ID: 961203938

View in Genome Browser
Species Human (GRCh38)
Location 3:125066152-125066174
Sequence TCACCCGGATGGTTTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961203932_961203938 4 Left 961203932 3:125066125-125066147 CCGTGAAATGTGTTGTTTCCTCA No data
Right 961203938 3:125066152-125066174 TCACCCGGATGGTTTCTACAAGG No data
961203930_961203938 25 Left 961203930 3:125066104-125066126 CCTTGTGTCCTGAGGCTCATGCC No data
Right 961203938 3:125066152-125066174 TCACCCGGATGGTTTCTACAAGG No data
961203931_961203938 17 Left 961203931 3:125066112-125066134 CCTGAGGCTCATGCCGTGAAATG No data
Right 961203938 3:125066152-125066174 TCACCCGGATGGTTTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961203938 Original CRISPR TCACCCGGATGGTTTCTACA AGG Intergenic
No off target data available for this crispr