ID: 961207941

View in Genome Browser
Species Human (GRCh38)
Location 3:125102215-125102237
Sequence AGAGTTTTCCAGATGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 9, 3: 59, 4: 432}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961207937_961207941 29 Left 961207937 3:125102163-125102185 CCAAAAGGGGTGAAAGTGGGTCT 0: 1
1: 0
2: 2
3: 7
4: 141
Right 961207941 3:125102215-125102237 AGAGTTTTCCAGATGGAGAAGGG 0: 1
1: 0
2: 9
3: 59
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961207941 Original CRISPR AGAGTTTTCCAGATGGAGAA GGG Intronic
902573514 1:17362018-17362040 AGAGTTTACCAGAAGGTGACAGG + Intronic
902665828 1:17937302-17937324 AAGGTTTTCCAGATGGACAAGGG - Intergenic
903374812 1:22859215-22859237 GGAGTTTGCCTGATGGTGAAGGG + Intronic
903798568 1:25949136-25949158 GGAGCTTTCCAGATGGATGAGGG - Intergenic
905460681 1:38120886-38120908 AGGGTCTTCCTTATGGAGAAGGG - Intergenic
905649598 1:39647421-39647443 TGAGTTTTCCAGACAGAGAAAGG - Intergenic
906328486 1:44864701-44864723 AGAGTTTTCCAGAGGGTTCATGG + Intronic
907632790 1:56100583-56100605 CGTGTATTCCTGATGGAGAAAGG - Intergenic
907796432 1:57722737-57722759 AGAGTTCTCTAGAAGGAGAAAGG + Intronic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
908859123 1:68463598-68463620 GGAATTTGCCAGATGGACAAGGG - Intergenic
909514877 1:76496146-76496168 AGATTTTTCCATATGGAGGGAGG - Intronic
910113045 1:83702231-83702253 AGAGATTCCAAGATGGAGGAAGG - Intergenic
910113220 1:83703707-83703729 AGAGATTCCAAGATGGAGGAAGG + Intergenic
910185770 1:84538253-84538275 AGCATTTTCCAGATTAAGAATGG - Intergenic
910825359 1:91401360-91401382 GGAATTTGCCAGTTGGAGAATGG - Intronic
910914753 1:92277116-92277138 ATAGTTTTAAAGATGAAGAAAGG - Intronic
911681905 1:100726518-100726540 AGATTTTGCCAGATGAAGGAAGG - Intronic
911952086 1:104186169-104186191 CAAGTTTTTCAGATGTAGAATGG + Intergenic
913393794 1:118343828-118343850 AGAGATTAGCAGAGGGAGAAGGG + Intergenic
914794854 1:150911380-150911402 AGAATTTTCTTGATGGAGTAAGG + Intergenic
916018274 1:160769985-160770007 AGATTGAGCCAGATGGAGAAAGG + Intergenic
916030213 1:160870281-160870303 AGAGTTCTGCAGATGGATGATGG - Intergenic
916254089 1:162768574-162768596 AGAGCTTTCTAGATGCAGGATGG + Intronic
916933926 1:169608290-169608312 AGAGTTTTGGAGATGAATAATGG - Intronic
917297669 1:173538677-173538699 ACAATTATCCAGATGAAGAATGG + Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
918511018 1:185314841-185314863 ATAGTTTGCTACATGGAGAAGGG + Intronic
918908279 1:190528785-190528807 ACAGTTTTCCAGCAGGAAAAAGG - Intergenic
920665720 1:207961465-207961487 ATAGCTTTGAAGATGGAGAAGGG - Intergenic
922390906 1:225140016-225140038 AGATTTTTCCAGATCGAGATAGG - Intronic
923105804 1:230852581-230852603 AGAGTTCTCGAGATGGATGATGG + Intronic
923112084 1:230899073-230899095 ACAGGTTTGCAGATGGAGAGAGG + Intergenic
923682922 1:236133533-236133555 GGAATTTCCCAGGTGGAGAAAGG - Intergenic
924835849 1:247646438-247646460 AGAGTTTTAGAGATGTTGAAGGG - Intergenic
924874919 1:248092187-248092209 GGGGTTTTCCAGATATAGAATGG + Intronic
1063177286 10:3563299-3563321 AGATTTCTCCAGATAGAGGAAGG - Intergenic
1063266771 10:4459724-4459746 GGAGTTAGCCAGATGAAGAAGGG - Intergenic
1063367847 10:5502153-5502175 TGCGTTTTCTAGATGGAGAGAGG + Intergenic
1063489264 10:6448036-6448058 GGATTTTTCCAGGTGGAGTAGGG + Intronic
1063506998 10:6608593-6608615 GGAGTTAACCAGATGGAAAATGG + Intergenic
1063507822 10:6617523-6617545 AGTGCTTTGAAGATGGAGAATGG + Intergenic
1064639286 10:17398955-17398977 GTAGTTTTCCTGAGGGAGAAAGG + Intronic
1064753429 10:18554638-18554660 AGAATGTAACAGATGGAGAATGG + Intronic
1064754823 10:18564346-18564368 AGAATGTAACAGATGGAGAATGG - Intronic
1064971568 10:21072255-21072277 AGAGGTATACAGATGCAGAAGGG - Intronic
1065263559 10:23951782-23951804 AGCATTTTCCAAATGGAAAATGG + Intronic
1065773121 10:29095923-29095945 TGAGGTTTGCAGCTGGAGAAAGG + Intergenic
1066508372 10:36067671-36067693 AGAGGTTTCCAGCTGATGAAGGG + Intergenic
1067481481 10:46602245-46602267 AGAGATTGCAAGATGGAGAAAGG + Intergenic
1067613271 10:47739484-47739506 AGAGATTGCAAGATGGAGAAAGG - Intergenic
1067844595 10:49709787-49709809 AGCATTTACCAGGTGGAGAAGGG - Exonic
1068232202 10:54182414-54182436 TGAGTTTTCCATTTGGAGTAAGG + Intronic
1068581100 10:58740794-58740816 ATTGTTCGCCAGATGGAGAAAGG + Intronic
1068653904 10:59554818-59554840 AGTGTTTTCCAGGTGGTGAGTGG - Intergenic
1069057720 10:63862240-63862262 AGAGTTTTCCAAAGGCAGATGGG + Intergenic
