGATGG + Intronic
909837603 1:80276598-80276620 ATGGAGAGGTGGAAAGGAGATGG - Intergenic
909917405 1:81337113-81337135 ATGGAGAGCTGGAAAGGGGATGG - Intronic
910009730 1:82446559-82446581 CTTGAGAAATAGAAAGAAGCTGG - Intergenic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
910453605 1:87372313-87372335 CAGGAGAGAAGGAAAGGACAAGG - Intergenic
910488899 1:87746347-87746369 ATGGGGAACTGGAAAGGAGATGG - Intergenic
910643193 1:89486746-89486768 AAGGACAAAAGGAAAGGAGAGGG - Intergenic
910835349 1:91502900-91502922 CTGGAAAAATGGAAAGGAAGAGG - Intronic
910946655 1:92599990-92600012 CTGGAGAAAAGGAAACTGGATGG + Intronic
911386347 1:97179917-97179939 AAGAAGAAAAGGAAAGGAGATGG + Intronic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912041738 1:105398696-105398718 GTGGGGAATTGGAAAGGGGATGG + Intergenic
912373601 1:109192588-109192610 CTGGAGACAAGGAAACAAGAGGG - Intronic
912414454 1:109498530-109498552 AGGGAGAAATGGAAAAGAGGGGG - Intronic
912474213 1:109925360-109925382 CTGAGGACCTGGAAAGGAGAGGG - Intronic
912565456 1:110584403-110584425 CTGTAGAACTGGAAAGAACATGG + Intergenic
912609036 1:111024237-111024259 CTGGTGAAAGGGAAAAGATATGG - Intergenic
912630308 1:111241300-111241322 CAGGGGAAAGGGAAACGAGAGGG - Intronic
913235940 1:116783571-116783593 TTGGAGAAATAGAAATAAGACGG - Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
913551083 1:119917386-119917408 CTGGAGAAAAGGAAATGTCAGGG + Intronic
914680801 1:149936930-149936952 CTGGAAAAGTGGAGAGGAAACGG + Intergenic
915451833 1:156010750-156010772 GTGGAGGAATGGAAAAGAGGGGG - Intronic
915506185 1:156357784-156357806 CTGGAGGAATCAGAAGGAGAAGG + Intronic
915555342 1:156657970-156657992 CCGGGGAAGGGGAAAGGAGAGGG - Intronic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
916790831 1:168123683-168123705 CAGGAGAAAGGGAAAGGAGAAGG - Intronic
917031630 1:170699458-170699480 CTAGATAAATGGCAAGAAGATGG + Intronic
917087576 1:171319196-171319218 CTGGGGAGCTGGAAAGGGGATGG + Intronic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
917245297 1:172994713-172994735 CAAGAGAAAGGGAAAGGTGAAGG - Intergenic
917921398 1:179753618-179753640 CTGGAGAGAAGGATAGGATAAGG + Intronic
917973355 1:180222700-180222722 CGCTAGAAATGGTAAGGAGAAGG - Intergenic
918472419 1:184887550-184887572 GAGGAGAAAAGGAAAGGAGGAGG - Intronic
918528056 1:185486584-185486606 CTGGAGAAGTGGAATGGAGCGGG + Intergenic
918611362 1:186496116-186496138 GTGAAGAACTGGCAAGGAGAAGG + Intergenic
918716046 1:187788296-187788318 CTGGAGAAATAGGAAGCAGGCGG - Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
918981413 1:191564763-191564785 CTGGAGAAATGCAGAAGAAAGGG + Intergenic
919056944 1:192583030-192583052 AGGGAGAAAGGGAAAGGAAAAGG + Intergenic
919182833 1:194107008-194107030 CTAAAGAAATAAAAAGGAGAAGG + Intergenic
919656317 1:200200719-200200741 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
919755961 1:201066440-201066462 CTGGAGGAAAGGGAAGGGGAAGG - Intronic
919793282 1:201305972-201305994 CTGGGGCCATGGAAGGGAGATGG + Intronic
920075216 1:203331116-203331138 CTCGAAAAAAGGAAAGGAGCTGG - Intergenic
920275337 1:204800263-204800285 GTGAAGAGGTGGAAAGGAGAGGG + Intergenic
920600161 1:207316995-207317017 ACAGAGAAAGGGAAAGGAGAAGG - Intergenic
920795570 1:209133093-209133115 ATGGAGAATTGGAAAAGGGATGG + Intergenic
921568150 1:216745598-216745620 CTGGACAAAGGGAAAGGAGGGGG - Intronic
921604204 1:217136677-217136699 CTGGCCAAAAGGAAAGGGGAAGG - Intronic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
922107886 1:222528026-222528048 TGGGAGAAATGGTAAGGAGCAGG - Intronic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
923176546 1:231472060-231472082 GTGGAAAAAAGGAAAGGAGAAGG + Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
923710608 1:236385932-236385954 GTGGGGAGAGGGAAAGGAGAGGG - Intronic
924095678 1:240548381-240548403 CTGAAGAATTGGAAAAGACATGG - Intronic
924166282 1:241286631-241286653 TGGGCCAAATGGAAAGGAGAAGG - Intronic
924313975 1:242776576-242776598 CAGGAGCAAGAGAAAGGAGAGGG + Intergenic
924465377 1:244294652-244294674 CTAGAGAAATGTCAAGGAGGGGG - Intergenic
924793503 1:247274858-247274880 CTGTTGCAATGGAAAGGAGGGGG + Intergenic
1062818514 10:517183-517205 ATGGAGAAGGGAAAAGGAGAAGG - Intronic
1062956897 10:1546481-1546503 GAGGAGAAATGGTGAGGAGATGG + Intronic
1063331073 10:5159980-5160002 CTGGAGAAGTGCAAAGAAGCAGG - Intergenic
1063342683 10:5282873-5282895 CTGGAGAAGTGCAAAGAAGCAGG - Intergenic
1063464285 10:6232959-6232981 CTGCAGAAATGGAAATGGAATGG - Exonic
1063802712 10:9598785-9598807 ATGGAGAAATGGACAGGTGAAGG - Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1064753192 10:18553035-18553057 ATTGGGAAATGGAATGGAGAAGG - Intronic
1065205532 10:23354231-23354253 CTAGATAAATGAAAAGGAAAGGG + Intergenic
1065539469 10:26746976-26746998 CTTGAAAAATGGAAAGTAGAAGG + Exonic
1065908827 10:30283649-30283671 ATGGAGACCTGGAAAAGAGAGGG + Intergenic
1065910906 10:30304668-30304690 GTGGGGAAAAGGAAAGGAAAAGG + Intergenic
1066050092 10:31626116-31626138 ATGGAGATTTGGAAAGGTGAAGG - Intergenic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067424865 10:46200133-46200155 GTGTAGAAAAGGAAAGGAAAAGG - Intergenic
1068104356 10:52594630-52594652 CTGAAGAAATGGAATAGAAAAGG + Intergenic
1068358577 10:55945113-55945135 GTGGAGAGCTGGAAAGGGGATGG + Intergenic
1068685877 10:59869577-59869599 CTGGAGCAAAGGCAATGAGAAGG - Intronic
1069841962 10:71345600-71345622 CTGGAAGAATGAGAAGGAGAGGG + Intronic
1069888035 10:71636203-71636225 CTGGAGTCATGGAAAGCAGTTGG + Intronic
1069917084 10:71793791-71793813 GGGGAGAGATGGAAAAGAGAAGG - Intronic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070438811 10:76422113-76422135 CTGAAGATATGCCAAGGAGAAGG - Intronic
1070861350 10:79666351-79666373 GTGTAGAAAAGGAAAGGAAAAGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071246509 10:83770834-83770856 CTGGGCAAATGGGATGGAGAGGG + Intergenic
1071815156 10:89225016-89225038 CTGAAGAAATGGCAAGGGGAGGG - Intronic
1072065193 10:91861682-91861704 CTGGCCAAGTGGGAAGGAGAAGG - Intronic
1072181264 10:92983282-92983304 ATGGGGAAAGGGAAAGGAGAGGG - Intronic
1072524493 10:96259367-96259389 CAGGGGAAATGGGAAGGAGAGGG + Intronic
1072534000 10:96345980-96346002 CTATAGAAATGGAAAGAAGGAGG - Exonic
1072536486 10:96368230-96368252 AAGGAGAAAGGGAAACGAGAAGG + Intronic
1072853431 10:98921698-98921720 CTGGGGAATATGAAAGGAGAAGG - Intronic
1073107938 10:101043202-101043224 GTGGAGAGAGGGAAAGGAGGAGG - Intergenic
1074087787 10:110221820-110221842 GGGGAGAAAGGGAAAGGACATGG - Intronic
1074364093 10:112844382-112844404 CTGAGGTCATGGAAAGGAGAAGG + Intergenic
1074591491 10:114817952-114817974 CTGTAGAAATAGGAAGGAGATGG - Intergenic
1075848671 10:125568069-125568091 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1075947135 10:126444098-126444120 TCTGAGAAATGGAAAAGAGAAGG + Intronic
1076034243 10:127185674-127185696 TTAGAGAAGTGGAAAGGAGAAGG + Intronic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1076564216 10:131387067-131387089 CTGGAGACTTGAAAAGGTGAGGG - Intergenic
1076844554 10:133062842-133062864 CTGACGAAATGGACAGGAAACGG - Intergenic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077872513 11:6273662-6273684 CTCAAGAAATGGAAAATAGATGG - Intergenic
1078254462 11:9646083-9646105 CTGGAAACATGGGAAGGAGGAGG + Intergenic
1078421070 11:11213444-11213466 CTGGAGTAAAGGCATGGAGAGGG - Intergenic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1079014561 11:16857519-16857541 CTGGAGAAAGGGGATGGACAAGG - Intronic
1079252897 11:18800409-18800431 CTGGAGACTTGGAAGGGTGAAGG + Intergenic
1079316357 11:19411025-19411047 CTGGAGGAATGCAAAAGAAAAGG - Intronic
1079660849 11:23035193-23035215 GTGCTGAAATGGACAGGAGACGG + Intergenic
1079921971 11:26443859-26443881 TTGGAGAGAGGGAAAGGAGTAGG - Intronic
1080238556 11:30099945-30099967 CTGGAGAAAGGAAGAAGAGATGG - Intergenic
1080780855 11:35428773-35428795 CGTGAGATTTGGAAAGGAGAGGG + Intergenic
1080898803 11:36467926-36467948 CTGGAGCAAAGGCAAGGAGTTGG - Intergenic
