ID: 961201510

View in Genome Browser
Species Human (GRCh38)
Location 3:125049355-125049377
Sequence CTCTCATTGCGCCCTCATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961201503_961201510 -5 Left 961201503 3:125049337-125049359 CCTGCAAGCCACCCCCACCTCTC 0: 1
1: 0
2: 1
3: 82
4: 526
Right 961201510 3:125049355-125049377 CTCTCATTGCGCCCTCATGCCGG 0: 1
1: 0
2: 1
3: 3
4: 73
961201502_961201510 -1 Left 961201502 3:125049333-125049355 CCAACCTGCAAGCCACCCCCACC 0: 1
1: 0
2: 4
3: 66
4: 586
Right 961201510 3:125049355-125049377 CTCTCATTGCGCCCTCATGCCGG 0: 1
1: 0
2: 1
3: 3
4: 73
961201501_961201510 5 Left 961201501 3:125049327-125049349 CCACAGCCAACCTGCAAGCCACC 0: 1
1: 0
2: 0
3: 27
4: 338
Right 961201510 3:125049355-125049377 CTCTCATTGCGCCCTCATGCCGG 0: 1
1: 0
2: 1
3: 3
4: 73
961201500_961201510 10 Left 961201500 3:125049322-125049344 CCAATCCACAGCCAACCTGCAAG 0: 1
1: 0
2: 0
3: 23
4: 181
Right 961201510 3:125049355-125049377 CTCTCATTGCGCCCTCATGCCGG 0: 1
1: 0
2: 1
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961201510 Original CRISPR CTCTCATTGCGCCCTCATGC CGG Intronic
902857386 1:19218476-19218498 CTCTCATTTCACCCACAGGCTGG - Exonic
909488503 1:76200501-76200523 ATTTCATTGCTCCCACATGCAGG - Intronic
912878089 1:113383327-113383349 CTCTCATTGGGTTCTCATTCTGG + Intergenic
917516623 1:175713974-175713996 CTCTCCTCTCTCCCTCATGCTGG + Intronic
920396365 1:205648848-205648870 CCCTCACTGCCCCATCATGCTGG - Intergenic
922085671 1:222344606-222344628 CACTCACTGAGTCCTCATGCTGG - Intergenic
1064132863 10:12725622-12725644 CTCTCATTTCGGCATCTTGCAGG + Intronic
1066780836 10:38943051-38943073 CTCTCATTGCCGCCGCACGCAGG - Intergenic
1067350778 10:45473794-45473816 CTCTCATGGCACCCTATTGCAGG - Intronic
1067467914 10:46514936-46514958 GTCACATTGCTTCCTCATGCAGG - Intergenic
1069024114 10:63521586-63521608 CTCTCACTGCGCCCTGCAGCCGG + Intronic
1069321788 10:67180755-67180777 CTTACATTTCTCCCTCATGCAGG + Intronic
1072450738 10:95537684-95537706 CTCTCATTCCACCCTGATGCTGG + Intronic
1074168754 10:110911124-110911146 CATTCATTGAGCTCTCATGCAGG - Intronic
1076522172 10:131088070-131088092 CTCTCCTTCCGCTCTCTTGCTGG + Intergenic
1076935215 10:133564228-133564250 TTCTCATTGTGTCCTCATGTTGG - Intronic
1104228319 12:126858705-126858727 CTCTCATTACGCCCACATGCTGG - Intergenic
1105040419 12:132956600-132956622 CGCTCATTGCAGCCTCAGGCTGG + Intergenic
1107542512 13:41404304-41404326 CTCTCCTTGTGCACACATGCCGG + Intergenic
1110268025 13:73560643-73560665 CTCTCCTTCCTCTCTCATGCTGG - Intergenic
1118091031 14:62478541-62478563 CTCTCATTTCAACCTCATGCTGG - Intergenic
1118488315 14:66234656-66234678 CTCTCATTGTGTCCTCATTTAGG + Intergenic
1121740191 14:96246428-96246450 TTCTCATTGCGCCAGCTTGCTGG - Intronic
1124449982 15:29779201-29779223 CTCTCTTTGGGCATTCATGCAGG - Intronic
1124579660 15:30942286-30942308 CTCTCATCCCGCCCCCATTCAGG - Exonic
1126796342 15:52263010-52263032 TTCTCATTGTGTCCTCATGGTGG - Intronic
1127617788 15:60704291-60704313 CTCTCCTTGCAACCGCATGCCGG - Intronic
1129541001 15:76346848-76346870 GTCTCATTGCCCCCTCGTCCCGG - Intergenic
1131755281 15:95553622-95553644 CTCTCATTGTGGCTTCATGAAGG - Intergenic
1132147693 15:99438179-99438201 CTTTCATGCCGCCCTCCTGCTGG + Intergenic
1132343506 15:101092741-101092763 CTCTCACTGAGTCCTCCTGCAGG - Intergenic