1069229206 10:65987030-65987052 GGATTTTTCCATATGGTGAAAGG - Intronic
1069789335 10:71009653-71009675 AGAGAATTCCAGATAGCGAATGG - Intergenic
1071021479 10:81062081-81062103 AGAGTTCTAGAGATGAAGAATGG - Intergenic
1071566916 10:86675939-86675961 AGAGTTTTCTAGACTGAGAGGGG - Intronic
1071628681 10:87199589-87199611 AGAGATTGCAAGATGGAGAAAGG - Intergenic
1071679724 10:87692542-87692564 AGAGTTTTCCAGAAAAAGAGTGG + Intronic
1072018483 10:91374556-91374578 AGAGTTTTGAAGAAGAAGAAAGG - Intergenic
1072302587 10:94075835-94075857 TCAGTTTTTCAGATGGAAAATGG + Intronic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1072924245 10:99602121-99602143 AGAGTTATAAATATGGAGAAAGG + Intergenic
1073875060 10:107913762-107913784 AGACTTTTCCATATGAAGAAGGG - Intergenic
1074094001 10:110291977-110291999 AGAGTTTTCCCCATTAAGAAAGG - Exonic
1074907697 10:117879483-117879505 AGAGTTATCCAGCTGGGGAGGGG - Intergenic
1075901111 10:126043450-126043472 ACAGTTTTCCAGATTGAAAAAGG - Intronic
1077347460 11:2070335-2070357 AGAGTATACAAGATGAAGAATGG - Intergenic
1077652563 11:3986625-3986647 GGAGTTTACTAGATGAAGAAAGG + Intronic
1077826576 11:5816230-5816252 AGAGTTCTGGAGATGGAGAGTGG + Intronic
1078514696 11:12011498-12011520 GGTGTTTTCCAGCAGGAGAATGG + Intergenic
1079104440 11:17561325-17561347 AGGGTTTTCCATGAGGAGAAGGG + Intronic
1079117537 11:17650098-17650120 AGAGTTTTCAAGATTGAGGAAGG + Intergenic
1079339863 11:19602944-19602966 AGAGTCTGAAAGATGGAGAAAGG + Intronic
1079970515 11:27030500-27030522 AGAGTGGTGCAGATGGAGGAGGG + Intergenic
1080019432 11:27544564-27544586 ACAGTGTTGCAGATGGTGAAAGG + Intergenic
1080109947 11:28555421-28555443 GGAATTTACCAGATGCAGAAGGG + Intergenic
1080857582 11:36125772-36125794 AGAGTTTTGGTGGTGGAGAATGG + Intronic
1080883529 11:36345010-36345032 AGGCTTTTCCAGATGGCAAAGGG + Intronic
1081536982 11:44003684-44003706 AGAGTTTTGGAGATGAATAATGG - Intergenic
1081743699 11:45458372-45458394 AGAGTTTTGCAAATGGGGTAAGG - Intergenic
1083030622 11:59588595-59588617 AGAGTTTTGGAGATGGAGGGTGG + Intronic
1083268821 11:61560389-61560411 AGAATATTCCATTTGGAGAAGGG + Intronic
1083779833 11:64912086-64912108 AGTGTTATCCAGGTTGAGAAGGG + Exonic
1084569906 11:69953119-69953141 AGGGTCTCCCAGATGGGGAAGGG + Intergenic
1084737236 11:71113412-71113434 AGAGTTGTTCAGAGGGAAAACGG + Intronic
1085414326 11:76310225-76310247 AGAGAATTCAAGGTGGAGAATGG - Intergenic
1085581100 11:77651367-77651389 AGAGTTTTCCAGATAGATGGTGG - Intergenic
1085929190 11:81060149-81060171 GGAATTTTCCAGGTGGACAAAGG - Intergenic
1088281738 11:108141679-108141701 ACAGTTTTCCAGAAAGAAAATGG + Exonic
1089691652 11:120190591-120190613 AATGTTCTCCAGTTGGAGAAGGG + Intergenic
1090057932 11:123439267-123439289 TGGGTTTTCCAGTGGGAGAAGGG + Intergenic
1090383570 11:126343636-126343658 AGTGCATCCCAGATGGAGAAAGG - Intronic
1091069370 11:132548825-132548847 AGAGGGTTGAAGATGGAGAAAGG - Intronic
1091105586 11:132916463-132916485 AGAGTTGTCAAGGTGGAGACAGG + Intronic
1092100479 12:5879676-5879698 AGAGCATTTCAGATGGAGAGAGG + Intronic
1092663747 12:10770395-10770417 AGATTTTTCCAGAAGCATAATGG - Intergenic
1093829195 12:23735094-23735116 AGTGTTTCACAAATGGAGAAGGG + Intronic
1093950637 12:25162274-25162296 AGAGTCTCACAGAGGGAGAATGG + Intronic
1095219175 12:39588182-39588204 AGACTGTTCCAGATGTAGATAGG - Intronic
1096880005 12:54659688-54659710 AGAGTTTAGCAGGTGGAGAGAGG + Intergenic
1097502858 12:60427702-60427724 AGAAATTGCCAGTTGGAGAATGG - Intergenic
1097911173 12:64971055-64971077 AGAATTTGCCAGATGTAGTAAGG + Intergenic
1098099738 12:67002009-67002031 AGAGCTTTGCACATGGAAAAAGG + Intergenic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1099841062 12:87967956-87967978 AGAGTATTTCAGATGGAGAATGG - Intergenic
1100093981 12:91008538-91008560 ACAGTTTCTCAGATGCAGAATGG - Intergenic
1101535672 12:105614074-105614096 AAAGTTCTCCAGATGGATAGTGG - Intergenic
1101573452 12:105976289-105976311 AGAATTTTCCTGATGAAGGAGGG - Intergenic
1101711376 12:107269869-107269891 AAAGTGTTCCAGATGGATAGGGG + Intergenic
1102374878 12:112414096-112414118 ACTGTTTTCCAGGTGGAGAAGGG + Intronic
1103637381 12:122318648-122318670 ACAGCTTTCCAAATGAAGAAAGG + Intronic
1104351035 12:128044179-128044201 AGTTTTCTCCAGCTGGAGAAAGG + Intergenic
1104550926 12:129756581-129756603 AGAGTTCTGGAGATGGATAAGGG + Intronic
1106457127 13:29937307-29937329 AGAGCTTTCCTGATGGAGCCTGG - Intergenic
