ID: 961215108

View in Genome Browser
Species Human (GRCh38)
Location 3:125153597-125153619
Sequence CATTATCTCTTAGAAGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961215108_961215109 21 Left 961215108 3:125153597-125153619 CCACTGACTTCTAAGAGATAATG 0: 1
1: 0
2: 4
3: 28
4: 182
Right 961215109 3:125153641-125153663 TATTTATATATTTTTTGAGATGG 0: 28
1: 2240
2: 3509
3: 5726
4: 115698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961215108 Original CRISPR CATTATCTCTTAGAAGTCAG TGG (reversed) Intronic
900247829 1:1646845-1646867 CATTGTTTCTAAGAAGTCAGTGG + Intronic
900259055 1:1713999-1714021 CATTGTTTCTAAGAAGTCAGTGG + Intronic
901512677 1:9725246-9725268 AAATATCTTTTAGAAGGCAGAGG - Intronic
903805493 1:26002563-26002585 TATTATAGCTTACAAGTCAGTGG + Intergenic
904075831 1:27841539-27841561 CATTAGCTCTAAGCAGTCAAGGG - Intronic
907406917 1:54259264-54259286 AATTATCTCTTAAAAATCCGAGG + Intronic
911277933 1:95886044-95886066 CAGTTTCTTTAAGAAGTCAGTGG + Intergenic
912360074 1:109087920-109087942 AATTATCTCTAAAAAGTGAGTGG + Intergenic
912541767 1:110421549-110421571 CAGTTTCTCTGAGAACTCAGAGG - Intergenic
916096399 1:161355082-161355104 CATTATCTGTTGGAGCTCAGTGG - Intronic
917593397 1:176501236-176501258 TGTTATCTCTTAAAAGTTAGTGG + Intronic
917685759 1:177414224-177414246 CATTCTCTCTCAGGACTCAGGGG - Intergenic
919289042 1:195604694-195604716 CATTTTCTCTGTGAAGTAAGAGG - Intergenic
920772919 1:208906679-208906701 CAGTATCTCTGAAAATTCAGAGG + Intergenic
923961472 1:239089064-239089086 CAATAACTCTTTGAGGTCAGGGG - Intergenic
1063017299 10:2091630-2091652 CATTAGCTTTAAAAAGTCAGGGG - Intergenic
1063254295 10:4309177-4309199 CTTCATCCTTTAGAAGTCAGAGG - Intergenic
1065550155 10:26861455-26861477 CTTTATTTCTAAGAAGGCAGAGG - Intergenic
1066086005 10:31972539-31972561 CTTTGTCTCTTGGAAGTCATCGG - Intergenic
1066749790 10:38642392-38642414 CATCATCTCTTAAAAGTCAGTGG - Intergenic
1066966858 10:42275384-42275406 CATCATCTCTTAAAAGTCAGTGG + Intergenic
1067482722 10:46614351-46614373 CATGATGTCTTAGTTGTCAGTGG - Intergenic
1067612031 10:47727313-47727335 CATGATGTCTTAGTTGTCAGTGG + Intergenic
1068807384 10:61213483-61213505 AATCATCTCTTAGAATACAGAGG + Intergenic
1072269084 10:93757748-93757770 CATTATGTCTTATTAGTGAGTGG - Intergenic
1073892767 10:108120040-108120062 CATTGTGTCTTAGAGGTCTGTGG - Intergenic
1074365825 10:112856680-112856702 CATGATCCCTAAGAATTCAGGGG - Intergenic
1074904688 10:117851373-117851395 TATTTTCTCTTAGAAAACAGTGG - Intergenic
1076075466 10:127530521-127530543 GACCATCTCTTGGAAGTCAGAGG - Intergenic
1078714979 11:13831318-13831340 CATTTTCCCTTAGATTTCAGAGG + Intergenic
