ID: 961212068

View in Genome Browser
Species Human (GRCh38)
Location 3:125133127-125133149
Sequence TGTTTGGCTTTGAAGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961212068 Original CRISPR TGTTTGGCTTTGAAGAGGAG AGG Intronic
900342929 1:2197235-2197257 TGTTTGGCTTTCCAGGGGTGGGG - Intronic
901137061 1:7004680-7004702 TGGTTGTCTTTGAGGAGGATGGG - Intronic
903010714 1:20328208-20328230 TGTTTGATTCTAAAGAGGAGGGG - Intronic
903464507 1:23542766-23542788 TGTTTGTTTTTGTAGAGAAGGGG + Intergenic
904068294 1:27772726-27772748 TGTTTAGATTAGAAGAGGGGTGG + Intergenic
904503879 1:30935055-30935077 GGTTTGGGATTGAAGAGAAGTGG - Intronic
906932400 1:50182739-50182761 TGTTTTGCTTTAAAAATGAGTGG - Intronic
907104588 1:51870978-51871000 TGTTTGGTTTTAAAGGGGAAGGG - Intronic
907824591 1:58003267-58003289 TCTTTGTCATTGAAGCGGAGAGG - Intronic
908214442 1:61936414-61936436 TTTTGGTCTTGGAAGAGGAGAGG - Intronic
908820841 1:68084948-68084970 TGTTGGGCTTTGAATAGAAGAGG + Intergenic
910951437 1:92653002-92653024 TGTTTGGGTTTGCAGGGTAGAGG - Intronic
911223572 1:95278372-95278394 TGGTTGTCTCTGAAGAGGAAAGG - Intergenic
911716320 1:101137545-101137567 TGTTTTGTTTTGCAGAGGGGTGG + Intergenic
912128853 1:106576051-106576073 TGTTTGGGGTTGAGGAAGAGAGG - Intergenic
914862527 1:151398594-151398616 TGTTTTGTTTTGTAGAGGTGAGG + Intergenic
914930990 1:151932949-151932971 TGTTTGGGTTTGAAGAGGGTAGG - Intergenic
915063950 1:153209381-153209403 TGTCTGGCTTTGAAGCTGAAAGG + Intergenic
915434488 1:155893593-155893615 TGTATGGCTTTTATGAGGATGGG - Intergenic
915530242 1:156499055-156499077 TGTTGGGGTTGGGAGAGGAGTGG + Intronic
916833851 1:168521339-168521361 CATTTTGCTTTGAAAAGGAGGGG + Intergenic
916960944 1:169888865-169888887 TGCTTGGCTTTGAGGAAGAGTGG - Exonic
917451557 1:175151534-175151556 TGGTGGGCTTTGAGGAGGATGGG + Intergenic
918681460 1:187360124-187360146 TGTTTTGTTTTGAATAGGAGGGG + Intergenic
919414453 1:197290297-197290319 TGTGTGTGTTTGAAGAGAAGTGG + Intronic
920084560 1:203405845-203405867 TGTTTTGCTTTGCAGGAGAGAGG - Intergenic
920213263 1:204344290-204344312 TGTTTGTTTTTGAGAAGGAGCGG - Intronic
920363059 1:205432545-205432567 TGTCAGACTTTGGAGAGGAGAGG + Intronic
920939127 1:210464491-210464513 TGTTTGCCTTTCAGGAGGACTGG + Exonic
921410242 1:214828516-214828538 TTTTTGGGTTTGTAGATGAGTGG + Intergenic
921799341 1:219383990-219384012 AGGTTGGCTGGGAAGAGGAGGGG - Intergenic
921841438 1:219832953-219832975 TGTTTTGCTATGATGACGAGAGG - Intronic
922168242 1:223133724-223133746 TGTGAGGCTTTGAGGAGGAGGGG + Intronic
1063205155 10:3824049-3824071 TGTTTCTCTTTGAAGATCAGAGG - Intergenic
1063845940 10:10126846-10126868 TTTCTGGCTTTGAAGATGGGAGG - Intergenic
1063897964 10:10702060-10702082 TGTTTGATTTTGGAGGGGAGCGG + Intergenic
1064544288 10:16435800-16435822 TGCTTGGCTTTGGGGATGAGGGG - Intergenic
1065163799 10:22953165-22953187 TTTCTGGCTTTGAAGACGAAAGG + Intronic
1065541979 10:26779613-26779635 TAGTTTGCTTGGAAGAGGAGGGG + Intronic
1066378893 10:34884608-34884630 TGTTTGGATTTGGAAAAGAGGGG - Intergenic
1068599973 10:58946519-58946541 TGGGTGGCTTTGAAGATGAAAGG - Intergenic
1068659786 10:59612148-59612170 TGTTTTGTTTTGAAGAGATGAGG + Intergenic
1068984589 10:63095387-63095409 TCATTGTCTTGGAAGAGGAGGGG - Intergenic
1069652860 10:70063713-70063735 TCTGTGGCTCTGGAGAGGAGGGG - Intronic