1107708989 13:43134117-43134139 AGAGGTTTGCAGAGGGAGAAAGG + Intergenic
1108555497 13:51587769-51587791 AGAGAATTTCAGATGAAGAATGG + Intronic
1108676780 13:52743891-52743913 GGAATTTTCCAGGTGGAGATGGG + Intergenic
1108692002 13:52867550-52867572 AGAGGTTTCCAGAAGGTGTAGGG + Intergenic
1109695428 13:65950491-65950513 AAAGTTTTCCAGTTTTAGAAAGG - Intergenic
1109829527 13:67769467-67769489 AGAGATTTTCAGCTGGCGAAGGG - Intergenic
1110275044 13:73633397-73633419 AGAGTTAGCCAGGTGAAGAATGG - Intergenic
1110966263 13:81701158-81701180 AGAGATTTCTATATGGAGAAAGG + Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111510396 13:89254597-89254619 AGAGAATTCCAGAAAGAGAAAGG + Intergenic
1111959279 13:94792033-94792055 AGAGTTTTAAGGAGGGAGAAGGG + Intergenic
1111962097 13:94823152-94823174 AGACTTTTCCAGATTAAGAAGGG + Intergenic
1112235112 13:97629010-97629032 AGATTCTTCCAGATGGAGCCAGG - Intergenic
1112741129 13:102473693-102473715 AGAGTTTTGGAGATGGATAGTGG + Intergenic
1113077736 13:106484507-106484529 ATAGTTTTGGAAATGGAGAATGG + Intergenic
1113794826 13:113050863-113050885 GGAGTTGTCCAGATGGAGGGGGG + Intronic
1114148056 14:20001655-20001677 AGAGTTTTCTTGATGGCAAAGGG + Intergenic
1114494554 14:23123672-23123694 ACAGTGTTCCAGATGGTGAAGGG + Intergenic
1115049602 14:29041698-29041720 AGAATTTTCCAGAAAAAGAATGG - Intergenic
1115174829 14:30549855-30549877 AGAGTTTTCCAGAGGCTGCATGG - Intergenic
1115322523 14:32099044-32099066 AGAGTGTTGGCGATGGAGAATGG + Intronic
1115975651 14:38993680-38993702 TGAGTTTTGCAGTGGGAGAAGGG - Intergenic
1119651788 14:76389099-76389121 AAAGTTTTCCAGATGTAGGAGGG - Intronic
1122167388 14:99838536-99838558 AAAATTATGCAGATGGAGAAGGG - Intronic
1127185864 15:56480084-56480106 AGAGTTCTGGAGATGGACAATGG + Intergenic
1127516245 15:59696024-59696046 AGAGTGGGCCAGATGGAGTAGGG - Intergenic
1127698177 15:61471994-61472016 AGAATTGGCCAGATGAAGAAGGG - Intergenic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128133158 15:65244075-65244097 AGATCTTACCAGATGGAGAAAGG - Intronic
1128173515 15:65533069-65533091 AGAATGTTCCAGAAAGAGAAAGG + Intronic
1129161728 15:73751621-73751643 AGGGTCTTCCAGATGTGGAAGGG + Exonic
1129508443 15:76102489-76102511 AGAGCATTCCAGGTGGAGAAAGG + Intronic
1130111386 15:80968282-80968304 AGATTGCTCCAGAAGGAGAATGG - Intronic
1130119590 15:81036112-81036134 AGAATTTTTCAGATGCACAAAGG - Intronic
1130736547 15:86556417-86556439 AGTGTTTTTCATATAGAGAATGG - Intronic
1131297823 15:91167516-91167538 TGTGTTTTGCAGATGGAGAAAGG - Intronic
1132300625 15:100773471-100773493 TGAATTTTCCAGATGGTGTATGG + Intergenic
1133385241 16:5364576-5364598 AGAGATTTTTAGATAGAGAATGG - Intergenic
1133605480 16:7383584-7383606 ATGGTTTTCAACATGGAGAATGG - Intronic
1133671603 16:8027382-8027404 ACAGGTTTCCATATGGATAATGG - Intergenic
1134379476 16:13710725-13710747 AGAGTTAGCCAGATGAAGGAAGG - Intergenic
1135192511 16:20366341-20366363 TGAGTTACCCAGATGAAGAAGGG - Intronic
1135618074 16:23929070-23929092 GGAGTTTTGGAGATGGGGAAGGG + Intronic
1135791186 16:25397722-25397744 TAAGTTTTCCAGATGTAGGAGGG + Intergenic
1135905155 16:26505251-26505273 AGAATTTTCCAGAAAGAGCAAGG - Intergenic
1135968219 16:27052905-27052927 ACAGGTTTGCAGATGGAGAGAGG - Intergenic
1138256065 16:55562277-55562299 AGAGTTCTCCAAATAGATAAGGG - Intronic
1138998671 16:62481750-62481772 AGAGGTTTCCAGCTGGCAAAGGG + Intergenic
1139015623 16:62685185-62685207 AGAGGTTTCCAGCTGGAAGAGGG + Intergenic
1139928159 16:70503549-70503571 GGAGTATTCCAGATAGAGCAAGG - Intronic
1140104324 16:71945850-71945872 AGAGCTCTCCAGATGAACAAGGG + Intronic
1140325980 16:74004100-74004122 TGAGTGTTCCAAAAGGAGAAAGG - Intergenic
1140627866 16:76816202-76816224 AGAGATGTCCAGGTGGGGAAGGG - Intergenic
1140937879 16:79691563-79691585 CTAGTTTTCAAGATGGAGAAAGG + Intergenic
1140956684 16:79873028-79873050 AGAGACTTCCAGGTGAAGAAGGG + Intergenic
1140984787 16:80147763-80147785 AGAGTGTTCCAGAAAGAGAGAGG - Intergenic
1141020638 16:80492852-80492874 TGAGTTCTACAGATGTAGAAAGG + Intergenic
1141487412 16:84349912-84349934 AGAGATTTGAAGATGGAGGAAGG + Intergenic
1141753749 16:85977356-85977378 AGAGTTGATCAGATGCAGAATGG + Intergenic
1144222707 17:13114539-13114561 TGAGATTTCCAGATAGAGAAAGG + Intergenic
1144311652 17:14019414-14019436 AGAGTTTTACAGATGGAGGGTGG + Intergenic
1144429896 17:15181667-15181689 AGAGTTTCCAAGATGGAGCAGGG + Intergenic
1144840096 17:18180827-18180849 AAGGTTTTCCAGAGGGGGAAGGG + Intergenic