1079269532 11:18971247-18971269 CTTTATATCTGAGAATTCAGTGG + Intergenic
1079515990 11:21269492-21269514 CATGATTTCTAAGAAATCAGTGG - Intronic
1079545140 11:21624827-21624849 CCTTTTCTCTCAGAAATCAGAGG + Intergenic
1080736085 11:35015291-35015313 CATTATGTTTTTAAAGTCAGAGG + Intronic
1080859187 11:36138547-36138569 CATTATCTCATGGAGGTCAGAGG + Intronic
1081788698 11:45767407-45767429 CATTCTCTCTTAGAGGGGAGAGG - Intergenic
1082730876 11:56795951-56795973 CATTATCTCTGAGAACAAAGGGG + Intergenic
1087033282 11:93728283-93728305 CATTATCTGTTAGCAGTCAGTGG + Intronic
1088095161 11:106091277-106091299 CATTTTCTCTTAGAATTTGGTGG - Intronic
1089600616 11:119612223-119612245 CATAATCTCTTATATGTCAAGGG + Intergenic
1090207010 11:124890944-124890966 CCTGAGCCCTTAGAAGTCAGGGG + Intronic
1090516415 11:127432969-127432991 CATTATCTGTTAGAATTCTTTGG - Intergenic
1094241824 12:28236279-28236301 TATTATGTATTAGAAGTTAGAGG + Intronic
1095636230 12:44436808-44436830 CATCATCTCTCAGAAGTGAGTGG + Intergenic
1096166756 12:49432089-49432111 CATTCTCACTTAGATGTGAGGGG + Intronic
1098095863 12:66955327-66955349 GATTATCTCTTTTAAATCAGTGG - Intergenic
1099001152 12:77179450-77179472 CATTATCTTTCAGAAGAAAGAGG - Intergenic
1099376007 12:81897029-81897051 TATTTTTTCTTAGAATTCAGGGG + Intergenic
1101448645 12:104756355-104756377 CTTTTGCTCTTAGAATTCAGAGG + Intronic
1103256687 12:119547722-119547744 CTTTATTTCCTAGAAGGCAGTGG - Intergenic
1107325230 13:39234813-39234835 CAGTATCTCTTATGAGTCACAGG - Intergenic
1107764764 13:43722329-43722351 ATTTAACTGTTAGAAGTCAGTGG - Intronic
1108378157 13:49832892-49832914 CAGGATCACTTAGCAGTCAGTGG - Intergenic
1108988648 13:56627935-56627957 TATTATTTCTTTGAGGTCAGTGG - Intergenic
1109276588 13:60310836-60310858 CATTAGCTCTGAGCAGGCAGGGG - Intergenic
1110093961 13:71491922-71491944 CATTCACTCTTTGAAGTCAGTGG - Intronic
1112264404 13:97909737-97909759 CATGAGCTCCTAGAATTCAGGGG - Intergenic
1113002526 13:105658884-105658906 CAATATTTTTTAGAAATCAGTGG + Intergenic
1113069206 13:106403361-106403383 CACAAACTCTTAGAAGTCAAAGG + Intergenic
1114483724 14:23050722-23050744 CATTCTCTCTTGGAAGGCACTGG - Intronic
1116060333 14:39916245-39916267 TATTGTCTCTTTAAAGTCAGAGG - Intergenic
1119174725 14:72560582-72560604 CAATAGCTCTTAGAAGGCAGAGG - Intronic
1121377536 14:93427997-93428019 CATTATGTTATAGAAGTCAAGGG + Intronic
1121533575 14:94675847-94675869 CATTAACTATTAGTAGGCAGAGG + Intergenic
1124138621 15:27057409-27057431 CATTTTCTCCTAAAAATCAGAGG - Intronic
1124448937 15:29766994-29767016 AATTATCTCTTAGAGGTCTGGGG - Intronic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1127033024 15:54884869-54884891 CAATAGCTCTTAGAACACAGGGG + Intergenic