1070154438 10:73824852-73824874 TTTCTGGCTTTGCAAAGGAGAGG + Intronic
1071087585 10:81880651-81880673 TGTTTGGCATTGGAGATGAGAGG - Intronic
1072890199 10:99316714-99316736 TGTTTGGCTCTGAGGGGGCGGGG - Intergenic
1072905798 10:99452162-99452184 TGTGTGTGTTTGAAGAGAAGAGG - Intergenic
1073042204 10:100615280-100615302 TGTGTGGGTTTGGGGAGGAGGGG + Intergenic
1074032838 10:109705697-109705719 TGTTTGGCTATGAGGAGGAGAGG + Intergenic
1074596275 10:114870681-114870703 TGTAGGGCTCTGACGAGGAGAGG + Intronic
1074637301 10:115335297-115335319 TTTTTGGCTGTGAAGATGTGAGG + Intronic
1075714309 10:124547402-124547424 TGTCAGGCTTTGCAGAGGAAAGG + Intronic
1075837917 10:125472173-125472195 TCTTTGGCTATGAATAGGAAAGG + Intergenic
1077137255 11:1006935-1006957 TGTGAGGCTTCGGAGAGGAGGGG - Intronic
1077663637 11:4090341-4090363 TGTTGGCCTTTAAAGAGCAGTGG - Intronic
1078506538 11:11953538-11953560 TCTTTGGCTATGCAGAGGATAGG - Intronic
1080697411 11:34614652-34614674 TATTTGGCTCTGAAGGGCAGGGG + Intergenic
1081178838 11:39962682-39962704 TCTCTGGCTTTGTAGAAGAGAGG + Intergenic
1081493298 11:43583089-43583111 TTTCTGGCTGGGAAGAGGAGGGG - Intronic
1085198244 11:74684969-74684991 TGTTTGGGATTGAACAGGGGTGG - Intergenic
1085733538 11:79019395-79019417 AGTTGGGCTTTGGAGAGGATGGG - Intronic
1087782798 11:102318976-102318998 TGCTTGGCTGTGAAGAGAAGGGG + Intronic
1089342234 11:117765916-117765938 TGTTTTGCTCTGAAGAAGTGGGG - Intronic
1089595422 11:119576033-119576055 TGTCTTTCTTAGAAGAGGAGAGG - Intergenic
1090098977 11:123773746-123773768 TATCTGGCTTTGGAGAGAAGGGG + Intergenic
1090281266 11:125458125-125458147 ACTTTGGCTTTGAATAGCAGCGG - Intronic
1090390941 11:126386798-126386820 TGTTTTGACTTGGAGAGGAGAGG + Intronic
1090859272 11:130638679-130638701 TGTTTGACCTTGAAGAGATGGGG - Intergenic
1091070985 11:132563048-132563070 TGTGTGCCACTGAAGAGGAGAGG - Intronic
1091093362 11:132793461-132793483 TCTTTGGCTTTAAGGAGAAGGGG - Intronic
1091691333 12:2599395-2599417 TGTTTGGCCTTAAAAAGGAAAGG + Intronic
1092816718 12:12318758-12318780 TGTTTGGTTTTGAGGATAAGTGG - Intergenic
1092972326 12:13708571-13708593 TTTTGGCATTTGAAGAGGAGAGG + Intronic
1093728085 12:22539077-22539099 TGTATGGCTATGAAGGGGGGAGG - Intronic
1095431661 12:42141063-42141085 TGATTGGTGTTGGAGAGGAGCGG - Intronic
1096323983 12:50641735-50641757 TGTGTGGCTTTGATAAGCAGAGG + Intronic
1096483684 12:51961048-51961070 GGTTTGGCTAGGAAGAGAAGTGG - Intronic
1096584750 12:52612682-52612704 TGTGTGGCTTGACAGAGGAGTGG - Intronic
1096787370 12:54024893-54024915 TGTTTTGCATTGGAGAGGACTGG + Intronic
1097327565 12:58295895-58295917 TGTTTGGGTTTGATGAAGAATGG - Intergenic
1097616832 12:61893581-61893603 GGGTTGGCTTTGAATAGCAGTGG + Intronic
1098153060 12:67568111-67568133 TGGCTGGCTTTGAAGATGAAGGG + Intergenic
1098334721 12:69391392-69391414 TGTGTGGATTTGAACAGAAGAGG - Intergenic
1099102271 12:78457668-78457690 TTTTTGGAGTTGAAGAAGAGTGG + Intergenic
1099966882 12:89456367-89456389 TGTTTGTCTTTTTAGAAGAGAGG + Intronic
1100041463 12:90323944-90323966 AGTTTTGCTTTGAACAAGAGTGG + Intergenic
1101545381 12:105707322-105707344 TGTTTTGTTTTGCAGAGGGGAGG + Intergenic
1101555670 12:105806668-105806690 TCTTTCGCTTTGTAGATGAGGGG - Intergenic
1101976309 12:109362564-109362586 TGCTTGGGTTTGATGAAGAGGGG + Intronic
1102649855 12:114432569-114432591 GGTTTGTCTTAGAAGAGGAAAGG - Intergenic