1081397291 11:42601737-42601759 TAGGAGAAAAGGAAAGGGGAAGG - Intergenic
1081494741 11:43597367-43597389 TTGGATAAATGGGAAGGATAAGG + Intronic
1081662078 11:44894432-44894454 CTAGAGAGAAGGAAAGGAGGCGG - Intronic
1083827895 11:65213540-65213562 CTGGAGGAAAGGGAAGGTGATGG + Intergenic
1083905142 11:65664077-65664099 CTGGAGAAACTGAAATGAGTGGG - Intergenic
1084405655 11:68971367-68971389 CTGGACAAAGAGGAAGGAGAAGG - Intergenic
1084923742 11:72495016-72495038 CTGGAGAAAGCTAAAGGAGGAGG - Intergenic
1085092026 11:73725155-73725177 TTAGAGAAATGGAAAGTATAAGG - Intronic
1085742775 11:79091046-79091068 CAGGAGAAAGGGGAAGGAGTAGG + Intronic
1086103113 11:83122211-83122233 CTGGAGAAATGGAATGAAAGAGG - Intergenic
1086282860 11:85210852-85210874 CCTGTGAAATGGAAGGGAGAAGG - Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087654505 11:100905991-100906013 CTAAACAAATGGAATGGAGAAGG - Intronic
1087898133 11:103610354-103610376 CTGGAGCAAGAGAAAGGCGAGGG - Intergenic
1087986314 11:104685321-104685343 TTTGAGAAATGACAAGGAGAAGG - Intergenic
1088688279 11:112303516-112303538 AAGGAGAAAAGGAGAGGAGAGGG + Intergenic
1088777594 11:113100548-113100570 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1089023075 11:115238453-115238475 CCGGGGAAATGGAATAGAGATGG - Intronic
1089762463 11:120738379-120738401 CTTGAGTGATGCAAAGGAGAGGG + Intronic
1090057513 11:123436271-123436293 CTGGGGAAATGGGATGGAGAGGG - Intergenic
1090611711 11:128477129-128477151 CTGGTGAAATGGCAGGGAGATGG + Intronic
1090972680 11:131656522-131656544 CTTGAGAGATGCTAAGGAGAAGG + Intronic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091674274 12:2477421-2477443 CTGGCTTAATGGAAAGGTGATGG + Intronic
1091819113 12:3461309-3461331 TTGGAGGAATGGAGAAGAGATGG + Intronic
1091848615 12:3677577-3677599 CTGGAGAAGGGGGAAGGAGAAGG - Intronic
1091980155 12:4858212-4858234 CAGGAGAGAGGGAAAGGAGCTGG + Intergenic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1092140781 12:6182082-6182104 CTGGAGGAAGGGACAGGGGATGG + Intergenic
1092216571 12:6688198-6688220 CAGGAGCCCTGGAAAGGAGAAGG - Exonic
1092229929 12:6770582-6770604 CTGGAGAGGCGGAAATGAGAAGG - Exonic
1092533825 12:9367619-9367641 ATGGAGGAATGGCAAAGAGATGG - Intergenic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1093042243 12:14395788-14395810 ATAGAGAAATGGAAAGAATAAGG - Intronic
1093055804 12:14554612-14554634 CTGGAGCAAGGGACAGGAGGAGG - Intronic
1093370311 12:18356668-18356690 ATGGAGAGCTGGAAAGGAGATGG + Intronic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1093966976 12:25338219-25338241 CTGAAGGAATGGAAAATAGATGG - Intergenic
1094071562 12:26420463-26420485 CTTCAGAAATTGAAAGGAAAAGG - Intronic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1094745605 12:33341227-33341249 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1096112521 12:49037949-49037971 ATGGTGAATTGGCAAGGAGAAGG + Exonic
1097136330 12:56859523-56859545 ATGGAGACTTGGAAGGGAGAGGG - Intergenic
1097228991 12:57497572-57497594 CTAGAAAAGTGGGAAGGAGAGGG + Intronic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097266461 12:57748328-57748350 GTAGAGAAATGGGAAGGAGAAGG + Exonic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097915511 12:65016902-65016924 CTGAAGAAATGGAAAAAACATGG + Intergenic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098148835 12:67525787-67525809 GAGGAGAATTGGAAAGGTGAGGG - Intergenic
1098469371 12:70826103-70826125 ATGGAGAGAGGGAAAGAAGAAGG + Intronic
1098595631 12:72271636-72271658 CCAGAGAAAGGCAAAGGAGAGGG - Intronic
1098948678 12:76616455-76616477 CTGGAGAGATGGAATGGAGGGGG + Intergenic
1100100963 12:91105193-91105215 GAGGAAAAATGGAAAGAAGATGG + Intronic
1100172423 12:91990706-91990728 CTGAAGCAAGGGAAAGGAAAGGG - Intronic
1100564428 12:95781655-95781677 ATGGAGAAATAGAAATGACATGG - Intronic
1100635290 12:96429704-96429726 TTGGAGAAATGGAAACAAAAGGG + Intergenic
1100730732 12:97465081-97465103 CTAGAGAGAAGGTAAGGAGATGG - Intergenic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1100864924 12:98847254-98847276 GGGCAGAAATGGAAAGGTGATGG - Intronic
1101453505 12:104805271-104805293 CTGGAGGAAAGGAAAGGACCCGG - Exonic
1101581848 12:106048818-106048840 ATGGAGGGAGGGAAAGGAGAGGG + Intergenic
1102003967 12:109576977-109576999 CTGGGGTCAGGGAAAGGAGAAGG - Intronic
1102517510 12:113459815-113459837 CAGGAGAAAAGGAAAGAATAAGG - Intergenic
1102936797 12:116904221-116904243 CTGGAGAAATGAAAAGGGAAGGG + Intergenic
1103768397 12:123299993-123300015 CTAGAGAGATGGAAAGGGGTGGG + Intronic
1104097693 12:125573345-125573367 GTTTAAAAATGGAAAGGAGAAGG - Intronic
1104302194 12:127574542-127574564 CTGGATGTTTGGAAAGGAGATGG - Intergenic
1104375376 12:128261467-128261489 TGGGAGAAATGCAGAGGAGAAGG + Intergenic
1104590974 12:130084474-130084496 CAGGAGAAATGCACAGCAGAAGG + Intergenic
1104959135 12:132479920-132479942 CTGGAGAAATGGGGAGGAAAGGG + Intergenic
1105886646 13:24648594-24648616 GTGGAGGAATGGAAAAGAGAGGG - Intergenic
1106081559 13:26504971-26504993 AGAGAGAAAAGGAAAGGAGAAGG + Intergenic
1106084927 13:26533155-26533177 CTGGAGAAAGGGAAAGAACCAGG - Intergenic
1106386186 13:29288421-29288443 TTTGAGGAATGGAAAGGGGAAGG + Intronic
1106598622 13:31168741-31168763 CTGGAGACATGGCAGGGACAAGG - Intergenic
1106706086 13:32281329-32281351 GTGGACAAATGGAAAGAATATGG - Intronic
1106845033 13:33729446-33729468 ATTGAGAAATGGAAAGGTTAAGG + Intergenic
1107592024 13:41919112-41919134 CTGGAGAACTGCAAAGGAGTAGG + Intronic
1107767846 13:43756496-43756518 AGGGAGAGAGGGAAAGGAGAGGG + Intronic
1108158984 13:47618500-47618522 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
1109097530 13:58136814-58136836 ATGGAGAAGTGGTAAGCAGAGGG + Intergenic
1109233959 13:59792839-59792861 CTGGAGTAATGCCAAGAAGATGG - Intronic
1109456308 13:62595997-62596019 ATGGAGAAATGGCAAAGAGAAGG + Intergenic
1109518475 13:63476408-63476430 ATTCAGAAGTGGAAAGGAGAAGG - Intergenic
1109759117 13:66803630-66803652 CTAGAGTAATGGAGAGGAAAGGG - Intronic
1110028882 13:70579866-70579888 CTAGAGAAATGAAAAGCAAATGG + Intergenic
1110080943 13:71310382-71310404 CTGGAGAAATGGTAATTTGAAGG - Intergenic
1110149289 13:72230107-72230129 CTAGGGAGATGGGAAGGAGATGG + Intergenic
1110958001 13:81581050-81581072 CTGTAGTAATTGAAAGGTGAAGG + Intergenic
1111101756 13:83597458-83597480 CTGGAGATCTTGAAAGGAGCAGG - Intergenic
1111480576 13:88820260-88820282 CTGGTGTAATGGAAAGAAGCCGG - Intergenic
1111894913 13:94129452-94129474 CTGGAGACTTGGAAAGGAAATGG - Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112161592 13:96874052-96874074 CTGCAGAAACAAAAAGGAGAGGG + Intergenic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113382179 13:109813990-109814012 CTGGAAGAAGGGAAAGGGGAGGG + Intergenic
1113574467 13:111384143-111384165 AAGGACAAATGGAAAGGAGAGGG - Intergenic
1113664104 13:112128842-112128864 TTGGAGAAAAGGAAAAGAGGCGG - Intergenic
1113827240 13:113265839-113265861 CTGTAAAAGTGGAAAGGAGAAGG + Intronic
1114573915 14:23695352-23695374 CGGGAGAAGAGCAAAGGAGATGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115404669 14:33001216-33001238 CTGGTGAAATGGACAGAAAATGG + Intronic
1115899563 14:38129629-38129651 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1116553476 14:46272435-46272457 ATGAAGAAAGGGAAGGGAGACGG + Intergenic
1116948318 14:50856658-50856680 CAGGAGGAATGGAAAAGAGGAGG - Intergenic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117211373 14:53503893-53503915 ATGGACAAATGGAGAGGAGAAGG + Intergenic
1117458496 14:55921460-55921482 CTTTAGAAATGGAAAAGACAAGG + Intergenic
1117538915 14:56727714-56727736 CTGCAGATATGGAAATAAGAAGG + Intronic
1117749717 14:58908613-58908635 CTGGAGACTTGGAAGGGTGAGGG + Intergenic
1118749409 14:68795397-68795419 CTGGAAAAAAGCAAAGGGGAAGG + Intronic
1119140626 14:72264025-72264047 CTGCAGAAATGTTAATGAGATGG - Intronic
1119529270 14:75348265-75348287 CTCCAGAAATGGAAATGAGGAGG - Intergenic
1119855453 14:77897088-77897110 CTGGAAAGATGGGAAGGGGAAGG + Intronic