1145397206 17:22505724-22505746 AGAATTTCCCAGGTGGAGCAAGG + Intergenic
1146625182 17:34430015-34430037 AGAGTTGCTCTGATGGAGAATGG + Intergenic
1146626224 17:34437509-34437531 AGTGTTTTTAATATGGAGAATGG - Intergenic
1148288876 17:46423208-46423230 AGTGATTTCCAAATGGGGAAAGG + Intergenic
1148311045 17:46640785-46640807 AGTGATTTCCAAATGGGGAAAGG + Intronic
1148686241 17:49502702-49502724 AGAGTTTTCCCGAGGCAGCAGGG + Intronic
1148715667 17:49713972-49713994 AGGGCTTCCCTGATGGAGAAGGG + Intronic
1148770566 17:50063765-50063787 AGGGTTCTCCAGGTGAAGAAGGG - Intronic
1148991983 17:51673974-51673996 AGAGTTTTCCAGATGAACCTGGG - Intronic
1149211774 17:54311737-54311759 AGTGTTTTCCAGAGGGGGACGGG + Intergenic
1150706087 17:67488670-67488692 AGAGTTCTGCAGATGGATAGTGG - Intronic
1150840972 17:68604992-68605014 GGTGTTTTCCAGGTGGGGAAAGG - Intergenic
1151013588 17:70530127-70530149 TGTGTTTTGCAAATGGAGAAAGG - Intergenic
1151538553 17:74752318-74752340 ACAGGCTGCCAGATGGAGAAGGG - Intronic
1153374392 18:4358927-4358949 AGAGTTAAACACATGGAGAACGG - Intronic
1153823809 18:8856252-8856274 AGAGGTTTCCAGGTGGGCAAAGG - Intergenic
1155280625 18:24235970-24235992 AGAGACTTCCAGATGGAGGATGG + Intronic
1155402319 18:25452519-25452541 AAAGTTTTCCAGTGGGTGAATGG + Intergenic
1157086706 18:44587501-44587523 AGAGTTCTCTAAATGGTGAATGG + Intergenic
1157522676 18:48356164-48356186 AGGGTTTTCCAGCTAGGGAAGGG + Intronic
1157828277 18:50832383-50832405 AGAGCTTTCCAGAAAGACAACGG - Intergenic
1158152902 18:54392750-54392772 TCAGGTTTCCAGAAGGAGAAAGG - Intergenic
1158234894 18:55301850-55301872 AGAGTTTTGGAGGGGGAGAAAGG - Intronic
1158243502 18:55404541-55404563 AGAGTTTTCCTGTTGGAAAAAGG - Intronic
1159983951 18:74820035-74820057 AGAGTATTACAGAAGAAGAAAGG + Intronic
1160362870 18:78298591-78298613 AGGGGTTTGCAGATGGATAAAGG + Intergenic
1162910570 19:13845925-13845947 AGAGAGTTCCAGGTAGAGAACGG + Intergenic
1165005785 19:32805442-32805464 TGATTTTTCCATATGGATAATGG + Intronic
1165286170 19:34844231-34844253 AAAGTTTTGGAGATGGAGAGTGG - Intergenic
1165618092 19:37219704-37219726 AGAGTTACCCAGAGGAAGAATGG + Intronic
1168634144 19:57982252-57982274 TGAGCTTTGCAGATGGAGGAAGG - Intronic
925071203 2:968323-968345 AGAGTATTACAAATGGAAAAGGG - Intronic
925098089 2:1223608-1223630 TGAGTTTTCCTGATGCTGAAAGG + Intronic
925991718 2:9259972-9259994 AGAGTTTCCCAGATAGGGGAGGG - Intronic
926059596 2:9796790-9796812 AGGGTTTTCAAGATGTAAAAGGG + Intergenic
927025956 2:19069471-19069493 GGAGTTTTCCAGATGAACAAGGG - Intergenic
927269027 2:21185734-21185756 AGAATTTTCCAAATATAGAAAGG + Intergenic
927632257 2:24784763-24784785 AGAGTTTACAAGATTCAGAAAGG - Intergenic
927654305 2:24932635-24932657 AGAGTTTTCCAGGTGGACAGAGG + Intergenic
928139502 2:28716102-28716124 AGAGTTCACCAGATAGACAAGGG + Intergenic
929217505 2:39431253-39431275 AGAGTATTCCAGGTGGAGACAGG + Intronic
929939820 2:46325057-46325079 TGACCTTTCCAGATGGAGCAGGG + Intronic
930419017 2:51126180-51126202 AGCATTTTCCAGTTGGAAAAGGG - Intergenic
930776448 2:55176477-55176499 AGAGTTCTCCAGCTAGAGACAGG - Intronic
931778044 2:65556759-65556781 AGGGTGTTCCAGGTGGGGAAAGG + Intergenic
933159129 2:79005207-79005229 AGAATTTTACAGGTGGAAAAGGG + Intergenic
933545457 2:83705696-83705718 ACAGATTACCAGATGGAGAGGGG - Intergenic
933648415 2:84830516-84830538 AGAGTGAACCAGAGGGAGAAGGG + Intronic
933819931 2:86101730-86101752 AGGGTTCTGCAGATGGAGAGTGG - Intronic
936139715 2:109928974-109928996 GGAGCTTTCCAGAGGGAGAAAGG + Intergenic
936204981 2:110442512-110442534 GGAGCTTTCCAGAGGGAGAAAGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936654068 2:114464031-114464053 CGAGTTCTCCAGAAGGTGAATGG - Intronic
937987249 2:127643506-127643528 GGGGTTTGCCAGATGAAGAAGGG + Intronic
939076771 2:137612269-137612291 TGAGTTTTCCAGCTGTGGAAAGG + Intronic
939582079 2:143962266-143962288 GGATTTTGCCAGGTGGAGAAAGG + Intronic
940834646 2:158507535-158507557 AGAGTTTTTCAAATGGGGAAAGG - Intronic
941528559 2:166635838-166635860 AGTGGTTTCCAGATACAGAATGG + Intergenic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
942255220 2:174090459-174090481 ACCGTTTGCCAGCTGGAGAATGG - Intronic
944365890 2:198919190-198919212 ACAGCTTTCAAAATGGAGAAAGG - Intergenic
945968171 2:216210212-216210234 AGAGTTTTAGAGATGGAGGTGGG + Intergenic
946227839 2:218273858-218273880 ACAGTTTTGCAGATGGAGGAGGG - Intronic
946299991 2:218817076-218817098 AGAGTTTTCTACATTGAGAAGGG + Intergenic