1106101598 13:26698140-26698162 TGGCTGGCTTTGGAGAGAAGAGG - Intergenic
1106872589 13:34037800-34037822 TGTGTGTCCTGGAAGAGGAGGGG - Intergenic
1108083317 13:46759730-46759752 TGTTTGTTTTTGTAGAGGAGGGG - Intergenic
1108670135 13:52678315-52678337 TGTTTTGTTTTGAGGAGGAATGG + Intronic
1109040237 13:57324963-57324985 TGTATTGCTTTGAAGAGAAGAGG + Intergenic
1109789282 13:67226773-67226795 CGCTTGGCTTTGGAGGGGAGGGG + Exonic
1110221976 13:73083617-73083639 TGTTGGGGTTCGAAGAGAAGTGG - Intergenic
1110664968 13:78106236-78106258 TGTTTGCTTTTAATGAGGAGTGG - Intergenic
1110915784 13:81019096-81019118 TGTCTGGCTTTGAAGAAAACAGG - Intergenic
1110927442 13:81172750-81172772 TGTTTGGCTTTGATTAGCAGGGG - Intergenic
1111612475 13:90621769-90621791 TGGTTGGTTTTGAAGATGAAAGG + Intergenic
1112002587 13:95224930-95224952 TGTATGGCGGTGAAGATGAGGGG + Intronic
1114416140 14:22545946-22545968 AGGTTGGCTTTAAAGAGGAAAGG - Intergenic
1115316673 14:32032435-32032457 TGTTTTGTTTTGTAGAGGTGGGG - Intergenic
1115414062 14:33111040-33111062 AGTTTGTCTCTGAAGAGGAGAGG + Intronic
1115522987 14:34251814-34251836 TGCCTGGCTTTGCTGAGGAGCGG - Intronic
1116429578 14:44830450-44830472 TGTTAGCCTTTGCAGAGGAGGGG - Intergenic
1117900048 14:60522785-60522807 TGTTTCTCTTTGCAGTGGAGGGG + Intergenic
1117912937 14:60651747-60651769 TGTTTGTCTTTTAAGAGACGTGG - Intronic
1119188596 14:72663187-72663209 TGTTTGGTTTCTAAGTGGAGGGG - Intronic
1119394316 14:74314999-74315021 TGGCTGGCTTTGAAGAAGAAGGG + Intronic
1119920909 14:78445116-78445138 TGTTAGGCTTTGCTGAGCAGTGG + Intronic
1120010526 14:79408256-79408278 TGTTTGGTTTTGAGGAGCAAAGG - Intronic
1121544426 14:94753058-94753080 TGTTTGTCTTTTAGGAAGAGTGG - Intergenic
1121655453 14:95592228-95592250 TTTTTGGCTTTGGAGAGAAAAGG - Intergenic
1122101850 14:99418705-99418727 AGTATTGCTTTGAAGAGGAAGGG - Intronic
1122432244 14:101660494-101660516 TATTTGGCTTTAAAAAGGAAGGG - Intergenic
1124619228 15:31264664-31264686 CTTTTGGCTTTGAGAAGGAGGGG + Intergenic
1124882673 15:33656801-33656823 TTGTTGGCTTTGAAATGGAGGGG - Intronic
1126098476 15:45105799-45105821 TGTTTAGTTCTGAAGAGGAACGG - Exonic
1126311883 15:47326813-47326835 TGTGTGGCTTTGGTGGGGAGGGG - Intronic
1127367375 15:58304209-58304231 TCTTTAGCTTTGAAATGGAGAGG + Intronic
1128393741 15:67201936-67201958 TCTTTGGCTTTAAAGAGAAAGGG + Exonic
1128600786 15:68993769-68993791 TGGTTGGCCTCCAAGAGGAGGGG + Intronic
1129062715 15:72873172-72873194 TGGTTGCCTTTGAAGATGGGAGG + Intergenic
1129522932 15:76197144-76197166 TGCTTGTCCTTGGAGAGGAGCGG + Intronic
1129660483 15:77550321-77550343 TGTGTGGCTTTGGGGAGGGGTGG + Intergenic
1130348212 15:83067656-83067678 TGTTTTGCCTGGAAGTGGAGGGG + Intergenic
1132860192 16:2066964-2066986 TGTGAGGCTTTGAAAAGTAGAGG - Intronic
1134103070 16:11466215-11466237 TGGTTGGCTTTCAGGAGGGGTGG + Intronic
1134369386 16:13608923-13608945 TGACTGGCTTTGAAGAAAAGGGG - Intergenic
1135036283 16:19079778-19079800 GGTCTGGCTTTGAAGGGTAGTGG + Exonic
1136313084 16:29428698-29428720 TGTTAGGCTCTGAAGAGAACAGG - Intergenic
1139828281 16:69775072-69775094 TGTTTAGGTTTGATGAAGAGTGG + Intronic
1139887717 16:70222769-70222791 TGTTAGGCTCTGAAGAGAACAGG - Intergenic
1139892906 16:70265550-70265572 TGGATGGCTTTGAAGAGGAGAGG - Exonic
1141013964 16:80430025-80430047 TGATTGCCTTTGAGGAGGAAGGG - Intergenic