1120255005 14:82107378-82107400 CTGGAGAGATGGAAAGTGGGAGG + Intergenic
1121226622 14:92325911-92325933 GTGGAGAAATAGAAAGTTGATGG + Exonic
1121777075 14:96598140-96598162 CAGGAGAAAGGGAGAGGAGGGGG - Intergenic
1121901030 14:97693672-97693694 CTGGAGATATCGAAAGGTGTTGG + Intergenic
1123127940 14:105962789-105962811 TTGGAGAACTTGAAAGGAGAAGG + Intergenic
1123408457 15:20038932-20038954 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123517781 15:21045573-21045595 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123602024 15:21982617-21982639 CTCTAAAACTGGAAAGGAGAGGG - Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1125375558 15:39025104-39025126 ATGCAGAAGTGAAAAGGAGAGGG + Intergenic
1125462217 15:39918223-39918245 CTACAAAAATGGAAAGGACATGG + Intronic
1125842011 15:42811687-42811709 CTGGAGAAAAATAAAGGACAAGG - Exonic
1126245366 15:46498786-46498808 CTGCACAAATGGAAAGGAGTAGG - Intergenic
1126567165 15:50112772-50112794 CTGGGGAGGTGGAAATGAGATGG - Intronic
1126834516 15:52646208-52646230 CTGGAGAAATAAAAAGTGGACGG + Intronic
1127274895 15:57433702-57433724 CTGGAGAAATGGAACTGGAATGG + Intronic
1127537558 15:59904246-59904268 AGGGAGAAATGGAAAGAAGAAGG + Intergenic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128618137 15:69126363-69126385 GGGGTGAAATGGAAAGGTGAAGG - Intergenic
1129272898 15:74428784-74428806 CTGGAGAGATGGCAAGGCCAGGG + Intronic
1129669242 15:77598001-77598023 CTAGGGAGATGGAAAGGAGCTGG + Intergenic
1129915286 15:79264789-79264811 CTTGAAAAAAGGAAAGGAGGGGG + Intergenic
1130312538 15:82767863-82767885 CTGGAGAAATGAAGAGGTGTTGG - Intronic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1131669160 15:94600739-94600761 CTGGAGGAGGGGGAAGGAGAAGG - Intergenic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1131862894 15:96673748-96673770 ATGGAGAAATGAGAAAGAGAAGG - Intergenic
1131937771 15:97525742-97525764 ATGGAAAAAAGGAAAGAAGAAGG + Intergenic
1132207495 15:99996342-99996364 CTAGAGTACTGGAAAGGGGAGGG + Intronic
1132407620 15:101553659-101553681 CTCTAGAAATGGAAAAGACAAGG - Intergenic
1202974131 15_KI270727v1_random:272423-272445 CTCTAAAACTGGAAAGGAGAGGG - Intergenic
1132794821 16:1714640-1714662 CTGGGGAGAAGGAAAGGTGATGG - Intronic
1133525083 16:6597311-6597333 ATGGAGACAGGGAAAGGAAAAGG - Intronic
1133567856 16:7011843-7011865 CATGAGAAATGGGAAGGAGTGGG + Intronic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1134016286 16:10890674-10890696 CGGAAGAAATGGAAGGGAAAGGG + Intronic
1134194673 16:12150192-12150214 GTGGAGAAGTGGATAGGAGGAGG + Intronic
1134330670 16:13248353-13248375 TTGGAGAAGGGGGAAGGAGAAGG - Intergenic
1134666601 16:16023522-16023544 ACGGAGAAATGGAAAGAAAATGG - Intronic
1134777954 16:16869217-16869239 CTGCAGAAAAGCAAAGGAAAAGG - Intergenic
1134849120 16:17466184-17466206 ATGGGGAAATGCAAAGGAAAAGG + Intronic
1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG + Intergenic
1135050167 16:19186023-19186045 CTCTTCAAATGGAAAGGAGATGG - Intronic
1135106867 16:19657413-19657435 CTGCAGAAATGGGAAGGCCAAGG - Intronic
1135409888 16:22225656-22225678 CTGGACAAATGCAGAGGCGAAGG - Exonic
1135678393 16:24436695-24436717 ATGGGGAGTTGGAAAGGAGATGG - Intergenic
1135940005 16:26814441-26814463 CTGCAGAAATGCAATGGAGATGG - Intergenic
1136250139 16:28999007-28999029 AGGGAGAAAGGGAAAGGAAAAGG - Intergenic
1136465882 16:30443367-30443389 CTTGAAAGATGGAAAGGAGGTGG - Intergenic
1137063061 16:35809785-35809807 CAGGAGAAAAGGAGGGGAGAGGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137941437 16:52691593-52691615 TTGGACACATGAAAAGGAGAGGG - Intergenic
1138293438 16:55867471-55867493 CTGGAGAACTGGAAAATGGAGGG - Intronic
1139187008 16:64818639-64818661 CTGGAGAAACTGCAAGGTGAGGG - Intergenic
1139194016 16:64897224-64897246 CTAGAGAACTGGGAAGGAGGTGG + Intergenic
1139270592 16:65678998-65679020 CTGGAAAAATAAAAAGGAGGAGG + Intergenic
1139298329 16:65922334-65922356 GTGGAGCAGTGGAGAGGAGAGGG - Intergenic
1139809043 16:69597184-69597206 CTAGAGAAGAGGGAAGGAGAGGG + Intronic
1140199781 16:72885751-72885773 GAGGAGAAGAGGAAAGGAGAAGG + Intronic
1140213698 16:72990590-72990612 GAGGAGAACTGGAAAGAAGAGGG - Intronic
1140250172 16:73288214-73288236 GTGGAGAGGTGGGAAGGAGATGG + Intergenic
1140602284 16:76491506-76491528 CTGGAGAGCTGGAAATGAGGGGG - Intronic
1140820636 16:78659683-78659705 CTGGTAAAATGGGAAGGAAAAGG - Intronic
1141025425 16:80541722-80541744 GTGGAGAAATGGAAAGGCCAGGG + Intronic
1141068813 16:80934862-80934884 TTGGAGATGGGGAAAGGAGATGG + Intergenic
1141092195 16:81137859-81137881 CTGGAGGAAAGGGAAGGAGCAGG - Intergenic
1141909009 16:87045793-87045815 CTGGGGAGATGGGTAGGAGATGG - Intergenic
1142359730 16:89620362-89620384 GTTGAGAAATGGAGAGGAGGGGG - Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142889830 17:2936052-2936074 GTGGAGACAGGGAGAGGAGATGG - Intronic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143416311 17:6753542-6753564 CTTGAGAAATGAAAAGAAAATGG + Intergenic
1143702091 17:8668232-8668254 TGGGAGAAATGGAGAGAAGATGG - Intergenic
1143724218 17:8834302-8834324 CTGGAGCAGAGGAAATGAGAGGG + Intronic
1143737350 17:8922118-8922140 CTGGAGAATAGGAAAGAAGGAGG + Intronic
1143757495 17:9077689-9077711 CAGGAAAATTGGAAAGGTGATGG + Intronic
1144220262 17:13093436-13093458 GGAAAGAAATGGAAAGGAGATGG + Intergenic
1144371304 17:14594294-14594316 CAGGAGATATGGATAGAAGAGGG + Intergenic
1144463669 17:15479276-15479298 CTGGGGAAGTGGAAAGGATCTGG + Intronic
1145029383 17:19493111-19493133 CTGGAGCAAGGGAAAACAGATGG + Intergenic
1145408216 17:22629275-22629297 GTGTAGAAAGGGAAAGGAAAAGG + Intergenic
1146390226 17:32415365-32415387 CAGTAGGAAAGGAAAGGAGAAGG + Intergenic
1146405540 17:32533665-32533687 CTGGAGAGCTGGGAAGGAGCAGG - Intronic
1146604030 17:34242815-34242837 TTCGAGAAATGGAAATGAGGAGG + Intergenic
1146724941 17:35148950-35148972 CTGAGGAAAGGGGAAGGAGAAGG - Intronic
1146922236 17:36721435-36721457 TTACAGAAATAGAAAGGAGAGGG - Intergenic
1147488846 17:40844841-40844863 CTGGACAAAGGGAGATGAGATGG + Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147776490 17:42905529-42905551 AAGAAGAAAAGGAAAGGAGAAGG + Intronic
1147844623 17:43396184-43396206 ATGAACAAATGGGAAGGAGAAGG - Intergenic
1147879252 17:43643385-43643407 CTGGAGGAAGAAAAAGGAGAAGG + Intronic
1148536390 17:48442581-48442603 CTAGAGAAGTTGGAAGGAGAAGG - Intergenic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149336843 17:55644224-55644246 CTGGAGCCCTGGTAAGGAGATGG + Intergenic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1151171894 17:72253611-72253633 CAGGATAAATGAAAAGGAGAGGG + Intergenic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1151437312 17:74105848-74105870 CTCGAAGAATGGAAAGGGGAAGG + Intergenic
1151507864 17:74541293-74541315 CTGGAGAAATGGAAGGGTGCAGG + Exonic
1153404572 18:4722221-4722243 CAGGAGTGATGGAAAGGTGAGGG + Intergenic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1153676782 18:7462772-7462794 CAGGAAACATGAAAAGGAGATGG - Intergenic
1154077213 18:11215142-11215164 GTGGAGAAATGGAAAAGCAAAGG - Intergenic
1155236200 18:23821866-23821888 CAGAAGAGAAGGAAAGGAGAGGG - Intronic
1155528467 18:26741870-26741892 GTGGAGAGATGGAAAGAAGCCGG + Intergenic
1155706343 18:28819238-28819260 CTGGCGAAATGCAAAGAAAAAGG - Intergenic
1155795293 18:30027851-30027873 ATGAAGAAATGGAAAGCAAAAGG - Intergenic
1155811153 18:30236816-30236838 CTGGAAAAATTGAAAGGAATTGG - Intergenic
1156105415 18:33653588-33653610 CTGGAATAAAAGAAAGGAGAAGG - Intronic
1156300915 18:35835146-35835168 CTGGAAAAATAGTAAGGAGAAGG + Intergenic
1156484047 18:37453620-37453642 CAGGAGCAATGGCAAGGAGGTGG + Intronic
1157113229 18:44840637-44840659 CTGGAGTAATGAGAGGGAGATGG + Intronic
1157308161 18:46531882-46531904 GTGGAGAAAAGGATAGGAGTAGG + Intronic
1157589319 18:48826900-48826922 GTGGGGAAATGGAATGGGGAAGG + Intronic
1158125513 18:54095860-54095882 GAGGAGAAGGGGAAAGGAGAGGG + Intergenic
1158859699 18:61580434-61580456 CAGGGGAAGGGGAAAGGAGAAGG - Intergenic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1159447392 18:68557524-68557546 GTGGGGAATTGGAAAGGGGATGG + Intergenic