946311061 2:218882933-218882955 AGGGTTTTCCAGAGGCAGCAGGG - Intronic
946593177 2:221274106-221274128 AGATTTTGCCTGATGGAGACAGG + Intergenic
946608163 2:221429239-221429261 AGAACTTTCTACATGGAGAATGG - Intronic
948318143 2:237045972-237045994 AGAGTCTTCCAGGAGGGGAAAGG - Intergenic
948562102 2:238861072-238861094 AGAGGACTCCAGATGGAGATGGG + Intronic
1168759278 20:338003-338025 AGAGTTCTCAAGATGGATGATGG - Intergenic
1168958182 20:1849218-1849240 GGAGTTTGCCAGGTAGAGAAGGG - Intergenic
1169167209 20:3434311-3434333 TGACATTTCCAGAGGGAGAATGG + Intergenic
1169330764 20:4714343-4714365 AGAGTTTGCCACTTGGAGATAGG - Intergenic
1169538382 20:6572166-6572188 ATAGTTTTACAGATGTTGAAAGG - Intergenic
1170390670 20:15870343-15870365 AGAATTTTCCAGATTCTGAAAGG - Intronic
1170467667 20:16637727-16637749 AGAAGTTTCCAAATGAAGAAAGG + Intergenic
1170734289 20:19000636-19000658 ATTCTTTTCCAGATGGAAAATGG + Intergenic
1172050715 20:32115481-32115503 AGAGTTTCCCAAATGGGGCATGG + Intronic
1173277053 20:41594459-41594481 GGAGTTTTCCAGATAGTCAAAGG - Intronic
1173303846 20:41829085-41829107 AGAGATTTTCAGCTGGGGAAGGG + Intergenic
1173317084 20:41954790-41954812 GGAGTTTTCCAGAGAGAGAAAGG - Intergenic
1173467175 20:43292498-43292520 ACCATTTTCCAGATGGAGAGAGG + Intergenic
1173537623 20:43828211-43828233 AGAGTTTTCCAGGTGGACAAGGG + Intergenic
1173862413 20:46292770-46292792 ATAGTTCTCCAGGTGGATAATGG - Intronic
1174208115 20:48856093-48856115 AGAGTATTCCAGGTGGAGACAGG + Intergenic
1174532072 20:51222098-51222120 AGAGTTAACCAGATGGAGAAAGG + Intergenic
1174540942 20:51288703-51288725 TCAGTTTTCAAGATGGGGAAAGG + Intergenic
1174721768 20:52820390-52820412 AGATTTTACCAGGTAGAGAAAGG - Intergenic
1174930089 20:54804274-54804296 GGAGTTTTCCAGGTGGAAGAGGG + Intergenic
1175970154 20:62682192-62682214 ACAGCTCTTCAGATGGAGAAGGG + Intronic
1177053257 21:16265906-16265928 GGAATTTTCCAGGTGAAGAAGGG + Intergenic
1178718550 21:34988550-34988572 TGAGTTTGGCAGATGGAGATGGG - Intronic
1178789369 21:35685228-35685250 AGGGTTGTCCACATGGAGAAGGG + Intronic
1178839624 21:36128429-36128451 AGAGATTTGGAGATGGAGGAAGG - Intergenic
1182108590 22:27706664-27706686 GGAGTTTGACAGGTGGAGAAGGG - Intergenic
1182209025 22:28658588-28658610 AGAGTTATAGAGATGGATAATGG + Intronic
1182449695 22:30411947-30411969 AGAGTCTGCCAGATGGAGCAAGG + Intronic
1182711201 22:32324523-32324545 GGAGTTTTCTAGGTGGAGATAGG - Intergenic
1182903104 22:33915274-33915296 AGAGTTTTGAATATTGAGAATGG - Intronic
1183133156 22:35859265-35859287 GGAGTTTTCTAGATGGATTAGGG + Intronic
1184398727 22:44261326-44261348 GGAGTTTTCTAGGTGGAGATAGG - Intronic
1184455165 22:44606034-44606056 TGAGTTTTCCAAATAGACAATGG - Intergenic
949796093 3:7852638-7852660 AGACTTTTACAGAGGTAGAAAGG - Intergenic
950236954 3:11330806-11330828 AGAGTTTTCCAGATGAAGATCGG + Intronic
950387536 3:12672047-12672069 AGAATGTTCCAGACTGAGAAGGG + Intergenic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
950897408 3:16465972-16465994 AGATTTCTCCAGAGGCAGAAAGG + Intronic
951598027 3:24339383-24339405 CCCGTTTTCCAGATGAAGAAAGG + Intronic
951633956 3:24752663-24752685 AGAGTTTCTCCAATGGAGAATGG - Intergenic
951665718 3:25121196-25121218 AGAGTTCCCCAGGTGGAAAAGGG + Intergenic
951698511 3:25470495-25470517 AGCATTTTCCAGATGAGGAAGGG + Intronic
953623766 3:44554131-44554153 TGAGATTTCCAAATGGAGAGGGG + Intergenic
956230372 3:67008480-67008502 AGAGTTTTATACATGGAAAATGG + Exonic
957005300 3:74938756-74938778 TTAGGTTTCCAGAGGGAGAATGG + Intergenic
957514073 3:81228768-81228790 AGAATTTTGCAGCTGGGGAAAGG - Intergenic
958078877 3:88719597-88719619 AGAGTTCTGCAGATGGATGATGG + Intergenic
958703428 3:97622149-97622171 AGAGTTCTGCAGATGGATACTGG - Intronic
959365972 3:105457864-105457886 AGAGTTAGCCAGGTGGAGAGTGG - Intronic
961207941 3:125102215-125102237 AGAGTTTTCCAGATGGAGAAGGG + Intronic
962501673 3:136000440-136000462 AGAGATATCCACATGGAGCAGGG + Intronic
963624896 3:147658934-147658956 AGAGTTTTGGAGATGGATAGTGG - Intergenic
964382824 3:156114841-156114863 AGAGTTTTTCATAGGGGGAAAGG + Intronic
964780017 3:160326905-160326927 AGGGTTTTCTAGATGTATAATGG - Intronic
967560377 3:190911052-190911074 GGAGTTTGCCAAATGAAGAAAGG + Intergenic
970493372 4:16599323-16599345 TGAGTTTTGAAGATGGAGGAAGG - Intronic
972573532 4:40331336-40331358 ACAGCGTTCCAGATGAAGAAGGG - Intergenic
973256813 4:48121835-48121857 AAAGTTTTGGAGATAGAGAATGG + Intronic