1143051196 17:4127333-4127355 TGTTTTGCTTTGAGGAGAAAAGG + Intronic
1144143618 17:12375645-12375667 TGTTTGGCATTGAACAGAACAGG + Intergenic
1144344163 17:14334949-14334971 TGTTTTGCTTTGGAGTGGGGAGG + Intronic
1146797016 17:35788873-35788895 TGTCTGGCTTGGAATGGGAGTGG + Intronic
1148249692 17:46065571-46065593 TCTGAGGCTTTGGAGAGGAGTGG + Intronic
1148328901 17:46801217-46801239 TGTTGGGGTTGGGAGAGGAGCGG + Intronic
1148359943 17:47003458-47003480 TGTTTGGCTCTGAAGCCCAGTGG + Intronic
1149680913 17:58506680-58506702 TGGGTGGCTTTGGTGAGGAGGGG - Intronic
1150503203 17:65671096-65671118 TGTTTGGCTGAGAAGGGGGGTGG + Intronic
1150786913 17:68170429-68170451 TGTTTGGCTCTGAAGCCCAGTGG - Intergenic
1150910631 17:69383984-69384006 AGTTTGGCTTTGGAAAGGACTGG + Intergenic
1151538749 17:74753451-74753473 TGTTTGGATTTGAAATGGACAGG + Intronic
1152136275 17:78505651-78505673 TGTTTGGCTTAGAAGGGCTGCGG - Intronic
1152275621 17:79355043-79355065 TGTGGGGCTATAAAGAGGAGAGG - Intronic
1155031768 18:21991144-21991166 TCTTGGCTTTTGAAGAGGAGGGG + Intergenic
1155139674 18:23033096-23033118 TGTTTGACTTTGTAGAGTTGAGG + Intergenic
1156353948 18:36325152-36325174 AGTTTACCTTTGGAGAGGAGGGG + Intronic
1156390394 18:36644926-36644948 TGTTTTGTTTTAAAGAGGAGAGG + Intronic
1156919056 18:42497096-42497118 TGCTTAGCTTTAAAGAGGTGAGG - Intergenic
1158543517 18:58377281-58377303 TGTTTGGCATTGGGGAGGAATGG - Intronic
1158886231 18:61829698-61829720 GCTTTGGATTGGAAGAGGAGGGG - Intronic
1158913039 18:62086961-62086983 AGAGTGACTTTGAAGAGGAGTGG + Intronic
1159049442 18:63405783-63405805 TGTTTGTTTTTGTAGAGGTGGGG - Intronic
1162138959 19:8573943-8573965 TGTTGGGTTTTGAACAGGATAGG - Intronic
1164014966 19:21247040-21247062 TGTTTGGGTTTGATAGGGAGAGG - Intronic
1164028224 19:21373434-21373456 TGTTTGGTTTTGATAGGGAGAGG + Intronic
1165285296 19:34837285-34837307 TGTTAGGTTTTGAAGGGAAGGGG + Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1166042513 19:40212539-40212561 GGTTAGGCTGTGAAGAGGAGGGG + Intronic
1166824604 19:45601153-45601175 TGTTTGGCGCAGAAGTGGAGAGG - Intronic
1167577032 19:50322865-50322887 TGGTTGGCGTCGAAGAGGTGAGG - Intronic
926227697 2:10979928-10979950 TATTTTGCGTTGAAAAGGAGAGG - Intergenic
926621661 2:15051631-15051653 TGTCTTGCTCTGAAGAGGAATGG - Intergenic
927018503 2:18993807-18993829 TGTTTTGCTTTGCTGAGGAAAGG + Intergenic
927881989 2:26695439-26695461 TGGGAGGCTTTGAGGAGGAGGGG - Intronic
927969134 2:27293502-27293524 TGTTTGTCTGTGAAATGGAGAGG - Intronic
928245616 2:29624464-29624486 TGTTCAGGTTTGCAGAGGAGCGG + Intronic
928342490 2:30456623-30456645 TCTTTGGCTTAGGAGAGCAGGGG + Intronic
928802964 2:35116088-35116110 TCTCTGCCTTTGAAAAGGAGAGG + Intergenic
928870851 2:35976866-35976888 TGGGAGGCTTTGAAGAGAAGGGG - Intergenic
931769471 2:65485356-65485378 TGTTTAGGTTTGATGAAGAGTGG + Intergenic
932740847 2:74290139-74290161 TGTCTGGCCTTGAAGGGGAAAGG - Intronic
933245335 2:79968633-79968655 TGTTTGGTTTTGCAGAGTTGAGG - Intronic
933689027 2:85165096-85165118 TCTGTGGCATTGAAGAGGATAGG + Intronic
935374080 2:102377683-102377705 TGTTTGGCTCTGAAATGAAGTGG - Intronic
938185020 2:129223900-129223922 TGCTTGTCTTTGAAAAGCAGTGG + Intergenic
938943920 2:136193342-136193364 TGTCTGGCTTTGAGGAAAAGGGG - Intergenic
939879989 2:147620218-147620240 TGTTGTGGTTTGAAGAAGAGAGG + Intergenic