1159499189 18:69247139-69247161 CTAGAGAAATGGCAATAAGAGGG - Intergenic
1159571520 18:70119467-70119489 AAGGAGAAAGGGAAGGGAGAAGG + Intronic
1159873153 18:73781300-73781322 TGGGAGAAATGGAAAGAAAATGG - Intergenic
1159946202 18:74446532-74446554 CTGGAGGGAAGGAAATGAGAAGG - Intronic
1160172838 18:76568736-76568758 TGGGAGGCATGGAAAGGAGATGG + Intergenic
1160914987 19:1492050-1492072 CTAGAGATTTGGAAAGGGGAAGG - Intronic
1161347207 19:3774356-3774378 CCCTAGAGATGGAAAGGAGAGGG + Intergenic
1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG + Intergenic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1162941330 19:14011343-14011365 TTGGAGAAATGGGTAGGAGGTGG - Intergenic
1163823865 19:19511929-19511951 AGGGAGAGAGGGAAAGGAGATGG - Intergenic
1164291453 19:23872679-23872701 CAGGAGATATGCAAGGGAGAAGG - Intergenic
1164292322 19:23879639-23879661 AAGAAGAAAAGGAAAGGAGAAGG + Intergenic
1164301690 19:23967737-23967759 CAGGAGATATGCAAGGGAGAAGG - Intergenic
1164678931 19:30121247-30121269 ATGGAGAAATGGATGGGGGATGG - Intergenic
1164895930 19:31877691-31877713 CTGAGGACATGGAAAGGAGTAGG + Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166112278 19:40629826-40629848 TTGGAGAAATAGACAGGAGGAGG - Intergenic
1166184591 19:41131577-41131599 CTGGAGACACTGAAAAGAGATGG + Intergenic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1167922515 19:52793514-52793536 CTGGAGCAGTGGAAGAGAGAAGG + Intronic
1168098259 19:54127754-54127776 ATGGGGAGAGGGAAAGGAGAAGG - Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
925229461 2:2220061-2220083 ATGGAAAAGTGGAAAGGAAAGGG + Intronic
925242970 2:2349257-2349279 GTGGAGAAAGGGAACAGAGAAGG + Intergenic
925392757 2:3508937-3508959 GGGGAGAAAAGGAGAGGAGAGGG + Intronic
925706324 2:6687083-6687105 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
926108731 2:10168730-10168752 CTGGATAAATGGAAAAGAAAAGG - Intronic
926794314 2:16606373-16606395 CTGGAGAGAGAGAAAGGAGGAGG - Intronic
927002419 2:18811943-18811965 TTGGAGAAGTGGAGGGGAGAGGG + Intergenic
927438546 2:23091466-23091488 ATGGACAAATGGAAAGGAAGTGG - Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
927851554 2:26503193-26503215 GGGGAGAAATGGAGAGGACAGGG - Intronic
927926598 2:27018078-27018100 CTGAAGAAAAGGAAAGGCAATGG - Intronic
928316316 2:30249491-30249513 CTGGAGTAAGTGAAAGGAGGAGG + Intronic
928792890 2:34979979-34980001 AAGGTGACATGGAAAGGAGAGGG + Intergenic
928933133 2:36645907-36645929 CTGGAGAAGTGAAAGGGAGAAGG + Intronic
929249565 2:39738012-39738034 CTGGAGTAATGGAAAAGACCAGG + Intronic
929385709 2:41403722-41403744 AGGGAGAAAAGGAAAGGGGAAGG + Intergenic
930361588 2:50387183-50387205 CAGGAGGAATGAAAAGGAGGTGG + Intronic
930765969 2:55085412-55085434 CTGGAGACCTGGAGAGGAGTGGG + Intronic
930774167 2:55156527-55156549 TTGCATAAATGGAAAGGAGCAGG - Intergenic
930851319 2:55964054-55964076 GTGGAGATATGGAAAAGAGCAGG + Intergenic
930934813 2:56935791-56935813 ATGGAGAAAAGGAAAGGAGCAGG + Intergenic
931099546 2:58980866-58980888 CAGGAGAAATTGAAAGGATTAGG - Intergenic
931296390 2:60930098-60930120 ATGGAGAAATGGAAAGAATAGGG + Exonic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
931994180 2:67824015-67824037 CTAGAGGAGTGGAGAGGAGAGGG - Intergenic
932082129 2:68724777-68724799 CTGAGAAAATGGAAAGGAGAAGG - Intronic
932479422 2:72029908-72029930 CAGGAGAAATGGAAAGAAACAGG + Intergenic
932876498 2:75457787-75457809 CTGGGGAAATGGGAAGATGAGGG - Intergenic
933127426 2:78626690-78626712 CTGGATTAATTGAAAGAAGATGG + Intergenic
933342854 2:81044621-81044643 AAGAAGAAAAGGAAAGGAGAAGG + Intergenic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
933481076 2:82857975-82857997 ATGGAGAAATGGAACTGAGAAGG + Intergenic
933674326 2:85040467-85040489 CAGGAGAAATGGAAAAGAGGTGG - Intronic
934615361 2:95767401-95767423 CTGGAGAGTAGGAGAGGAGAGGG - Intergenic
934645544 2:96057158-96057180 CTGGAGAGTGGGAGAGGAGAGGG + Intergenic
934751751 2:96798295-96798317 CTTGTGGAATGGGAAGGAGAAGG + Intronic
934838948 2:97613247-97613269 CTGGAGAGTGGGAGAGGAGAGGG + Intergenic
935547003 2:104410958-104410980 CTGAAGAAATAGAAGTGAGATGG + Intergenic
936068394 2:109349315-109349337 CTTGATAAAAGGAAGGGAGAAGG - Intronic
936414842 2:112297081-112297103 CTTGAGAAATTGAAAGTAGCTGG + Intronic
936984912 2:118300010-118300032 CAGGAAAAACTGAAAGGAGAGGG + Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937487059 2:122326272-122326294 CTGGAGGAAAAGAAAGGGGAAGG + Intergenic
937818214 2:126276433-126276455 AAGGAGAAAAGGAAGGGAGAAGG + Intergenic
938610123 2:132938719-132938741 CTGGAGAAAGGTAGAGGAAAGGG + Intronic
938739804 2:134220407-134220429 CTGCACTAATGGAAAGGAGCAGG + Intronic
939547530 2:143571654-143571676 CTGGAGAAGTAGAAAGGATGAGG - Intronic
939691686 2:145269830-145269852 CTGGAGAAAAGGAAAGGGGTTGG - Intergenic
940133704 2:150412578-150412600 CTGGAGTAGTTGAAAGGACATGG - Intergenic
940197393 2:151110822-151110844 ATGGAGCAATTGAAAGGATAAGG - Intergenic
940274702 2:151927143-151927165 AGGCAGAAATGGATAGGAGAAGG + Intronic
940550779 2:155153002-155153024 CTAGACAAATGCAAAGGAAATGG + Intergenic
940581884 2:155590732-155590754 CAGGACAAAGGAAAAGGAGAGGG + Intergenic
941215839 2:162707993-162708015 CAAGAGAAATGGGAAGTAGATGG - Intronic
941334981 2:164230819-164230841 CTGGTGAAATGGACAGGGAATGG + Intergenic
941499989 2:166262297-166262319 CTGAATAAATGGAAAGGAAAGGG + Intronic
941873832 2:170413315-170413337 CTACAGCACTGGAAAGGAGAAGG + Intronic
941968839 2:171328206-171328228 CTGGATAGAGGGAGAGGAGAAGG + Intronic
942338118 2:174913235-174913257 CTGGAGAAATGCAGGGGAAATGG + Intronic
942933137 2:181520518-181520540 CTGGATTAAAGGAGAGGAGAAGG + Intronic
943057476 2:182999992-183000014 CTCCAGAAGTGGGAAGGAGAGGG + Intronic
943060146 2:183034502-183034524 GTGGAGGAAAAGAAAGGAGAAGG + Intronic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
943408607 2:187518737-187518759 CTGGGAGAATGGAAAGGAGCTGG - Intronic
943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG + Intronic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
943749191 2:191494081-191494103 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
944511665 2:200471766-200471788 CAGGAGAAATGGAAAGGCCAGGG - Intronic
945012371 2:205479256-205479278 AAGGAGAAGTGGGAAGGAGAAGG - Intronic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945179238 2:207074969-207074991 TTGGAGAAAGGGAAAGCAAAAGG - Exonic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945299021 2:208198908-208198930 CTGGAGAAATTTAAAGGCTATGG - Intergenic
946406154 2:219493049-219493071 ATGGAGAAGTGGAGAGGAAAAGG + Exonic
946489394 2:220133098-220133120 CAGTAGCAATGGAATGGAGAAGG - Intergenic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
946832114 2:223737525-223737547 AAGGAGAAAGAGAAAGGAGAGGG - Intergenic
947159552 2:227198621-227198643 CTGGAGAAATGAAAATGAATGGG + Intronic
947177092 2:227378741-227378763 ATGGAGCAATGGAAAGTTGAAGG + Intronic
947772739 2:232683639-232683661 CTGAAGAAATAGGAAGGAGCAGG - Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
949027454 2:241773302-241773324 CTGGAAAAATAAAAAGGAGCTGG + Intergenic
1168803166 20:656749-656771 GTGGAGAAATGGAAAGGCAAAGG + Intronic
1169110266 20:3028194-3028216 CTGGGGCACTGGGAAGGAGAGGG - Intronic
1169140935 20:3227219-3227241 CTGGAGAAATGGCCATGCGAAGG + Intergenic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169495756 20:6113376-6113398 CTGGAAAAAGGAAAGGGAGAGGG - Intronic
1169692350 20:8345680-8345702 CTGGAGAAAGGGCAAGGTGGAGG + Intronic
1169874186 20:10278865-10278887 CTGGAGGAGTGGGAAGGAGGTGG + Intronic
1169930168 20:10824036-10824058 TTGGAGGAATGGAGAGGATATGG + Intergenic
1170272068 20:14538344-14538366 CTGGAGCAATGGAGGAGAGATGG + Intronic
1170280323 20:14639220-14639242 CAGGAAAAAAAGAAAGGAGAGGG - Intronic
1170694365 20:18645303-18645325 CTGCAGAAATGGAAACAAGGAGG + Intronic
1170965897 20:21071393-21071415 CTCGTGAAATGGAAAGGTAAAGG - Intergenic