1127362585 15:58257843-58257865 CATTATATCTTTGAAAGCAGGGG - Intronic
1133640618 16:7713551-7713573 CATTTTCCCAAAGAAGTCAGTGG + Intergenic
1136732926 16:32434754-32434776 CATCATCTCTTAAAAGTCAATGG + Intergenic
1137479057 16:48836177-48836199 TATTATCTCTCACAAGTCTGTGG + Intergenic
1138674104 16:58638539-58638561 CAGTGTCTCTGAGAAGTCCGAGG - Intergenic
1203020155 16_KI270728v1_random:394849-394871 CATCATCTCTTAAAAGTCAATGG - Intergenic
1203038490 16_KI270728v1_random:668007-668029 CATCATCTCTTAAAAGTCAATGG - Intergenic
1145854121 17:28135559-28135581 GGTTATTTCCTAGAAGTCAGGGG + Intronic
1145922700 17:28622639-28622661 TATTATATCTTAGAAGTTACAGG + Intronic
1146083828 17:29808697-29808719 CTTTATCCCTTTAAAGTCAGAGG + Intronic
1148569659 17:48658048-48658070 CAGTATCTTTTAGAACTCTGGGG - Intergenic
1156705117 18:39872112-39872134 CACTATCTGAAAGAAGTCAGAGG - Intergenic
1157445656 18:47745132-47745154 AATTAGCTCTGAGAAGACAGAGG - Intergenic
1157960832 18:52151775-52151797 CATGACCTCTTACCAGTCAGAGG + Intergenic
1158868054 18:61657290-61657312 GGTTATCTCCTAGAAGCCAGGGG - Intergenic
1166087052 19:40483298-40483320 CATCATCTGTTAGAAGGCAGAGG + Intronic
1166087071 19:40483706-40483728 CATCATCTGTTAGAAGGCAGAGG - Intronic
925654243 2:6127985-6128007 CATTATCTCTTGCAGCTCAGAGG - Intergenic
925738756 2:6986768-6986790 CATTATCTGATAGAAGGAAGTGG + Intronic
927038715 2:19206478-19206500 CATAACCTTTTAGAAGTCAGGGG + Intergenic
928468689 2:31550988-31551010 AATAATCTATTAGAAGTGAGGGG - Intronic
929546426 2:42857772-42857794 CATTATCATTTAAAAATCAGAGG + Intergenic
931231491 2:60378938-60378960 CATTATCTTTTGGGGGTCAGTGG - Intergenic
933134199 2:78711203-78711225 CATCATCTCTGGGAAGCCAGTGG - Intergenic
934312786 2:91884515-91884537 CATCATCTCCTAAAAGTCAATGG - Intergenic
937708545 2:124950360-124950382 CATCATCTCTAAGAGCTCAGCGG + Intergenic
938016360 2:127870551-127870573 CATTATCTCTTATTAGACATGGG + Intronic
938649586 2:133368675-133368697 CATTAGCACTTTGAAGGCAGGGG - Intronic
939249841 2:139669196-139669218 GATTATCTCTAAGAAGAGAGTGG + Intergenic
941236383 2:162979996-162980018 CATTATTTCTTACATGTCTGTGG - Intergenic
941287936 2:163637500-163637522 CATTATCTCTTCTAAGTGAGAGG - Intronic
942999067 2:182301705-182301727 CAGTATGTCTTAGAATTCAGGGG + Intronic
943351353 2:186799958-186799980 CATGTTCACTTATAAGTCAGAGG - Intergenic
943462711 2:188189465-188189487 TATGATCTCTTAGAAGTCTGTGG + Intergenic
944787465 2:203087745-203087767 TAGTATCTTTTAGAAGTCTGTGG + Intronic
946573874 2:221053233-221053255 TATTATCTCTTACAAATCATGGG + Intergenic
946630653 2:221664586-221664608 CATTATCACTGAGAATTCATGGG + Intergenic
947809765 2:232996985-232997007 CATAAACTGTTAGAAGTCAGAGG - Intronic