941174245 2:162177561-162177583 CATTTGACTTTGAAGAGGAGAGG - Intronic
942258431 2:174131131-174131153 TGATTATCTCTGAAGAGGAGTGG - Intronic
942547252 2:177078218-177078240 TGCTTTGGTTTGAAGAAGAGTGG + Intergenic
942681824 2:178484789-178484811 AGTTTGGCTTCAAAGAGGAGTGG + Intronic
943637346 2:190320329-190320351 TGTGTGTCTTTGAGGAAGAGTGG - Intronic
944900305 2:204207115-204207137 TGATTGGGTTTGATGAAGAGTGG + Intergenic
945728527 2:213503829-213503851 TGTTTGGCTTTCAAGTGGTGAGG - Intronic
946025082 2:216666846-216666868 TCTGTTGCATTGAAGAGGAGTGG + Intergenic
946466482 2:219916555-219916577 TGTTGGGTTTTGAAAAGGAAGGG + Intergenic
946549147 2:220781397-220781419 TGTATTTCTTTGAACAGGAGTGG + Intergenic
946576964 2:221086280-221086302 TGTTTGTCTTTGTAGAGCTGAGG + Intergenic
946679097 2:222194638-222194660 TTTCTGGCTTGGAAGAGTAGAGG - Intergenic
947863369 2:233378861-233378883 TGCTTTGCTTTGTAGAGGCGGGG - Intronic
948165707 2:235860629-235860651 TGTTTTGCTTTACAGAGAAGTGG + Intronic
948331744 2:237173068-237173090 TATTTAGCCTTAAAGAGGAGGGG - Intergenic
948966953 2:241389978-241390000 AGTTTGGCTTAGAAGAGCAGAGG - Intronic
949005709 2:241645960-241645982 TGCTTGGCAGTGAACAGGAGTGG - Intronic
1169905180 20:10595526-10595548 TGTTTAGCTTTAGAGAGTAGTGG + Intronic
1170483527 20:16792886-16792908 TGTGTTCCTTTGGAGAGGAGAGG + Intergenic
1175108424 20:56630052-56630074 AGTTTGGCTTTCAAAAGAAGTGG + Intronic
1175998416 20:62821492-62821514 TGTTTGGCTTTGCAGGGCAAAGG + Exonic
1177194329 21:17886757-17886779 TGTTTAGCTCTGAAGAAAAGAGG - Intergenic
1181468793 22:23125466-23125488 TGTAGGGTTTTGGAGAGGAGGGG + Intronic
1181508162 22:23375729-23375751 TGGTTGGGTTTGAGGAGAAGGGG - Intergenic
1181579022 22:23816678-23816700 TGTTTGGCTTCAAAGAAGAAGGG + Intronic
1181804061 22:25364605-25364627 TGTTGGGCTATAAAGAAGAGAGG + Intronic
1182029928 22:27150655-27150677 TGGTTTGCTTAGAAGACGAGGGG + Intergenic
1182127342 22:27825664-27825686 TGCTTGGCTTTGAAGATGGAAGG - Intergenic
1182900667 22:33895625-33895647 TGGGTGGCTTTGAGGAGCAGAGG - Intronic
1184487222 22:44787165-44787187 TGCTAGGCTTTAAAGAGCAGAGG + Intronic
949268865 3:2191100-2191122 TATTTGGTTTTGAAGAGATGGGG + Intronic
949729221 3:7088585-7088607 TGTTTGTTTTTAAAGTGGAGAGG - Intronic
949907167 3:8867396-8867418 TGTTAGGCTTGGGAGGGGAGAGG - Intronic
951063511 3:18237705-18237727 TTTTTGCCTTTAAACAGGAGTGG - Intronic
951506481 3:23451208-23451230 TTATTTGCTTTTAAGAGGAGAGG - Intronic
951749175 3:26014583-26014605 TGCTTGGCTATCTAGAGGAGGGG + Intergenic
953157319 3:40386946-40386968 TGTTTGGCTTCGACCTGGAGGGG + Intergenic
953528257 3:43713499-43713521 TGTTTGGATTGGGAGAGCAGTGG + Intronic
953724513 3:45386295-45386317 TCCTTGTCTTTGAAGAGGATTGG + Intergenic
954468429 3:50672451-50672473 TGTGTGGGTTTCAAGAGTAGAGG + Intergenic
955479143 3:59371522-59371544 TCTATGGCTTTGGAGAGGGGTGG - Intergenic
955874171 3:63472869-63472891 TGTTTGGCTTTGCAGACCACAGG + Intronic
957149556 3:76468482-76468504 TGTGTGGCTATAAAGGGGAGGGG - Intronic
958156455 3:89761729-89761751 TATTTGGATGTGAAGTGGAGAGG + Intergenic
959194359 3:103159369-103159391 AGTTTGGCTTTTAAGAGAAGTGG + Intergenic
959741913 3:109730297-109730319 TGTGTGTCTTTAAAGAGGGGAGG - Intergenic
960404955 3:117248411-117248433 TGTCTGGATCTTAAGAGGAGGGG - Intergenic
961212068 3:125133127-125133149 TGTTTGGCTTTGAAGAGGAGAGG + Intronic