1171084947 20:22229519-22229541 CTGGAGAAAAGAAAGGGAGTGGG + Intergenic
1171172655 20:23029236-23029258 GTGCAGAAATGGAAAGGCCATGG - Intergenic
1171565019 20:26174487-26174509 ATAGAGAAATCTAAAGGAGAGGG + Intergenic
1172080797 20:32339067-32339089 CTGGAGTGATGGAATGGGGATGG + Intergenic
1172396202 20:34607511-34607533 ATGGAGAGCTGGAAAGGGGATGG - Intronic
1172806963 20:37619018-37619040 AAGGAGAAAGGGAGAGGAGAGGG - Intergenic
1173022103 20:39275231-39275253 GTTGAGAAATGTAAAGAAGACGG + Intergenic
1173456831 20:43209563-43209585 ATGGAAAAATAGAAAGCAGATGG + Intergenic
1173566235 20:44040395-44040417 CTGGAGAAAGGAAAGGGAGCTGG + Intronic
1173633720 20:44536445-44536467 CAGCGGAAAGGGAAAGGAGAGGG + Intronic
1173806201 20:45926954-45926976 CTGGAGAAATGGAAAGCCTTAGG + Intergenic
1174031513 20:47632244-47632266 TGGGAGAAATGTATAGGAGAAGG + Intronic
1174060991 20:47833015-47833037 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174070906 20:47898355-47898377 CTGGAGACCTGGACAGGAGCTGG + Intergenic
1174100197 20:48121427-48121449 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174100597 20:48123688-48123710 CTGGAGATCTGGACAGGAGCTGG - Intergenic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174153154 20:48500304-48500326 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174153602 20:48502870-48502892 CTGGAGAACCAGAAAGGAGCTGG - Intergenic
1174441639 20:50560273-50560295 CTGGAAAAATGTAAACCAGAAGG - Intronic
1174932874 20:54834451-54834473 CTGGAGAAGGGGAAAGGAGGAGG + Intergenic
1174979298 20:55375212-55375234 CTATAGAAATGGAAACAAGAAGG - Intergenic
1175065310 20:56279618-56279640 CAAGAAAAATGAAAAGGAGAGGG + Intergenic
1175206341 20:57314607-57314629 TTGGAGAAAAGGCAAGGAGTGGG + Intergenic
1175262282 20:57682128-57682150 CTGGATAAATGAACAGAAGATGG + Intronic
1175616641 20:60405365-60405387 ATGGAGAAGGGGGAAGGAGAAGG + Intergenic
1175621922 20:60454677-60454699 GTGGAGACATTGAAAGGACAGGG - Intergenic
1175631471 20:60541574-60541596 CAGCAGAAATGCAAAAGAGATGG - Intergenic
1175637323 20:60596738-60596760 ATGGAGACATGGATAGGACATGG - Intergenic
1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG + Intronic
1175814496 20:61876459-61876481 CCGGAGAACTGGGAAGGGGAAGG + Intronic
1176515906 21:7783259-7783281 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1176893559 21:14348407-14348429 ATTGAGAAAAGGAAAGAAGACGG + Intergenic
1177972117 21:27803037-27803059 CTAGAGAAAGAGAATGGAGAGGG - Intergenic
1178087048 21:29122515-29122537 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1178649934 21:34413271-34413293 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1178683225 21:34690806-34690828 CTGGGGAAAAGAAAAGGAGGGGG - Intronic
1178685534 21:34707823-34707845 CTTGAGAACTGCAAAGTAGATGG - Intronic
1178836868 21:36105526-36105548 CTAGGGAAAGGGGAAGGAGAGGG + Intergenic
1179329115 21:40381288-40381310 ATAGAGATATGGAAAGGGGAAGG + Intronic
1179464061 21:41559789-41559811 CAGAAGAAATGAAGAGGAGAAGG + Intergenic
1179489868 21:41734294-41734316 CAGGAAAGATGGAAAGGAAAAGG + Intergenic
1180570976 22:16718307-16718329 CTGGAGAAATGAACTGGAGGAGG + Intergenic
1180902786 22:19386699-19386721 CTTGGGAAATGGTAAGCAGATGG + Intronic
1181416356 22:22762257-22762279 CTGCAGGAGAGGAAAGGAGAGGG - Intronic
1181978248 22:26747781-26747803 CTGGAGGAAGTGAAGGGAGAGGG + Intergenic
1182035725 22:27196831-27196853 CTGGAGACATGCAGAGGAAAGGG - Intergenic
1182689726 22:32150627-32150649 CTGAAGGAAGGCAAAGGAGAAGG + Intronic
1182689845 22:32151701-32151723 CTGAAGGAAGGCAAAGGAGAAGG + Intronic
1182730129 22:32482342-32482364 TTGGAGAAATGGAGGGGAGCCGG - Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183141191 22:35941518-35941540 CTGGAAAAATGGAAAGAACAGGG - Intronic
1183228008 22:36563483-36563505 CTTGAGGAAAGGGAAGGAGAGGG - Intergenic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1184002004 22:41681943-41681965 CTGGAGCAGTGGGAATGAGATGG - Intronic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
1185183259 22:49376228-49376250 CTTTAGAAATGCAAAGGATACGG + Intergenic
1185236825 22:49718747-49718769 CTGGAGAATGAGAGAGGAGAGGG - Intergenic
949143539 3:665871-665893 GTGAAGAAATGGAAAGAAGCTGG - Intergenic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949448791 3:4163883-4163905 CTGTAGAAATGGAAAATATATGG - Intronic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
950617367 3:14171871-14171893 CTAGAGAAAAGGAGAAGAGATGG + Intronic
951494377 3:23309933-23309955 GAAGAGAAAAGGAAAGGAGAAGG + Intronic
952007928 3:28863836-28863858 CTGGTGAGAGGGAAAGGAGAAGG - Intergenic
952303040 3:32121193-32121215 CAAGAGAAATGGAAAGGATCAGG - Intronic
953023916 3:39134043-39134065 CTGGAGAACTGCATGGGAGAAGG + Intronic
953349692 3:42206066-42206088 CTGGAGAAATGGAAAGAAAGAGG + Intronic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
953830344 3:46292064-46292086 GTAGAAAAATGGAAAGGATAAGG + Intergenic
954069324 3:48131319-48131341 CTGGTGTAATGGAAAGGTGAAGG - Intergenic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
954659806 3:52221037-52221059 CTGGAGGCATGGACAGGAGGAGG - Intergenic
955127718 3:56130709-56130731 ATGGAGAAATTGAAATGTGATGG - Intronic
955239492 3:57166296-57166318 CTGGAGAAATGTATCGGACACGG - Intronic
955497779 3:59553755-59553777 GGAGAGAAATGGAAAGGAGGTGG + Intergenic
955851483 3:63224725-63224747 CTGGAGAAATTGAGGAGAGAAGG + Intergenic
955855800 3:63272104-63272126 CGACAGCAATGGAAAGGAGATGG - Intronic
955871169 3:63440274-63440296 CTGAAGAGTAGGAAAGGAGAGGG + Intronic
956109734 3:65858634-65858656 TTGGAGAAGAGGAAAGGAGGAGG + Intronic
956348207 3:68304211-68304233 ATGAAAAAATGTAAAGGAGAAGG + Intronic
956931191 3:74045191-74045213 CTGGATAAATTGAAAACAGATGG - Intergenic
956962194 3:74416027-74416049 TTAGAGAAAAGGAATGGAGATGG - Intronic
957244706 3:77702378-77702400 GTGGAGAGCTGGAAAGGGGATGG - Intergenic
957591463 3:82204913-82204935 ATGAGGAACTGGAAAGGAGATGG + Intergenic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
958196804 3:90251644-90251666 CCGGAGAAATAGGAAGAAGAGGG + Intergenic
958420229 3:93921512-93921534 CGGGAGAAATAGGAAGAAGAGGG + Intronic
958432639 3:94060346-94060368 ATGGAGAAATGGAACTGAGAAGG - Exonic
958439028 3:94133222-94133244 ATGGCAAAAAGGAAAGGAGAGGG + Intergenic
958453243 3:94299629-94299651 CTCAATAAATGGAAAGGAAAAGG + Intergenic
958962625 3:100524443-100524465 CAGGGGAAAGGGAAAAGAGAAGG - Intronic
959090763 3:101900258-101900280 TGGGAGAAAACGAAAGGAGAGGG + Intergenic
959486634 3:106934500-106934522 GTGGGGAACTGGAAAGGGGATGG - Intergenic
959546228 3:107599596-107599618 CTTGAAAAATGGAAAGGTGTTGG + Intronic
960092058 3:113650818-113650840 CTGGGGAAAGAGAAAGGAGGGGG - Exonic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
961194088 3:124986734-124986756 TTGGACAAATGGGAAGGAAAAGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961545790 3:127632055-127632077 CTGGAGCCATGGAAATGACAGGG + Intronic
961931276 3:130536033-130536055 CTGGAGAAATGGCTAGAATAAGG - Intergenic
962062456 3:131944504-131944526 CAGGAGAAATGTAATGGTGAGGG + Intronic
963762202 3:149295276-149295298 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
963766084 3:149337306-149337328 CTGGTGAAAAGGAATGGAAAGGG + Intergenic
963942228 3:151106342-151106364 CTGTAGGAAAGGAAAGGAAAGGG - Intronic
963958328 3:151280203-151280225 ATGGAGAAATGGAAAGCTAAAGG + Intronic
964007635 3:151851255-151851277 ATGGAGAAATGGACAGAAGTAGG - Intergenic
964248030 3:154676965-154676987 ATGGAGAAGTAGAAAGGAGCTGG - Intergenic
964315181 3:155436064-155436086 ATGGAAAAATGCAAATGAGAAGG - Intronic
964917826 3:161857586-161857608 ATGGAGAACTGGAAGGGACAAGG - Intergenic
965299714 3:166994822-166994844 ATGGAGAGATGAAAAGGAAATGG + Intergenic
965835757 3:172850370-172850392 ATTGAGAAATGGAGAGAAGAAGG + Intergenic
966474887 3:180333115-180333137 CTGCAGAAGAGGAAAGGAAAAGG + Intergenic
966587029 3:181637588-181637610 CAAGAGAAATGTAAAGCAGATGG + Intergenic
966627699 3:182036487-182036509 GTGAAGAAAAGGAAAGGAAAGGG - Intergenic
