ID: 961214202

View in Genome Browser
Species Human (GRCh38)
Location 3:125147148-125147170
Sequence GGCGCTGTTGTCCTAGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961214196_961214202 11 Left 961214196 3:125147114-125147136 CCCAACTTCCAGGGAAGACTTCC 0: 1
1: 0
2: 2
3: 15
4: 181
Right 961214202 3:125147148-125147170 GGCGCTGTTGTCCTAGTCCTAGG 0: 1
1: 0
2: 0
3: 4
4: 81
961214201_961214202 -10 Left 961214201 3:125147135-125147157 CCGCAAAATCAAGGGCGCTGTTG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 961214202 3:125147148-125147170 GGCGCTGTTGTCCTAGTCCTAGG 0: 1
1: 0
2: 0
3: 4
4: 81
961214197_961214202 10 Left 961214197 3:125147115-125147137 CCAACTTCCAGGGAAGACTTCCG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 961214202 3:125147148-125147170 GGCGCTGTTGTCCTAGTCCTAGG 0: 1
1: 0
2: 0
3: 4
4: 81
961214198_961214202 3 Left 961214198 3:125147122-125147144 CCAGGGAAGACTTCCGCAAAATC 0: 1
1: 0
2: 0
3: 3
4: 87
Right 961214202 3:125147148-125147170 GGCGCTGTTGTCCTAGTCCTAGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961214202 Original CRISPR GGCGCTGTTGTCCTAGTCCT AGG Intronic
900265775 1:1756415-1756437 GGCACTGTTGCCCTTGTCATTGG - Intronic
902137158 1:14319077-14319099 GGCTCTGTTTTCCTACTTCTTGG + Intergenic
902177020 1:14658020-14658042 GGCGCTGGTGTCCCAGACCCTGG + Intronic
905035094 1:34912986-34913008 TGGGCTGGTGTCCTAGTCCCTGG + Intronic
924396115 1:243623027-243623049 GGCGCCGTTGGCCAACTCCTGGG + Intronic
1065912457 10:30320712-30320734 GGCCCTGTTGTCCTCTGCCTGGG - Intronic
1066498129 10:35962220-35962242 CTCACTGTTGCCCTAGTCCTGGG + Intergenic
1066625875 10:37404789-37404811 CTCACTGTTGCCCTAGTCCTGGG + Intergenic
1073091661 10:100945801-100945823 GGGGCTTTTGTCCTAGTCAAAGG + Intronic
1076822758 10:132948523-132948545 GGCGGTGATGGCCAAGTCCTTGG - Intergenic
1077072253 11:680726-680748 GACACTGTTGGCCTTGTCCTGGG - Intronic
1077411321 11:2405219-2405241 GGGGCTGCTTTCCTAGTCCCAGG - Intronic
1077518523 11:3017026-3017048 GCCTCTGTTCTCCCAGTCCTGGG + Intronic
1085042208 11:73333265-73333287 GGCGGTGGTGGCCTTGTCCTGGG + Intronic
1089157681 11:116414759-116414781 GGGGCTCCTGTCCTGGTCCTGGG - Intergenic
1090175006 11:124640890-124640912 GGCGCTCTTGTCCTTCTCCAGGG - Intronic
1102455742 12:113069839-113069861 GCCGCTGTTGTCCTTGTTGTAGG + Intronic
1102589440 12:113946356-113946378 GGCACTGTTGGCTTTGTCCTGGG + Exonic
1119024110 14:71139126-71139148 GCCCCTGCTGTCCTTGTCCTAGG - Intergenic
1119222957 14:72924284-72924306 GGCGCTGTGCACCAAGTCCTGGG + Intergenic
1119732888 14:76962237-76962259 GGGGCTATTGCCCAAGTCCTGGG + Intergenic
1122812744 14:104297104-104297126 GGAGCTTTTGTCCTGGGCCTGGG - Intergenic
1128553326 15:68612941-68612963 GGCTCTGATGTCCTGGACCTGGG - Intronic
1129693867 15:77729524-77729546 GGCCCAGTGGTCCTTGTCCTGGG + Intronic
1134034607 16:11020268-11020290 GGCGCTTTTCTCCTCGTCCGTGG - Exonic
1138461514 16:57151074-57151096 GGCGCGGTTGTCCTAGCCGTGGG - Intergenic
1141226357 16:82119736-82119758 GAAGCTGTTCCCCTAGTCCTGGG - Intergenic
1141585103 16:85028229-85028251 GGAGCTGGTGTCCCAGTCTTGGG + Intronic
1144840883 17:18184791-18184813 GGCGCTGTTGACGAAGCCCTCGG - Exonic
1149197969 17:54146002-54146024 TGCGCTATAGTCCTTGTCCTTGG + Intergenic
1149237791 17:54613059-54613081 GGGGCTGTTGGGGTAGTCCTGGG - Intergenic
1150376836 17:64688454-64688476 GGCGCTGTAGTCACAGACCTGGG - Intergenic
1151145280 17:72034709-72034731 GGCCCTGTTTCCCTAGTCCTAGG + Intergenic
1152623929 17:81379823-81379845 GGAGCTGTTGAGCCAGTCCTGGG + Intergenic