961709125 3:128813493-128813515 TGTTTTGTTTGGAAGAGGAGAGG - Exonic
962313728 3:134344920-134344942 TGTTTGGCTATGAAGGAGAAGGG - Intergenic
962608715 3:137054922-137054944 TTTTTTGCTTTGGAAAGGAGAGG - Intergenic
963081706 3:141401300-141401322 TGCTTGGCTTTGAGGAGGTTGGG + Intronic
964546321 3:157838525-157838547 TGTTTGGCTTATAAGATGGGTGG - Intergenic
965911983 3:173789502-173789524 TCTTTGGCTGTGAAAAGGAAGGG - Intronic
966660335 3:182407779-182407801 TGTTTGCCTTAGAAGTGGAGTGG + Intergenic
966932662 3:184685884-184685906 TCTTTGGCTCTGAAGGGGTGAGG + Intergenic
967631021 3:191743022-191743044 AGTTTGGCTTAGATGAGGATTGG - Intergenic
967718092 3:192786901-192786923 TGATTGGCTTTGAAAATTAGTGG + Intergenic
967776084 3:193387487-193387509 TGCTTGGATTTGAAGATGAATGG - Intergenic
969119172 4:4894720-4894742 TGTGTGGCTTGGAAGATAAGTGG - Intergenic
969358725 4:6647586-6647608 GGTTTGGGGGTGAAGAGGAGTGG + Intergenic
970136206 4:12927113-12927135 TGTTTAACTTTGAAGAACAGTGG - Intergenic
970365351 4:15352717-15352739 TGTTGGGTTTTGGATAGGAGTGG + Intronic
970773943 4:19649943-19649965 TATTTTGCTTTTAAGAGGAAAGG - Intergenic
971807787 4:31382871-31382893 TGTTTGACTCTGACAAGGAGAGG + Intergenic
971984649 4:33806339-33806361 TGTATGGCATTAAATAGGAGTGG + Intergenic
974432405 4:61816327-61816349 TGGTTAGTTTTGCAGAGGAGGGG + Intronic
976227218 4:82805050-82805072 TGCTTGGCAGTAAAGAGGAGAGG + Intergenic
976569007 4:86587029-86587051 TGTTTGGCTTTAAAAAATAGTGG + Intronic
976616642 4:87084653-87084675 TTTTTGCCTTTGGAGATGAGTGG - Intronic
976690006 4:87858859-87858881 AGTTTGGCTTTTACGATGAGTGG + Intergenic
976759068 4:88528631-88528653 TGTTTCTCTTTGACGAAGAGTGG + Intronic
977106738 4:92895416-92895438 TGTTTAGCTTACAAGAGGTGAGG + Intronic
977414364 4:96712800-96712822 TGTTTTGCCTCGCAGAGGAGGGG - Intergenic
979865789 4:125751406-125751428 GGTTTGGCATTGAGGAGGGGAGG - Intergenic
982290285 4:153774041-153774063 TGTCTGGCTTTGATGGGCAGAGG + Intergenic
982696799 4:158611353-158611375 TATTTCACTTTGCAGAGGAGTGG + Intronic
983456329 4:167969035-167969057 TCTCTGCCTTTGAAGAGGAGAGG + Intergenic
983557863 4:169074351-169074373 TGTTTTGCCTTTAAGAGGTGGGG - Intergenic
983809486 4:172041900-172041922 AGTTTAGCTTTAAAGAGGACTGG + Intronic
983911463 4:173244196-173244218 TGTTTGGCTTTGCAGACCACAGG - Intronic
985493322 5:191641-191663 TAGCTGGCTTTGAACAGGAGTGG - Exonic
986150914 5:5129800-5129822 TGTTTGGCTTTGCTGGGGAGGGG - Intergenic
988254766 5:28808150-28808172 TGTTTGTTTTTGTAGAGAAGGGG + Intergenic
988493003 5:31720897-31720919 TGGCTGGCTTTGAAGAATAGGGG + Intronic
988882714 5:35520831-35520853 GGTATTGCTTTGAACAGGAGTGG + Intergenic
990120923 5:52450404-52450426 TGTTTGGTTTTTAAGAGGCAGGG - Intergenic
990568900 5:57057685-57057707 TTGCTGGCTTTGAAGAGGAAAGG + Intergenic
991035343 5:62122670-62122692 TGATTGGCTTGGAAGGGGAAAGG + Intergenic
991989099 5:72320070-72320092 CGGTGGGCTTTCAAGAGGAGAGG - Intronic
992121719 5:73600234-73600256 TGGGGGGCTTTGAAGAAGAGGGG - Intergenic
992220985 5:74573190-74573212 TGCTTAGGTTTGAAGAAGAGTGG - Intergenic
994714505 5:103305616-103305638 TGTTTGGGTTTGTAGAGGTGGGG + Intergenic
994722576 5:103398065-103398087 TGTCTGGCTCTGAAGGAGAGAGG + Intergenic
995206047 5:109482653-109482675 TGTTTTGTTTTGAGGAGGAAGGG + Intergenic
995441490 5:112197242-112197264 AGTTTGGCTTTGAAGGAGAGAGG - Intronic