966959697 3:184922871-184922893 GAGAAGAAATGGAAAGGAAATGG + Intronic
967123787 3:186406982-186407004 CTGAAAAAATGAAAAGGCGAGGG - Intergenic
967438549 3:189479419-189479441 CAGGAGCAATGACAAGGAGATGG - Intergenic
967994413 3:195155700-195155722 GCGGAGAATGGGAAAGGAGAAGG - Intronic
968378991 4:72709-72731 CAGGAGAAATGGAAATTGGAAGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968885421 4:3328225-3328247 ATGGAGACTTGGAAAGGTGAGGG + Intronic
968928619 4:3563441-3563463 CAGGGGAATTGCAAAGGAGAAGG - Intergenic
969072860 4:4553314-4553336 TTTGAGAAATGGAAAAGAGTAGG - Intergenic
969171576 4:5368091-5368113 GGGGAGAGATGGAAAGGAAATGG + Intronic
969185442 4:5470985-5471007 CTGCAGAGATTGAAAGGAGGCGG - Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969247683 4:5945978-5946000 CTGGAGAAAGGGAGGAGAGAAGG + Intronic
969424852 4:7118201-7118223 ATGGAGAGATGGATGGGAGATGG + Intergenic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970083738 4:12321265-12321287 CTGGAGACATGGAAATTAGCAGG + Intergenic
970172365 4:13302724-13302746 CTATAGAATTGGAAATGAGAGGG + Intergenic
970236953 4:13968364-13968386 CGTGAGAAGTGGAAAGGACAAGG + Intergenic
970499952 4:16666946-16666968 GTGGGGGAATGGAAAGGTGAGGG + Intronic
970943321 4:21661183-21661205 ATGGGGAGCTGGAAAGGAGATGG - Intronic
971075016 4:23138308-23138330 GTGGAGAAATGCTAAGGAGCTGG - Intergenic
971264808 4:25088244-25088266 CTGGAGAGATGGAGGGGACAGGG - Intergenic
971342116 4:25780305-25780327 CCGGAGACATGGACAGGAGCAGG - Intronic
971777494 4:30985451-30985473 CTAGTAAAATGGAAAGAAGATGG + Intronic
971906556 4:32733166-32733188 ATGGATAAATTGAAAGGAGTCGG + Intergenic
971986117 4:33827071-33827093 ATAGAGAAATCTAAAGGAGAGGG - Intergenic
972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG + Intronic
972696525 4:41451880-41451902 CTGGAAAAAAGGTAAGAAGATGG - Intronic
972707572 4:41560255-41560277 CAGGAGGAATAGAAAGGAAAAGG - Intronic
972784753 4:42315799-42315821 CTAGGGAAAGGGGAAGGAGAGGG + Intergenic
972857652 4:43126460-43126482 ATGCGGAAATGGAAAGGAGTGGG + Intergenic
973809372 4:54554847-54554869 CTGGGGCAATGGCAAGGAAATGG + Intergenic
973838559 4:54836997-54837019 CTGGAGAAATTGACAGCATAAGG + Intergenic
974112554 4:57542569-57542591 CTGGAGAACTAGAAAGGTGGTGG + Intergenic
974558885 4:63491616-63491638 CTGTAGAAATGGCAAGAAAATGG + Intergenic
975091022 4:70404371-70404393 ATGGAGAAAGGGTAAGAAGATGG - Intronic
975097819 4:70477583-70477605 CTGGAGTCAAGGGAAGGAGAAGG - Intronic
975692754 4:76982179-76982201 TTGCAGAAAGGGAATGGAGATGG - Intronic
975695515 4:77008941-77008963 ATGGAGAAGTGGAAAGGATTTGG + Intronic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
976815339 4:89140929-89140951 CTCAGAAAATGGAAAGGAGATGG - Intergenic
977116026 4:93030236-93030258 CGGGAGAAAAGGAAAGAGGAAGG - Intronic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977573830 4:98657352-98657374 TTGTAGAAATGCAAAGGAGAAGG - Intronic
977805639 4:101294135-101294157 CAGAAGAAGTGGAATGGAGATGG + Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
977928264 4:102725733-102725755 ATGGAAAGATGGAAATGAGATGG + Intronic
978546569 4:109877003-109877025 CTGAAAGAAAGGAAAGGAGAGGG - Intergenic
978632752 4:110766135-110766157 CTGGAGAAATGTCATGGAAAAGG - Intergenic
978716413 4:111848497-111848519 TTGGGGAAAAGAAAAGGAGAGGG - Intergenic
979347241 4:119602771-119602793 CTGGAGAAATAAAAATGAAAGGG + Intronic
979402547 4:120266163-120266185 CTGGAGCAAGGGAAACAAGAGGG - Intergenic
979441978 4:120760955-120760977 CTGGAGAAGTGGGCAGGTGAAGG + Intronic
979625419 4:122839684-122839706 CTGCAGAAATGAAATGGACAGGG - Intronic
980097313 4:128504692-128504714 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
980501326 4:133657987-133658009 CAGCAGAAATGGAAAAGAAATGG + Intergenic
980551016 4:134335350-134335372 GTAGAGAAATGGAATGGTGATGG + Intergenic
981373502 4:143987349-143987371 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
981382603 4:144090620-144090642 ATGGAGAGTTGGAAAGGGGATGG - Intergenic
981544249 4:145878322-145878344 GTAGAAAAATGGAAATGAGAGGG + Intronic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
982456470 4:155615481-155615503 CTGGTGAAAAGGAAATGACAAGG - Intergenic
983345188 4:166520363-166520385 CTGAAGAGATGGAAAGGTGTAGG + Intergenic
983629969 4:169840364-169840386 CTGGAGAGAAGCAAATGAGAAGG - Intergenic
983657172 4:170094687-170094709 CTCAAGAAAAGAAAAGGAGAGGG - Intergenic
983660118 4:170122711-170122733 CAGGAGAATTGCAATGGAGATGG - Intergenic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984125117 4:175799055-175799077 AAGGAAAAAAGGAAAGGAGAGGG - Intronic
984190218 4:176596614-176596636 CTGGAGAGAGGGATAGGGGAAGG - Intergenic
984278011 4:177633717-177633739 ATGGGGAATTGGAAAGGAGATGG - Intergenic
984357143 4:178676261-178676283 GGGGAGAAGTGAAAAGGAGAAGG + Intergenic
984863607 4:184261463-184261485 CTGCAGAAGAGGAAAGGAGCTGG - Intergenic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
986048160 5:4060844-4060866 TTAGAGAAATGGAAAGATGATGG + Intergenic
986795128 5:11202747-11202769 CTGGAGAAAAGCAAAATAGAGGG - Intronic
987218159 5:15761180-15761202 CTGAAGCAGTGGAAAGGAAATGG - Intronic
987268448 5:16280081-16280103 ATGGAGAGCTGGAAAGGAGATGG + Intergenic
987269264 5:16288586-16288608 CTGGTCAAGTGCAAAGGAGAGGG + Intergenic
987341098 5:16940167-16940189 CTGGAGTAATGGAAGAGAGAGGG - Intergenic
987678456 5:21105790-21105812 TAGGAAAAATGAAAAGGAGAAGG + Intergenic
987859233 5:23462846-23462868 TGGGAGAATTGGAGAGGAGATGG + Intergenic
988065451 5:26225459-26225481 CTGGAGAAATGGGGAGGAGCTGG - Intergenic
988371370 5:30371998-30372020 CTGGAGGAATGAAAAGGGAAGGG + Intergenic
988922845 5:35960800-35960822 ATGGGGAGCTGGAAAGGAGACGG + Intronic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989654335 5:43729682-43729704 CACGAGAAATGAAAAGGAAAAGG + Intergenic
989664076 5:43832519-43832541 CTGGAGGAAGGGAAAGGGTAAGG - Intergenic
990450797 5:55930050-55930072 CTTGAGGAATGGACAAGAGAGGG - Intergenic
990642795 5:57806709-57806731 CTGGAGAAAAGAAAGGCAGAAGG + Intergenic
991215831 5:64156602-64156624 CTGGGGAAATAGTAAGGAGAAGG + Intergenic
991538517 5:67700445-67700467 CTGGAGAGAGAGAGAGGAGAGGG - Intergenic
991601054 5:68351508-68351530 CAGGATAAGGGGAAAGGAGAAGG - Intergenic
991622336 5:68557949-68557971 CTGGAGCCTTGGAAGGGAGAGGG - Intergenic
991714210 5:69436589-69436611 CTGGAGCAATGGAATGGTGTTGG + Intronic
991976564 5:72189038-72189060 CTGGATAAAAGGAAAAGAGCTGG - Intronic
992344993 5:75867450-75867472 AAGGAGAGAAGGAAAGGAGAAGG + Intergenic
993468635 5:88279384-88279406 CAGGAGAAAAGGAGACGAGAAGG + Intergenic
993773542 5:91962501-91962523 GTGGGGAGCTGGAAAGGAGATGG - Intergenic
993927682 5:93890997-93891019 ATAGAGAAAAGGAAATGAGAAGG - Intronic
994139835 5:96330033-96330055 CTGGAGAAAAAGACAAGAGATGG - Intergenic
994146812 5:96404487-96404509 GAGGAGAAAAGGAAAGGAGAAGG - Intronic
994221275 5:97198070-97198092 CTGGTGAAAACAAAAGGAGAAGG + Intergenic
995123917 5:108561432-108561454 CAGGAGAAAGTGATAGGAGAGGG - Intergenic
995437795 5:112157629-112157651 CAGGAGAAATAGACATGAGAGGG - Intronic
995742101 5:115365946-115365968 GAGGAGAAAAGGAAAGGATAAGG - Intergenic
998049876 5:139023390-139023412 CTGGAGGAAAGGAAAGAAGCAGG + Intronic
998105846 5:139468675-139468697 CCAGAGAGATGGAAAGGAGGTGG + Intergenic
998889981 5:146735605-146735627 ATGGAAAAGTGGAAAGGATAAGG + Intronic
998997571 5:147882329-147882351 TTAGAGATAAGGAAAGGAGAAGG - Intronic
999181999 5:149676308-149676330 GGGGAGAAATGGGAAGCAGAGGG + Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999413319 5:151371890-151371912 CGGGAGACAGGGAAAGGGGAGGG + Intergenic
999783285 5:154868664-154868686 CAGCATAAATGGAAAGGAGTGGG - Intronic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000992960 5:167929467-167929489 CTTGATAAATGGAAAGAAAAGGG - Intronic
1001107831 5:168870434-168870456 TGGGAGGAAAGGAAAGGAGAAGG - Intronic
1001237394 5:170041891-170041913 GAGGAGAGATGGAAAGGACAGGG + Intronic