1144520335 17:15948515-15948537 CTCTCACTTCACCCTCAGGCAGG + Intronic
1148560884 17:48605436-48605458 CTTTCATTTTGCCCTTATGCAGG - Intergenic
1151733159 17:75922844-75922866 CTGTCACAGCGCCCTCAGGCTGG - Intronic
1152659014 17:81533927-81533949 CTCTCATGGGCCCCTCCTGCGGG + Intronic
1156385847 18:36604209-36604231 CTCTCCTTACACGCTCATGCTGG + Intronic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1163714414 19:18865688-18865710 CTCTCAGGGCGCCCTGACGCAGG + Exonic
1166394268 19:42427230-42427252 CTCTCATTGATTCCTCATGATGG + Exonic
930001037 2:46861537-46861559 CTCTCATTCCGCCCTCATATGGG - Intergenic
934702552 2:96453763-96453785 CTCTCATCTCTCCCACATGCAGG - Intergenic
936323076 2:111482766-111482788 TTCTAATTGCTACCTCATGCAGG - Intergenic
944507625 2:200429152-200429174 CTCTGTTTGGGCCCTCATACTGG + Intronic
949018090 2:241724867-241724889 CTCTCCTGGTGCCCTCCTGCCGG + Intronic
1169472258 20:5896738-5896760 CACTCACTGTGCCCTCATCCAGG - Intergenic
1169838980 20:9913087-9913109 CTTTCAATGCGGCCTCCTGCTGG + Intergenic
1170813695 20:19695389-19695411 TTCTCCTTGGGCCCACATGCAGG + Intronic
1171466165 20:25329296-25329318 CTCTCATGGCTCCCTCTCGCAGG + Intronic
1175545581 20:59775773-59775795 CCCTCATAGCACCCTCCTGCTGG - Intronic
1179873497 21:44255760-44255782 GTCTCAGAGCGGCCTCATGCGGG - Intronic
1183038607 22:35159362-35159384 ATCTCAGTGCGGCTTCATGCAGG - Intergenic
1183489463 22:38108898-38108920 CCCTCATTGCCCCCTCCTTCAGG - Intronic
1184124815 22:42479644-42479666 CCCTCATTCCGCCCTGAGGCTGG + Intergenic
1185371820 22:50464520-50464542 CCCTCATTACGCACTCATGGGGG + Exonic
950472076 3:13192660-13192682 CTCTCACTGCCCCCGCAGGCTGG - Intergenic
961201510 3:125049355-125049377 CTCTCATTGCGCCCTCATGCCGG + Intronic
965200023 3:165645970-165645992 CTGTGATTGCAACCTCATGCTGG + Intergenic
966159204 3:176950254-176950276 CTCTCAATGCGGTCTCATTCTGG + Intergenic
966926916 3:184650554-184650576 CTCTCAAGGCTCCCTCCTGCAGG - Intronic
967037747 3:185660607-185660629 ATCTCATAGCGCCCTCTTGTGGG - Intronic
976005420 4:80424036-80424058 CTCTCAATGGGCCCTCCTGATGG + Intronic
981815174 4:148822754-148822776 ATCTCATTGAGCCTTCATGATGG + Intergenic
988077076 5:26367076-26367098 CAGTCATTGGGCCCTCATGTTGG + Intergenic
990279096 5:54230695-54230717 CCCTCTGTGCGCCCTCATCCAGG + Intronic
995896194 5:117013797-117013819 CTCTCTGTGCCCCCTCAGGCAGG + Intergenic
1005198548 6:23316938-23316960 TTCTCATTGTTCCCTCATGGAGG - Intergenic
1007341036 6:41191758-41191780 CTCTCACTGCTGCCTCCTGCTGG - Exonic
1007973263 6:46074572-46074594 CACTTATAGGGCCCTCATGCGGG - Intronic
1017790877 6:157798208-157798230 GTCTCATTGCGCCCTCACAGGGG - Intronic
1018204185 6:161421491-161421513 CTCTCTATCCACCCTCATGCTGG - Intronic
1019108466 6:169690072-169690094 CACCCATTAGGCCCTCATGCTGG + Intronic
1019108483 6:169690158-169690180 CACCCATTAGGCCCTCATGCTGG + Intronic
1035077361 7:156189706-156189728 CTCGCATGGCGCCCTCAGCCTGG + Intergenic
1036004290 8:4644308-4644330 TTTTCATTGAGGCCTCATGCAGG + Intronic
1045020035 8:98034555-98034577 CTCTCATTCTGCCCTCAAGAGGG + Intronic
1049502807 8:142976618-142976640 CTCTCACTGTGACCTCATGTGGG - Intergenic
1192582642 X:72297988-72298010 CTCCAATTGCCCCCTCATCCTGG + Intronic
1199959233 X:152766720-152766742 CTCTCAAAGCCCACTCATGCAGG + Exonic