997055449 5:130438272-130438294 TGTCTGGGTGTGAAGTGGAGAGG + Intergenic
997728498 5:136143776-136143798 TGTTTGAGTTTGCAGGGGAGGGG + Intronic
997857515 5:137385590-137385612 TGTTGGACTGTGAGGAGGAGTGG - Intronic
998557028 5:143135449-143135471 TACTTTGCCTTGAAGAGGAGAGG + Intronic
999504049 5:152177159-152177181 TGTTAGGCTCTGGAGAGGATAGG - Intergenic
1001025064 5:168216993-168217015 TGTTTGGTTTGGAAGTGGAATGG + Intronic
1001716103 5:173817750-173817772 TGTTGGGCTGAGAAGAGGGGAGG + Intergenic
1001770957 5:174295445-174295467 TGTGTGGCGTGGAGGAGGAGAGG + Intergenic
1003208019 6:4031939-4031961 AGTCTGGCTCTGAAGAAGAGGGG + Exonic
1003257460 6:4487077-4487099 TATTTGGCTTTGCAGCAGAGAGG + Intergenic
1005252986 6:23968755-23968777 TGTATGGCTTTGAAGTGAAATGG - Intergenic
1007562468 6:42821413-42821435 TGTTTGGAGTTGAACAGGGGTGG + Intronic
1010643872 6:78364009-78364031 TTTTTGGCTTTGAAGATGAAGGG + Intergenic
1014129499 6:117814421-117814443 TGTTTTTCTTTAAAGAGAAGTGG - Intergenic
1015386554 6:132631285-132631307 TCTTTGGCTTTGATGATGATGGG + Intergenic
1016422394 6:143899082-143899104 TGTTTTGCTCTATAGAGGAGGGG + Intronic
1016492198 6:144618251-144618273 AGTGTGGCATTGTAGAGGAGAGG - Intronic
1017466345 6:154697251-154697273 TGTTTGCCTTAGGTGAGGAGTGG + Intergenic
1017855022 6:158343163-158343185 TCTTTGTCTATGAAGGGGAGGGG + Intronic
1017911486 6:158796606-158796628 TATTTGGCTTTGAAAGGGAAAGG + Intronic
1018493120 6:164317352-164317374 TGTTTGGCCTTAAATAGCAGTGG + Intergenic
1019750495 7:2726056-2726078 GGCTTTGCTTTGAAGAGGACAGG - Intronic
1020245686 7:6427571-6427593 TGTTTGTCTTTTAAGAGACGGGG - Intronic
1021003430 7:15362284-15362306 TGTTTAGCTTTAAAAAGAAGTGG + Intronic
1021301296 7:18976065-18976087 TCTGTGGCTTTGGAGAGGACAGG - Intronic
1021341636 7:19470636-19470658 TATTTAACTTTGAAGAGCAGTGG - Intergenic
1021561120 7:21969645-21969667 TGTTTTGTTTTGAGGAGGACAGG + Intergenic
1022042233 7:26592042-26592064 AGGTTGGCTTTGGGGAGGAGAGG + Intergenic
1022974936 7:35548271-35548293 TGTTTGGCTGGGAAGAACAGAGG - Intergenic
1023817125 7:43959719-43959741 TGATGGGTTTTAAAGAGGAGAGG - Intergenic
1024675754 7:51636622-51636644 GGTCTGGCTGTGCAGAGGAGAGG + Intergenic
1025956951 7:66190227-66190249 TGGTGGGCGTTGAAGGGGAGTGG + Intergenic
1026607236 7:71826583-71826605 TGATTGCCTTTGAAGAGGAGTGG - Intronic
1026968769 7:74455327-74455349 GGTTTCTCTTAGAAGAGGAGAGG + Intronic
1028063557 7:86351867-86351889 TGTTTAGCTATAAATAGGAGAGG - Intergenic
1029750223 7:102538941-102538963 TGTTGGGATTTGGGGAGGAGGGG - Intronic
1029768174 7:102638049-102638071 TGTTGGGATTTGGGGAGGAGGGG - Intronic
1030175988 7:106654154-106654176 TCTTTAGCTTTGAAGAAGAAAGG + Intergenic
1031255270 7:119439409-119439431 TGTTTGACTTTGATCAGGCGAGG - Intergenic
1031978541 7:128109035-128109057 TGGTTGGCTTTTGAAAGGAGAGG + Intergenic
1033003575 7:137535471-137535493 TGTTTGGCAGGGAAAAGGAGGGG - Intronic
1033602999 7:142902305-142902327 AGTTTAGCTTTGCACAGGAGTGG + Intergenic
1034248480 7:149668133-149668155 TGTTTGGCTTCCAAGAGGCTGGG + Intergenic
1035823042 8:2615632-2615654 TGCATGGCATTGAAGAAGAGGGG + Intergenic
1037749125 8:21668546-21668568 TGGCTGGCTTTGAAGAAAAGGGG - Intergenic
1038863471 8:31413152-31413174 TGCGTGGATTTGAAGAGGAATGG + Intergenic
1039252926 8:35686530-35686552 TGTTTCCCTTTGAAGTGGATGGG + Exonic