1001397941 5:171429889-171429911 CTGGAAAAGTAGAAAGGAGGTGG + Intronic
1001474230 5:172038538-172038560 CTGGAAAAATGGGAAGAAGCAGG - Intergenic
1001835151 5:174825293-174825315 CTAGAGAATGGGAAAGGACATGG - Intergenic
1002452501 5:179326849-179326871 CTGAAGTCATGGGAAGGAGAGGG + Intronic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003576074 6:7296643-7296665 CTGGAGGGAAGGAAAGGAGGAGG + Intronic
1003772127 6:9317088-9317110 CTAGAGAATTGGAAAGTAGCTGG + Intergenic
1003813096 6:9806081-9806103 GTGGAAAAATGGTAAGGAAAAGG + Intronic
1003967379 6:11266020-11266042 ATGGAGACTTGGAAGGGAGAGGG + Intronic
1004098428 6:12583017-12583039 CTGGAGAAATAGAAAAGAATTGG - Intergenic
1004542018 6:16560066-16560088 CTGGAGATATGCCAACGAGAGGG + Intronic
1004730014 6:18348448-18348470 CAGATGAAATGGAAAGGAGCCGG + Intergenic
1004759207 6:18647629-18647651 TTGGATAAACGCAAAGGAGAGGG + Intergenic
1005288203 6:24351459-24351481 ATTGTGAAATGCAAAGGAGATGG - Intronic
1005444844 6:25911666-25911688 ATGGATAAAATGAAAGGAGATGG - Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1005993608 6:30918734-30918756 CAGTAGAACTGGAAAGGGGAAGG - Intronic
1006053835 6:31365742-31365764 ACGGAGAAATGGAACTGAGAAGG - Intergenic
1006183156 6:32166082-32166104 CTGGAGAAATTAATAGGAGAGGG + Intronic
1006200666 6:32287064-32287086 CTGCATCAATGGAAGGGAGATGG + Intergenic
1006205853 6:32342127-32342149 CTGGAAAAAATGAATGGAGAAGG - Intronic
1006219179 6:32473521-32473543 CTGGAGAACAGGAAAGGACCAGG + Intergenic
1006308416 6:33239519-33239541 CTGGAGGAATGCAGAGGAAACGG + Intergenic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006594221 6:35181279-35181301 CGGGAGTAATGGAAAGAATAAGG - Intergenic
1006805104 6:36783005-36783027 GTGGAGAAGGCGAAAGGAGATGG + Intronic
1006948066 6:37798672-37798694 CAGGACAGATGGAAAGGAGTGGG - Intergenic
1007072369 6:39047248-39047270 AAGGAGGAATGGGAAGGAGATGG - Intergenic
1007103463 6:39267507-39267529 CTAGAGAAATGGTAAGAAGAGGG - Intergenic
1007263469 6:40580114-40580136 CATGAGAAATGGCAATGAGAAGG + Intronic
1007328525 6:41083664-41083686 CTGGAGAGAAGGCAATGAGAGGG - Intronic
1007727718 6:43926742-43926764 CCGGGGAAATGGAAAGCAGGAGG + Intergenic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008515470 6:52314691-52314713 CTGGATAGATGGAAAGGAGGAGG + Intergenic
1009684373 6:66937014-66937036 CAGGAGAAATGGACCGGAGTGGG + Intergenic
1009781732 6:68280089-68280111 CTTGAGAAATGGAGAGGGGAGGG + Intergenic
1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG + Intronic
1010030752 6:71268489-71268511 CAGGAGAAATGGAAACTATAAGG - Intergenic
1010552137 6:77236421-77236443 CTGGAGAACTGGCATGGAAATGG + Intergenic
1011191815 6:84737519-84737541 CTACAGAGATGAAAAGGAGATGG + Intronic
1011213625 6:84981328-84981350 CTGGAGAAATGCAGAGGATGAGG + Intergenic
1011217639 6:85021839-85021861 GAGGAGAAATGGAAAGGATCTGG - Intergenic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1011606213 6:89108618-89108640 TTGGACAAATGGAAAAAAGATGG + Intronic
1011628020 6:89299099-89299121 CTAGAGAAATGCTATGGAGAAGG - Intronic
1012493381 6:99807885-99807907 TTGGAGAATTGGAAATGAAAAGG - Intergenic
1012634138 6:101514418-101514440 ATGGAGACAGGGAAGGGAGAGGG + Intronic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1013611567 6:111800768-111800790 CTGGAGATGTGGGCAGGAGAGGG - Intronic
1014436264 6:121424216-121424238 GGGAAGTAATGGAAAGGAGAGGG + Intergenic
1014812412 6:125901851-125901873 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1014855006 6:126389472-126389494 TTGCAGAAATGGAAAAGAAAAGG - Intergenic
1015020971 6:128474484-128474506 CTGAATAAATGGCAAGGAGTTGG + Intronic
1015972018 6:138751955-138751977 TTGGAGAGATGGAAAAGATAAGG + Intronic
1015976406 6:138795877-138795899 CTGGAGGCAGGGAAAGGAGCCGG + Intergenic
1016275973 6:142352958-142352980 GTGGAGAGAGAGAAAGGAGAGGG - Intronic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016698211 6:147022773-147022795 CAGGAAAAAAGGAAAGGAAATGG - Intergenic
1016739576 6:147513129-147513151 CTGGAGAAAGTGGCAGGAGATGG + Intronic
1017139299 6:151175959-151175981 CTAGTCACATGGAAAGGAGATGG + Intergenic
1018366068 6:163121269-163121291 CTTAAGGAATGGAAAAGAGAAGG - Intronic
1018537472 6:164836701-164836723 CTGGAGGCATGGACAGGAGGTGG - Intergenic
1018741969 6:166736492-166736514 CTGGAGAAATCAAAAGGAATAGG - Intronic
1018927277 6:168215127-168215149 CTGGAGCCATGGAAATGAGAGGG - Intergenic
1019410778 7:905726-905748 AAGGAGAAAGGGAAAGGAGAAGG + Intronic
1020366073 7:7381973-7381995 ATGGAAAAATGTAAAGAAGATGG - Intronic
1020431822 7:8123258-8123280 CTGGGGAAATGGAGAGGAAGGGG - Intronic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1020507059 7:9004203-9004225 CTTGGGAAATAGAAAGGTGAGGG - Intergenic
1020579754 7:9981415-9981437 CTGGAAAAAAAAAAAGGAGAAGG + Intergenic
1020686874 7:11307222-11307244 CTTGAGAAATTAAAAGGAGAAGG + Intergenic
1020875682 7:13690870-13690892 CTTGAGAAATGAAAATGACATGG + Intergenic
1021005148 7:15385578-15385600 CTGGAGCAATATAAAGGAAATGG - Intronic
1021742852 7:23705111-23705133 ATTGAGAATTGGCAAGGAGAAGG + Intergenic
1022052567 7:26692113-26692135 CAAAGGAAATGGAAAGGAGATGG + Intronic
1022651942 7:32285638-32285660 CTGAAGAAAGGGAAAAGAAAGGG + Intronic
1022972792 7:35532566-35532588 AAGGAGGAATGGAAAGGAGGTGG + Intergenic
1023341917 7:39230095-39230117 CTGGAGCAATGGAAGGGACAGGG - Intronic
1023602441 7:41892959-41892981 CTGGAGAAATGAGAAGGAAGGGG + Intergenic
1024011684 7:45272133-45272155 ATGTAGAAATGGTAAGGAGAAGG - Intergenic
1024504434 7:50149870-50149892 AGGGAGAAGTGGAAACGAGAAGG - Intronic
1024747835 7:52428437-52428459 CTGGAAGCATGGTAAGGAGAAGG - Intergenic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1025233943 7:57221001-57221023 CTGGAGACCTGGACAGGAGCTGG + Intergenic
1025932926 7:66010842-66010864 CTGGAGACAGAGAGAGGAGAAGG + Intergenic
1025950457 7:66141411-66141433 CTGGAGACAGAGAGAGGAGAAGG - Intronic
1026958666 7:74394623-74394645 CTGTATAGAAGGAAAGGAGATGG - Intronic
1027131393 7:75593744-75593766 CTGGCTAAATGGAAAGGGGCTGG - Intronic
1028043260 7:86085487-86085509 GTGTAGTAATGTAAAGGAGATGG - Intergenic
1028753530 7:94409539-94409561 ATGAGGAAAAGGAAAGGAGAAGG - Intronic
1028975139 7:96904418-96904440 CTGGAGAAAGCAAAGGGAGAAGG + Intergenic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030157021 7:106465614-106465636 TGGAAGAATTGGAAAGGAGAGGG + Intergenic
1030444354 7:109630373-109630395 CTGGAGAAATGAATAGGGAATGG + Intergenic
1030950701 7:115787864-115787886 CTGTAGAAAGAGAAAGGAAAAGG + Intergenic
1031003422 7:116444554-116444576 CGGGAGATATGGAAAGGAATGGG - Intronic
1031007657 7:116492265-116492287 CAGGAGAAAAGGGAAGGAAAGGG + Intronic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1031871976 7:127097384-127097406 ATTGAGAACTGGAAAAGAGAGGG + Intronic
1032183984 7:129707328-129707350 CTGGAGAAAATGAAATGAGAAGG - Intronic
1032552039 7:132793101-132793123 CAGGAGAAATGGAAAGGAGCGGG - Intronic
1032612475 7:133430144-133430166 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1033404183 7:141055805-141055827 CTGGAAAAGTGAAAAGGAAATGG - Intergenic
1033854192 7:145536916-145536938 CTGGAGACTGGGAGAGGAGATGG + Intergenic
1033899197 7:146115817-146115839 GAGGAGAGAAGGAAAGGAGAAGG + Intergenic
1033921951 7:146404715-146404737 CTGGAGTGATGCAAAGGAGAAGG - Intronic
1033976046 7:147101647-147101669 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1034108440 7:148512708-148512730 CATAAGAAATGGAAAAGAGAAGG + Intergenic
1034855569 7:154543245-154543267 GTTGAGAAATGGAAAGGAATTGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1036729355 8:11248707-11248729 CTGCAACAATGCAAAGGAGAAGG - Intergenic
1036913174 8:12776369-12776391 GTAGAGAAAAGGAAAGGAGAGGG + Intergenic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1037219779 8:16504607-16504629 TTGAAGAAAAGGAAAGGGGAAGG + Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037737255 8:21577653-21577675 CTTGGGAAATAGAAATGAGAAGG + Intergenic
1038722239 8:30047311-30047333 ATGGAGAAAGGGAGAGGAGGCGG - Intergenic