973622967 4:52745611-52745633 AGAATTTTCCAGGTTGAGGAGGG + Exonic
973999353 4:56495644-56495666 AGAGTTTTTCATATGTAAAATGG + Intronic
974581038 4:63801838-63801860 AGAGTATTCCAGATAGAAGATGG + Intergenic
974602082 4:64096231-64096253 AAAGTATTCCACATGGATAAAGG - Intergenic
975173046 4:71255090-71255112 AGAGTTTGCCAAATATAGAATGG + Intronic
976263675 4:83170267-83170289 AGAGTTTTGAAGACGGTGAAGGG - Intergenic
976859291 4:89643768-89643790 AGAATTCTCCAGGTGGGGAAGGG + Intergenic
977101153 4:92816528-92816550 AAAGGTTTCCACAAGGAGAAGGG + Intronic
977212156 4:94231325-94231347 AGAGTCTTGTAGATGTAGAAAGG + Intronic
977475010 4:97494703-97494725 AGAGTTTTGCGGAAGGAGTAAGG + Intronic
977743953 4:100522741-100522763 AGAGTTGTCCAGTAGGACAATGG - Intronic
978694708 4:111563861-111563883 AGAGTTTGCCAGATAACGAAAGG - Intergenic
980345598 4:131613078-131613100 AGAGATTGCCAAATGAAGAACGG + Intergenic
980885551 4:138758708-138758730 GGAGTTTGCCAGATGGAAAAGGG + Intergenic
981243182 4:142502883-142502905 TGAGTTTTGCAGTAGGAGAAAGG - Intronic
981486985 4:145297207-145297229 AGAGTATTTCAGATGGAGGCCGG - Intergenic
982003096 4:151038979-151039001 TGAGTTTTCCAGAAAGAGATGGG - Intergenic
982097453 4:151935785-151935807 AGGGTTTTGTAGATGGAGAAGGG + Intergenic
983161455 4:164420598-164420620 AGAGTTTCAATGATGGAGAAAGG + Intergenic
983682174 4:170365906-170365928 AGAATGTTCCAGGTGGACAAGGG + Intergenic
984338419 4:178421952-178421974 AGATTTTTCCAAATGGAATAGGG + Intergenic
984483777 4:180339201-180339223 AGAGATTTCCAGATTGAGGGAGG + Intergenic
984801250 4:183719031-183719053 AGAGCTTTCCAGGTGATGAAAGG + Intergenic
984820438 4:183876885-183876907 AGCGTTTTCTAGACTGAGAACGG + Intronic
987239269 5:15977244-15977266 AGAGTTTTGGAGATGGATGAAGG + Intergenic
987383183 5:17304945-17304967 AGAGTTTTCAAGTTCTAGAAAGG + Intergenic
987593167 5:19959664-19959686 ACAGATTTCCAGAAGGAGAAGGG + Intronic
987674134 5:21052206-21052228 AGAGTTTTCTAAATGTAGTATGG + Intergenic
988124332 5:27009546-27009568 AAAGTATTCCAGAAGGTGAATGG - Intronic
989439084 5:41448971-41448993 AAAGTTTTGCAGGTGCAGAAAGG - Intronic
989730305 5:44640958-44640980 AGATATTTCCAGCTGGTGAAGGG - Intergenic
992018976 5:72603817-72603839 ATAGTTTTCCAGGTGAAGAAGGG - Intergenic
992893793 5:81229745-81229767 AAGGTTTTCCAGTTGGAGACTGG - Exonic
992938841 5:81741388-81741410 AAAGTTCTAGAGATGGAGAACGG + Intronic
993149180 5:84138397-84138419 GTAGTTTTCCAGATGGAGTGTGG - Intronic
993636790 5:90353773-90353795 AAAGCTTTCGAGATGGAAAAGGG - Intergenic
994383217 5:99096565-99096587 TGAGCTTTGAAGATGGAGAAAGG - Intergenic
994662180 5:102667299-102667321 TGAGTATTCAAGATGGAAAAAGG - Intergenic
995401368 5:111745848-111745870 AAAGGTTTCCAGATGGAGTCTGG - Intronic
997623546 5:135316361-135316383 AGACTTTTGCAGTTGCAGAATGG + Intronic
997894460 5:137703779-137703801 AGATATTTCCAGGTGGAGGAGGG - Intronic
998536574 5:142937830-142937852 ACAGTTTTAGAAATGGAGAATGG + Intronic
998736642 5:145149511-145149533 AGAGTTTTCCATATGGGTTATGG - Intergenic
998911923 5:146969267-146969289 AGTGGGTTCCAGATGGAGGAAGG + Intronic
999450301 5:151672876-151672898 AGAGTTCTCCAGCTGGAAATGGG - Intronic
1001080489 5:168663761-168663783 GGAGTTTGCCAGAGTGAGAAAGG - Intronic
1001717404 5:173827842-173827864 GGGGTTTACCAGATGAAGAAGGG + Intergenic
1001743473 5:174072091-174072113 AGAGACTTCCAGAGGGAGAGGGG - Intronic
1001929735 5:175664443-175664465 TGGGTATTCCAGATGTAGAAAGG + Intronic
1001931417 5:175675776-175675798 AGAGTTTGACAGGTGGAGAATGG - Intronic
1002514943 5:179750794-179750816 AGAGTTTGCTAGAAAGAGAAAGG + Intronic
1002940645 6:1712721-1712743 AAAGTTATAAAGATGGAGAAAGG + Intronic
1004330129 6:14713637-14713659 GGAGTTTTTCACATGGTGAAAGG - Intergenic
1004538506 6:16526330-16526352 ACATTTTTCAAGATTGAGAAAGG + Intronic
1006082872 6:31577427-31577449 GGGGTCTTCCAGCTGGAGAAGGG + Exonic
1006190196 6:32202648-32202670 AGAGTTTGCTTGATGGAGAGCGG - Intronic
1006835780 6:36998107-36998129 ACAGGTTTCCAAGTGGAGAAAGG - Intergenic
1007088519 6:39167462-39167484 AGAGCTTGCCACATGGGGAAGGG + Intergenic
1008367248 6:50696436-50696458 AGAGTTTCCCAGAAAGAAAAAGG + Intergenic
1008477812 6:51951186-51951208 ATGGTTTTCTAGATGTAGAAAGG - Intronic
1008891500 6:56497640-56497662 AGAGCTCTCCTGATGAAGAAAGG - Intronic
1009545491 6:65014560-65014582 AGAGTTTTCTAGAAGGATGAGGG + Intronic
1009589714 6:65651578-65651600 AGAGTTTTGCAACTGGAGAGGGG - Intronic