1162766565 19:12923426-12923448 GCGTCTGTAGTCCTAGTCCTAGG - Intronic
1166749960 19:45159885-45159907 GGCCCTGTGGTCCGGGTCCTGGG + Intronic
1167259421 19:48450177-48450199 GGAGCTGTAGTCCCAGGCCTGGG + Intronic
925967970 2:9083851-9083873 TGTGCTGTTGTCCTAGAACTTGG - Intergenic
944379541 2:199092231-199092253 GGTGGTGTTGTCCAAGGCCTTGG - Intergenic
947230880 2:227884986-227885008 GGCCCTCTTGTCCTAGTTTTGGG + Intronic
947637526 2:231687670-231687692 GTGGCTGCTGTCCTAGTGCTGGG - Intergenic
1168848374 20:960320-960342 GACTCTCTGGTCCTAGTCCTCGG - Exonic
1173672105 20:44805953-44805975 GGCGCTGTGGTACTAGTTTTTGG + Intronic
1175403767 20:58714555-58714577 GGGGCTGTTGTCTCGGTCCTAGG - Exonic
1175468642 20:59210012-59210034 GGCCCTGAGGTCCTAGTCCATGG - Intronic
1175562015 20:59939119-59939141 GTCGTTGTTGTCCCAGTACTCGG + Exonic
1175880089 20:62252881-62252903 GGTGCTGTCCTCCTGGTCCTGGG - Intronic
1176850530 21:13908957-13908979 GGACCTGTTGACCTAGTCATTGG - Intergenic
1183083607 22:35473051-35473073 GGGGCAGTTGTCCTAGGTCTCGG - Intergenic
1183515639 22:38264296-38264318 GGCTCTGATGTCCTGGTCCCAGG + Intronic
1185089629 22:48758462-48758484 GGCCCTGTTGGCCTGGACCTTGG + Intronic
949964456 3:9343794-9343816 TGCGCTGTAGTCCTGCTCCTCGG - Intronic
951419817 3:22471201-22471223 GGCTCTGTAGCCCTGGTCCTTGG + Intergenic
954423302 3:50430189-50430211 GGCCTTGCTGTCCTAGCCCTGGG + Intronic
959250620 3:103938621-103938643 AGTGCTGTTGTCCTAGTTCAGGG - Intergenic
960150995 3:114248652-114248674 GTTGCTGTTTTCCCAGTCCTTGG - Intergenic
961214202 3:125147148-125147170 GGCGCTGTTGTCCTAGTCCTAGG + Intronic
961335748 3:126179006-126179028 GGGGCTGTTGTCACAGTCCAGGG + Intronic
963760284 3:149281349-149281371 GGCCCTGGTGTCCTCCTCCTTGG + Intergenic
966750749 3:183319820-183319842 GGCTCTGTTGTTCTATTTCTAGG + Intronic
967754097 3:193149108-193149130 GGCTCAGTTACCCTAGTCCTTGG - Intergenic
969114873 4:4865220-4865242 GGAGCTGTTGCCCTCGGCCTGGG + Intergenic
971612307 4:28741481-28741503 GGTGTTGATGACCTAGTCCTGGG - Intergenic
981737179 4:147964917-147964939 GGAGCTGTTGTCATTGTCTTGGG + Intronic
985506776 5:285999-286021 GGAGCTGTTGTTCTAGTTTTAGG + Intronic
992240719 5:74766819-74766841 GGCCCTGTTGTCCTCTTCCGTGG + Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
1002778194 6:346642-346664 GGCTCTGTTGTCTAAGTGCTAGG + Intronic
1003004748 6:2370269-2370291 TGCGCTGTTGTGCTAGCCATGGG + Intergenic
1003604132 6:7543236-7543258 GGCGTTGTGGCCCTAGGCCTGGG + Intronic
1004399672 6:15276744-15276766 GGTCCTGTTGGCCTGGTCCTTGG + Intronic
1007761190 6:44134640-44134662 GGCGCTGTAGCAGTAGTCCTTGG - Exonic
1016307651 6:142700339-142700361 GGAGCACTTGTTCTAGTCCTGGG + Intergenic
1019261515 7:84468-84490 GGGGCCCTTGTCCTCGTCCTTGG - Intergenic
1022902575 7:34825489-34825511 GGCGCTGTGGTCCTAGCCCAGGG + Intronic
1022911272 7:34901471-34901493 GGTGCTGTTGTCCTTGACCTTGG - Intergenic
1023541942 7:41275201-41275223 AGCTCTGTTGCCCTACTCCTGGG + Intergenic
1034756361 7:153624363-153624385 GGGGCTGCTGTGCCAGTCCTGGG + Intergenic
1036753822 8:11459577-11459599 GGGGCTGGGGTCTTAGTCCTTGG + Intronic
1039047665 8:33464653-33464675 GTGTCTGTAGTCCTAGTCCTGGG + Intronic
1048444260 8:134481589-134481611 GGCGTGGTTCTCCTTGTCCTTGG - Intronic
1053146133 9:35713263-35713285 GGTGCTGTTGCCCAGGTCCTGGG + Exonic
1053856209 9:42341950-42341972 GGCGGTGGAGTCCTGGTCCTCGG + Intergenic
1055134213 9:72808319-72808341 GGTGCTGTTGCCCTAGAGCTAGG + Intronic
1186793556 X:13022669-13022691 GGCTCTGTTGTCCCAGCCCCCGG - Intergenic
1195701302 X:107707714-107707736 TGGGCTGTAGTCCTAGTCTTTGG - Intergenic