1039300470 8:36203334-36203356 CTGGGGAAAAGGCAAGGAAATGG + Intergenic
1039314572 8:36356945-36356967 CTGGGGGAATGGAAAGCAGCAGG + Intergenic
1039332458 8:36553492-36553514 CTGTAGAAATGGAAAGTTGCAGG + Intergenic
1039444798 8:37622447-37622469 TCTGAGAAATGGAAAGTAGAGGG - Intergenic
1039608891 8:38903551-38903573 CTGCAGAAGTGGGAAGGGGAAGG + Intronic
1039670836 8:39595867-39595889 TTGGAGAAATGGAAACAAGAAGG - Intronic
1039777253 8:40749245-40749267 CTGGTCCACTGGAAAGGAGAAGG + Intronic
1040898402 8:52391857-52391879 CTTGAATAATGGAAAGGACAGGG + Intronic
1040976227 8:53197324-53197346 TTAGACAAATAGAAAGGAGAGGG + Intergenic
1041419220 8:57647733-57647755 CTGGAGAAATGGAAGATGGATGG - Intergenic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1042482746 8:69322615-69322637 CTGGAGACCTGGGAAGGAGCGGG + Intergenic
1043236636 8:77876291-77876313 CAGGAGAAATGGAAATCACAGGG + Intergenic
1043781795 8:84345638-84345660 AGGGAGAAATGAAAATGAGAGGG - Intronic
1043976044 8:86586101-86586123 CTGTATAAATGGAAAAGAAAAGG + Intronic
1044145029 8:88702145-88702167 CTGGAAATGTGGACAGGAGAGGG + Intergenic
1044514417 8:93121693-93121715 CTGGAATAATGGACAGGGGATGG - Intergenic
1044666827 8:94640806-94640828 CTGGATGAATGGAGAGGCGAGGG - Intergenic
1045033699 8:98161565-98161587 GGGGAGGAAAGGAAAGGAGAGGG - Intergenic
1045065734 8:98442249-98442271 TTGGAGAATTGGAGAGGGGAAGG - Intronic
1045656348 8:104391305-104391327 TTTGAAAAATGGAAAGAAGAGGG + Intronic
1045838706 8:106554135-106554157 CTGGAGAATTTGAAAATAGATGG + Intronic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046147294 8:110177614-110177636 CTGAAGACATGGAAAGGTGCTGG + Intergenic
1046291055 8:112162391-112162413 AGGGAGAAATGAACAGGAGAAGG - Intergenic
1046453879 8:114433166-114433188 CTGGAGAAATGGAAAAGCTGGGG - Intergenic
1047248659 8:123165693-123165715 AGAGAGAACTGGAAAGGAGAGGG - Intergenic
1048884925 8:138902249-138902271 AAGGATAAAGGGAAAGGAGAGGG - Intronic
1049238191 8:141523201-141523223 CTGGAGCAGGGGCAAGGAGAGGG - Intergenic
1049315555 8:141965151-141965173 CTGGAGGATTGGAAGGGAGCAGG - Intergenic
1049808429 8:144551903-144551925 CTGGAGAGATGGGAACGAGCTGG - Intronic
1050137462 9:2481803-2481825 CTGGAAAAAGGGAAGGGTGAGGG - Intergenic
1050831083 9:10014321-10014343 ATGGAGAAGTGGAAAGAATATGG - Intronic
1051194198 9:14545536-14545558 GGGGAGAAATGGAAAGAAGACGG + Intergenic
1051618608 9:19030162-19030184 TTAGAGAAAGGGAAAGGATAAGG + Intronic
1052660170 9:31419326-31419348 TAGGGGAACTGGAAAGGAGACGG - Intergenic
1053803499 9:41778582-41778604 CAGGGGAATTGCAAAGGAGAAGG - Intergenic
1054141766 9:61536542-61536564 CAGGGGAATTGCAAAGGAGAAGG + Intergenic
1054191793 9:61989895-61989917 CAGGGGAATTGCAAAGGAGAAGG - Intergenic
1054646577 9:67597817-67597839 CAGGGGAATTGCAAAGGAGAAGG + Intergenic
1054818408 9:69497691-69497713 CTGTGGAAATGGAAAAGAGGAGG - Intronic
1055054554 9:72011750-72011772 TTGGAGAAATAGGAAGGACATGG + Intergenic
1055397257 9:75889229-75889251 CTGGAGAAAGGGGAAGGGGGAGG - Intergenic
1055431400 9:76247731-76247753 ATAGAGAAAGGTAAAGGAGATGG + Intronic
1056089193 9:83187743-83187765 GAGGAGAAATGGAAGGTAGAGGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058139794 9:101345275-101345297 GGGGAGAGATGGCAAGGAGAAGG - Intergenic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1058978233 9:110144980-110145002 CTCAACAAATGGGAAGGAGAAGG - Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059657349 9:116368679-116368701 CTGGAGAAACCGAAAGAAGGAGG + Intronic
1059746061 9:117202932-117202954 CAGGAAAAATGGAAAGAAGCTGG - Intronic
1059849304 9:118319472-118319494 AGGGAGGAATGGAATGGAGAGGG + Intergenic
1059992484 9:119878331-119878353 GTAGAGAAATGGCAAGAAGATGG - Intergenic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1060449624 9:123724451-123724473 CTGGAGTGAGGGGAAGGAGAGGG + Intronic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1061921533 9:133785159-133785181 CTGGTGAAATGGAGAGGGGAAGG - Intronic
1061947441 9:133916576-133916598 ATGGAGAAGGGGAAAGGAGGGGG + Intronic
1062486288 9:136778035-136778057 CTGGAGACTTGGAGAGGAGCTGG - Intergenic
1062486349 9:136778387-136778409 CTGGAGACCTGGGGAGGAGATGG - Intergenic
1185951316 X:4437612-4437634 TTTTAGAAATGGATAGGAGATGG + Intergenic
1187025646 X:15433299-15433321 CTGGAGAAAGGAAACTGAGAAGG + Intronic
1187587879 X:20684093-20684115 CTGAAAAAATGAAAAGTAGATGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1188526567 X:31094106-31094128 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1189266732 X:39722501-39722523 GAGGAGAAATGAAAAGGAGGAGG - Intergenic
1189654695 X:43231806-43231828 TTAGAGAAATGCAAAGAAGAAGG + Intergenic
1189679109 X:43496485-43496507 CTGGAGGACTGGAAAAGAGTGGG + Intergenic
1190256280 X:48765108-48765130 CTGCAGAATGGGAAAGGAGGGGG + Intronic
1190394315 X:49964852-49964874 AGGGAGCAATGGAAAAGAGAGGG - Intronic
1190515878 X:51223188-51223210 AGGGAGAAAAGAAAAGGAGAAGG - Intergenic
1190534175 X:51409101-51409123 CTGGAGAAAAGGAGGGGTGATGG + Intergenic
1190569375 X:51766173-51766195 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
1190879478 X:54482616-54482638 CTGGTGAATGGGAAGGGAGATGG - Intronic
1191023856 X:55892453-55892475 CAGGAGAAAGGGAAAGAAGGAGG + Intergenic
1191779048 X:64847269-64847291 CTGGAGTAATGAGGAGGAGAGGG - Intergenic
1192033854 X:67543910-67543932 GGGGAGAAAAGGAAAGGGGAGGG + Intergenic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192989861 X:76438880-76438902 ATGGAGAAAGGGGAAAGAGAAGG - Intergenic
1193375134 X:80751084-80751106 CAGGATACAAGGAAAGGAGAGGG + Intronic
1193709374 X:84860770-84860792 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1193906203 X:87247499-87247521 CTGAACAAAAGGAAAGGAGCTGG - Intergenic
1194418535 X:93643573-93643595 AGGGAGAAATAGAGAGGAGAAGG + Intergenic
1194529213 X:95023904-95023926 GTGGAGAAAGGAAAAGAAGAAGG - Intergenic
1194633346 X:96313864-96313886 CAGGAGAAAAGAAAAGGAGTAGG - Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1195352067 X:104005384-104005406 GGGGAGAAATGGAGAGGGGATGG - Intergenic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1197187238 X:123601429-123601451 TAGGAGAAAAGGAAGGGAGAAGG + Intronic
1197222806 X:123929792-123929814 CTGCTGAAATCTAAAGGAGAAGG - Intergenic
1197836749 X:130702719-130702741 CTAGAGGAGAGGAAAGGAGACGG - Intronic
1197836804 X:130703353-130703375 CTGGAGAAATGGACAAGTGGTGG + Intronic
1197996278 X:132378338-132378360 TTGGAGAAATGGCTAGGACAGGG - Exonic
1198066831 X:133106542-133106564 CTGGAGAAATAGAAACAATAGGG - Intergenic
1198116729 X:133551436-133551458 ATAGAGAAATGGAAAGGAGGGGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198489218 X:137122174-137122196 ATGGAGATTTGGAAAGGTGAGGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199380654 X:147168475-147168497 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1199546661 X:149013523-149013545 TTGGGGAAATGGAAAGTAGCCGG - Intergenic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1199599887 X:149535575-149535597 GAGGAGAAAAGGAGAGGAGAGGG - Intergenic
1199612337 X:149629198-149629220 CTGGAGGAGAGGAAAAGAGAGGG + Intronic
1199637518 X:149827167-149827189 CTAGGGAAAGGGGAAGGAGAGGG + Intergenic
1199650753 X:149944676-149944698 GAGGAGAAAAGGAGAGGAGAGGG + Intergenic
1199848227 X:151706931-151706953 CTGGGGAGAGGGCAAGGAGAGGG - Intergenic
1199966439 X:152824489-152824511 GTGGGGCAAGGGAAAGGAGAGGG - Intergenic
1200054842 X:153454842-153454864 CAAGAAAAATGGACAGGAGAGGG + Intronic
1200822281 Y:7599227-7599249 CTTGCAAAATGGAAAAGAGATGG + Intergenic
1200877293 Y:8171368-8171390 CTTGCAAAATGGAAAAGAGATGG + Intergenic
1201176770 Y:11314606-11314628 CTGGAGAAATGAAGAGGAAGGGG - Intergenic
1201751498 Y:17436650-17436672 ATGGGGAGATGGAAAGGGGATGG + Intergenic
1201757518 Y:17502432-17502454 CTGGGGAAGAGAAAAGGAGAGGG - Intergenic
1201844036 Y:18403550-18403572 CTGGGGAAGAGAAAAGGAGAGGG + Intergenic
1202238019 Y:22734790-22734812 CTTGCAAAATGGAAAAGAGATGG - Intergenic