1010267306 6:73881595-73881617 AGAGTTCTGGAGATGGACAATGG - Intergenic
1010946935 6:81985944-81985966 GGACTCTTCCAGATGGAGATTGG - Intergenic
1010968307 6:82237264-82237286 AAGGTTTTACAGATGGAAAAGGG + Intronic
1011268203 6:85548154-85548176 AGAGTTCTGGAGATGGGGAATGG + Intronic
1011394312 6:86890610-86890632 AGACTTTTCTAAATGGAGCATGG + Intergenic
1011447659 6:87459633-87459655 TGATTTTTCCACATGGGGAAAGG + Intronic
1012532045 6:100249940-100249962 AGTATTTTCCAGTTGGAGAAAGG - Intergenic
1013158885 6:107522328-107522350 AGAATTTTCTAGATGCAGAATGG + Intronic
1014080122 6:117276194-117276216 TGCTTTTTCCAGATGCAGAAGGG - Intergenic
1015106396 6:129541775-129541797 AGAGTTCTGGAGATGGATAATGG - Intergenic
1015586405 6:134780915-134780937 AGAGTTTTCCAGGTGGTAATAGG + Intergenic
1016615037 6:146037950-146037972 AGAGTTGCTCAGATGCAGAAGGG - Intronic
1016876701 6:148872785-148872807 TGTGTTTTGCAGATGGAGGAAGG - Intronic
1017563837 6:155662989-155663011 AAAGTTTTCAAGTAGGAGAATGG + Intergenic
1018957513 6:168420035-168420057 AGAAGTTTCCAGGTGGATAAGGG - Intergenic
1021725820 7:23547227-23547249 AGAGGTCTCCAGATGCAGATGGG + Intergenic
1023091321 7:36619993-36620015 AGAGTATTCTAGGTGGAGAGGGG + Intronic
1024202263 7:47119463-47119485 AGAATGTTCCAGGGGGAGAAGGG + Intergenic
1024823106 7:53357119-53357141 AGAATTTTCCACATAGAGAGTGG - Intergenic
1025614091 7:63103213-63103235 AGAGATGTACAGATGGTGAAAGG - Intergenic
1027389737 7:77693049-77693071 AGAGCTTTCTAGCTGTAGAATGG + Intergenic
1027492164 7:78841793-78841815 AATGATTTCCAGATGAAGAAAGG - Intronic
1027525797 7:79267234-79267256 AGAGATTTGCAGCAGGAGAAAGG - Intronic
1028102700 7:86840762-86840784 AAAGTTTTCCAGAAGCATAATGG + Intronic
1030349367 7:108466665-108466687 AGAGTCTACCTGATGGGGAAGGG + Intergenic
1030601276 7:111595978-111596000 AGAGTTTTGGAAATGGAGAGTGG + Intergenic
1031140787 7:117940924-117940946 AGAGTCTTCATGTTGGAGAATGG + Intergenic
1031315462 7:120252953-120252975 AGAAGTTGCCAGATAGAGAAAGG + Intergenic
1031543203 7:123021274-123021296 AGACATTTCCAGATAGAAAAAGG - Intergenic
1031870195 7:127082587-127082609 AGAGTTTTCCATTAGAAGAATGG - Intronic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1032647052 7:133836396-133836418 AGAATTGGCCAGAAGGAGAAGGG - Intronic
1032654165 7:133909473-133909495 AGAGCACTCCAGGTGGAGAAAGG + Intronic
1032890025 7:136184077-136184099 AGAGTTTTGAAGATGGAGGAAGG + Intergenic
1033045345 7:137957187-137957209 GCAGTTTTCCAGGTGGAGAAGGG - Intronic
1034107190 7:148500538-148500560 AGAGTTTTCCTGGAGGAGAAGGG - Intergenic
1034136767 7:148778174-148778196 ACAGTTCTTCAGATGGAGCATGG - Intronic
1034662025 7:152779376-152779398 TGAGTTTTCCAGTTGTAGCATGG - Intronic
1034974882 7:155442283-155442305 AGAGTTTTCCAGTGGCAGAGAGG - Intergenic
1035987028 8:4445856-4445878 AGTGTTCTCCCGCTGGAGAAGGG + Intronic
1036502844 8:9329231-9329253 AGGGTTTTGCAGGTAGAGAAAGG + Intergenic
1036761413 8:11511613-11511635 AGAGATTCCCAGAGGAAGAAAGG - Intronic
1037410289 8:18588761-18588783 TGAGTCATCAAGATGGAGAATGG - Intronic
1037420659 8:18698492-18698514 AGAGGTTTGAAGGTGGAGAAAGG + Intronic
1037436549 8:18869639-18869661 AGAGTTTGCCAGCCAGAGAAGGG - Intronic
1038663520 8:29517693-29517715 GGAGTTTACCAGATGGGGAAGGG + Intergenic
1038947336 8:32375639-32375661 AGATTTTTCCAGATGTTCAAAGG - Intronic
1040722567 8:50344320-50344342 AGAGATCTCCAGCTGGAGCAAGG + Intronic
1041710297 8:60888272-60888294 AGACTTGTCCAGTTGGAGACTGG + Intergenic
1042465015 8:69119061-69119083 AAAATTTTCCAAATGGAGAACGG - Intergenic
1042557001 8:70042038-70042060 AGAGTTTTGGAGCTGGATAATGG - Intergenic
1043670280 8:82876093-82876115 AAAGTTATCCAGATGTAGGATGG + Intergenic
1043961311 8:86421901-86421923 AAAATTTTGCAGATGGGGAAGGG + Intronic
1044732074 8:95237049-95237071 AGAGTTTTCCCCATGGAGTAAGG - Intergenic
1044866409 8:96575181-96575203 ACAGTTTTCATGAAGGAGAAAGG - Intronic
1044885561 8:96773453-96773475 TGATTTCTCCAAATGGAGAAAGG + Intronic
1045235971 8:100352873-100352895 GGAGTTTGCCAGATAGAGAATGG + Intronic
1045625522 8:104043759-104043781 TGAGTTTCCAAGATGGAGCATGG + Intronic
1045868801 8:106901818-106901840 AGAGTTTTCTAGATATAGAGTGG + Intergenic
1046625022 8:116567615-116567637 AGAGTATTCCAGATGGACAAGGG - Intergenic
1046754785 8:117962217-117962239 AGAGTATTCCAAATAGATAATGG - Intronic
1047152273 8:122277278-122277300 AGAGTTTTTCACATGAAGAGCGG - Intergenic
1047194367 8:122708098-122708120 GTCGTTCTCCAGATGGAGAAGGG + Intergenic