1039671491 8:39605215-39605237 TGTTTGCCTTGGAAGAGAAATGG + Intronic
1040557409 8:48493130-48493152 TTGTTGGCTTTGAAGATGGGAGG + Intergenic
1041023295 8:53659114-53659136 TGTGTGTCTTTGCAGGGGAGTGG - Intergenic
1041886144 8:62810084-62810106 TCTCAGGCTTTGAAGAAGAGCGG - Intronic
1043427082 8:80158262-80158284 GGGTTGGGGTTGAAGAGGAGTGG - Intronic
1043834017 8:85025200-85025222 TCTTTGGCTTTGAACAGATGTGG + Intergenic
1043873184 8:85457842-85457864 TATTTAGTTTTGAAGAGTAGTGG - Intergenic
1043928197 8:86061527-86061549 AGTTTAGCCTTGAAGAGGACTGG + Intronic
1044051733 8:87514499-87514521 TGTCAGGCTTTGAAGAAGACAGG + Intronic
1044684943 8:94817445-94817467 TGTTTGGCTCTGAAGAGAAGAGG - Intronic
1045892236 8:107170561-107170583 TGCTGGGGTTAGAAGAGGAGAGG - Intergenic
1046583794 8:116126091-116126113 TTGTTGGCTTTGAGGAGGAAAGG + Intergenic
1046661712 8:116954698-116954720 AGTTTGGTTTTTAAGAGGAAAGG + Intronic
1048042227 8:130742196-130742218 TGTTTAGCTTTGAACATGATTGG + Intergenic
1048360822 8:133695777-133695799 TTCTTGGCTTTGAAGTCGAGGGG + Intergenic
1049315764 8:141966518-141966540 TGTTTGCCTTTGAAGGAGAGTGG - Intergenic
1050594925 9:7195581-7195603 TGTGTGGCTTTGCAGAGCATAGG + Intergenic
1052463171 9:28793995-28794017 TGTTTGTTTTTGAAGAGCAATGG - Intergenic
1053105689 9:35406054-35406076 TGGCTGGCTTGGGAGAGGAGCGG - Intergenic
1054962316 9:70982660-70982682 AGTTTGTCTTTGAAGAGAGGAGG - Intronic
1055818290 9:80232551-80232573 TGTTTTGCCTTGGAGTGGAGTGG + Intergenic
1056398973 9:86208834-86208856 TTCTTGGCTTTGAAGAGTTGAGG + Intergenic
1057502550 9:95607230-95607252 GGTTTGGCTTGGAACAGCAGTGG - Intergenic
1057931659 9:99198913-99198935 TTTTTGGTTTTGAGGAGGACTGG + Intergenic
1058242997 9:102590071-102590093 TGTTTGTTTTTGAGGAGGTGTGG + Intergenic
1059102776 9:111485523-111485545 TGTATGGCTTTGATGGGGACAGG + Intergenic
1060731527 9:126039940-126039962 TGTGTGGTTTGGAAGAAGAGGGG + Intergenic
1060857851 9:126929353-126929375 TTATTGGCTGTGAAGAAGAGAGG + Intronic
1062098904 9:134717841-134717863 TGTTTCGGTTGGACGAGGAGGGG + Intronic
1186165504 X:6822385-6822407 TGTTTAGGTTTGATGAAGAGGGG - Intergenic
1187016968 X:15338862-15338884 TCATTGGCTTTCAAGAGGAAAGG - Intergenic
1187246681 X:17559181-17559203 ATTTTGGCTTAGTAGAGGAGAGG + Intronic
1188022330 X:25172501-25172523 TGTTCTGATTTGGAGAGGAGGGG - Intergenic
1189020166 X:37327813-37327835 TGTTTTACATTGAAGTGGAGAGG + Intergenic
1189030554 X:37445044-37445066 TGTTTGGAGCTGAAAAGGAGAGG + Intronic
1189036643 X:37500314-37500336 TGTTTTGTTTTGTTGAGGAGGGG + Intronic
1189037786 X:37509857-37509879 TGTTTGGAGCTGAAAAGGAGAGG + Intronic
1191736121 X:64389711-64389733 TGTTTGGCTCTGATGGAGAGAGG + Intronic
1192216599 X:69163742-69163764 TGTCTGTCTATCAAGAGGAGAGG + Intronic
1192578606 X:72262348-72262370 CTTTTGGCTTTGAAGAGGTTTGG - Intronic
1193668284 X:84351378-84351400 TGTTTTGCTTTGCGGAGGTGGGG + Intronic
1194581433 X:95676868-95676890 TGTTTGGTTTTAAAGGGGATGGG - Intergenic
1195858486 X:109356054-109356076 TGTGTGTCTTTGGAGAGGTGGGG + Intergenic
1198184114 X:134237288-134237310 TGGTTGTCTTTGAGGAAGAGAGG + Exonic
1198214097 X:134541331-134541353 TGTTTTGCTATGAAGATGAGTGG + Intergenic
1200031936 X:153303990-153304012 AGTTTGGCTCTGAAGGGGAAGGG - Intergenic
1201738433 Y:17297272-17297294 TGTTTTGTTTTGAAGAGATGGGG - Intergenic