1047819261 8:128500786-128500808 GGAGTGTTCCAGATTGAGAAAGG - Intergenic
1047823738 8:128550629-128550651 AGAGTTTTCCATAGGGAGATGGG + Intergenic
1048791956 8:138112463-138112485 AGAGTTTTCCAGATAGAGGATGG - Intergenic
1049274478 8:141712953-141712975 AGAGCTTTTCAGAGGGAGGATGG + Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1051159869 9:14195257-14195279 AGAGCTTTGCAGATGGATGAAGG - Intronic
1051675308 9:19552791-19552813 TGACTTTGGCAGATGGAGAAAGG - Intronic
1051994358 9:23196813-23196835 AGAGGTTTTCAGCTGGAAAAGGG + Intergenic
1052029022 9:23607534-23607556 AAAGTGTTCCACATGGAGAATGG - Intergenic
1052937697 9:34106751-34106773 AGAGAGTTCCAGATGGAAGATGG - Intronic
1053529174 9:38861427-38861449 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054201399 9:62085856-62085878 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054529632 9:66167266-66167288 AGGGTTTTCCAGAACGGGAAAGG - Intergenic
1054636960 9:67502504-67502526 TGAGAGTTCCAGAAGGAGAAGGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055312508 9:74997598-74997620 AAAATTTTGCAGATGGGGAATGG - Intronic
1055788510 9:79896959-79896981 AGAATTGTCCACATGGAGATAGG - Intergenic
1057966950 9:99513477-99513499 AAAGTTATACAGATGGAAAATGG + Intergenic
1058286389 9:103185010-103185032 ATGGTTTTGAAGATGGAGAAAGG + Intergenic
1058422574 9:104846586-104846608 AGAGAATTCCAAATGCAGAAGGG + Intronic
1059266031 9:113031464-113031486 AGAGTAATGGAGATGGAGAATGG + Intergenic
1059287276 9:113185416-113185438 AGCGTATCCCAGATGGAGAAGGG + Intronic
1059350770 9:113663274-113663296 AGTGTTTTCCAGGTGGGGATGGG - Intergenic
1060002100 9:119968244-119968266 GGAGTTTTCCAGTTGTGGAAGGG + Intergenic
1060213964 9:121727174-121727196 AGGGATCTCCAGATGGGGAATGG - Intronic
1060266315 9:122113491-122113513 GGAGTTTGCCAGATAGAGGAGGG + Intergenic
1060815513 9:126633076-126633098 AGAGTTTTCCAGAAGAAGAAAGG - Intronic
1061077203 9:128348828-128348850 ACCATTTTCCAGATGGAAAAAGG - Intronic
1061423330 9:130483968-130483990 GGAACATTCCAGATGGAGAATGG + Intronic
1061653153 9:132067435-132067457 AGAGTTTTCCACAGAAAGAAAGG + Intronic
1062217930 9:135399219-135399241 AGAGATTTCCAGAGGAAGATGGG + Intergenic
1186055374 X:5644128-5644150 AAAGTTTTGCAGTGGGAGAAGGG + Intergenic
1186212752 X:7267221-7267243 AGACTCTTCCATCTGGAGAAAGG - Intronic
1186441698 X:9592577-9592599 AGAGTTTTGGAGAAGGATAATGG - Intronic
1186732879 X:12429128-12429150 AGTCTTCTCCAGCTGGAGAAGGG + Intronic
1187654835 X:21459946-21459968 AGAGTTTTGGAAAGGGAGAAGGG - Intronic
1187972998 X:24677136-24677158 AGAGTGTTCTAGAAGGAGGATGG - Intergenic
1189011184 X:37047188-37047210 AGAGTTTTGGAGAAGGAGTAGGG - Intergenic
1189166700 X:38867857-38867879 AGAGTGGTGCAGTTGGAGAAAGG - Intergenic
1189345244 X:40236141-40236163 AGAGTTCTGGAGATGGATAATGG - Intergenic
1189354935 X:40303456-40303478 GGAGTTTTCCAGGTGGACAAAGG + Intergenic
1190899819 X:54659924-54659946 TGAGATTTCCAGAAAGAGAAAGG - Intergenic
1191861635 X:65670292-65670314 AGCGTGTGACAGATGGAGAAAGG + Intronic
1192044056 X:67653472-67653494 AGAGTTTGCCAGATACAAAAAGG + Intronic
1192054786 X:67761912-67761934 ATAATTTTCCAGATGAAAAATGG - Intergenic
1192545085 X:72006459-72006481 AGATTTTTCCAAATGGAAAGAGG - Intergenic
1192596067 X:72409633-72409655 AGTGTTTTCCAGTTGAAGAAAGG - Intronic
1195376076 X:104229475-104229497 AGAGTTAACAAGATGAAGAATGG - Intergenic
1195381829 X:104278353-104278375 AGAGTTTTTCAGAGGGAGTGTGG - Intergenic
1195842237 X:109186818-109186840 AGAAGTTTATAGATGGAGAAGGG + Intergenic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1197780643 X:130156343-130156365 AAATTTTTCCAAAAGGAGAAAGG + Intronic
1197845330 X:130795820-130795842 AAAGTTCTCCAGGTGGAAAAAGG - Intronic
1197923588 X:131622571-131622593 AGAGTTTGCCAGTTGGATAAGGG + Intergenic
1198001231 X:132439466-132439488 AGAGTTTGCCATGTGGAAAATGG - Exonic
1198948934 X:142047288-142047310 AGATTTCTCCTGATAGAGAAAGG - Intergenic
1198990218 X:142505177-142505199 TGAGTTTAACAGCTGGAGAAGGG - Intergenic
1199315841 X:146376749-146376771 AGAGTTTTTGAGAGGGTGAAAGG - Intergenic
1199336560 X:146624824-146624846 ATAGCTTTGAAGATGGAGAAAGG - Intergenic
1199550976 X:149061044-149061066 TGAGTTTTCCTGATGGAGACAGG - Intergenic
1200024540 X:153245790-153245812 AGAGTTTTAGAAATGGTGAAGGG + Intergenic
1201177340 Y:11316837-11316859 AGAATTTCACAGATGGACAAGGG - Intergenic
1201632666 Y:16086283-16086305 AAAGTTTTGGAGATGGAGGATGG + Intergenic