1168785782 20:539188-539210 GATTATCTTACAGAAGTCAGTGG + Intronic
1169705798 20:8503313-8503335 CAGTATCTCTTAGGAATCAAAGG - Intronic
1170351914 20:15451114-15451136 TATTGTCTTTTGGAAGTCAGAGG + Intronic
1172229814 20:33329100-33329122 CATCATCACTTAGAGCTCAGGGG - Intergenic
1177645015 21:23890015-23890037 CATTAACTCTCAGAAATAAGAGG + Intergenic
1177660110 21:24071864-24071886 CCTTGTCTCTTATAAGACAGAGG - Intergenic
1177863396 21:26482705-26482727 CATTATTTCTTAGAAATATGAGG + Intronic
1177874705 21:26617812-26617834 CTTTATCTCTTATAAATCAATGG - Intergenic
1179117781 21:38509872-38509894 CATTAGCTCCTAGAAATCAGAGG + Intronic
1179441562 21:41398331-41398353 AATTATTTCTTAGAAGTTTGAGG - Intronic
1180539526 22:16430369-16430391 CATCATCTCTTAAAAATCAATGG - Intergenic
1181764871 22:25084152-25084174 CATTATCTCTCAGGACACAGAGG - Intronic
1183010787 22:34944798-34944820 CATTATTTCTCAGGAGGCAGTGG - Intergenic
1183134572 22:35874158-35874180 CATTATTTCTTAGAATTGTGAGG - Intronic
949159691 3:865823-865845 CAATATATCTCAGAAGTCAGTGG + Intergenic
954429573 3:50463229-50463251 CATTATCTCTCAGATGCCTGTGG - Intronic
955644296 3:61120040-61120062 AATTATCTCTTGTAACTCAGAGG - Intronic
959191882 3:103123669-103123691 CATAATTTCTTAAAAGGCAGGGG - Intergenic
961028257 3:123580208-123580230 TTTTTTCTCTTAGAAGGCAGAGG - Intronic
961045673 3:123706182-123706204 CATTATTTCTTAGGAGTCTTTGG - Intronic
961215108 3:125153597-125153619 CATTATCTCTTAGAAGTCAGTGG - Intronic
964968246 3:162525778-162525800 CATTATCACTTAGAACTTGGGGG + Intergenic
973938508 4:55878104-55878126 CATTATCTTTTAGAATTAAGAGG + Intronic
975263888 4:72338776-72338798 AATTATCTTTTAGAAGTAGGTGG + Intronic
976060090 4:81117428-81117450 CACTAACTCTCAAAAGTCAGTGG - Intronic
977604219 4:98965735-98965757 CATTATCTCATAGAAGTCATAGG + Intergenic
977806348 4:101302839-101302861 CATTTACTCTTAAAAGGCAGAGG - Intronic
977944992 4:102902552-102902574 AATCATCTCTTAAAAGTCAATGG - Intronic
979537796 4:121843318-121843340 CAGCATATCCTAGAAGTCAGAGG + Intronic
980511445 4:133793895-133793917 TATTGTCTCTGCGAAGTCAGAGG - Intergenic
981370744 4:143956171-143956193 CATTTTCTCATATGAGTCAGTGG - Intergenic
983151420 4:164286592-164286614 CATATTCTCTTAGAAGCCATGGG + Intronic
983835220 4:172376613-172376635 TATTTTTTCTTAGAATTCAGGGG - Intronic
986466761 5:8033945-8033967 CATTATCTCTAACAGGTGAGTGG + Intergenic
986932383 5:12842354-12842376 CAGTACTGCTTAGAAGTCAGTGG + Intergenic
992060519 5:73040414-73040436 CATTAACTGTCACAAGTCAGAGG + Intronic
993110718 5:83654262-83654284 CATTATCTATTCAAAGTGAGGGG - Intronic
993801178 5:92339793-92339815 CATTATATCTAAGAAATCATTGG + Intergenic
993964114 5:94339466-94339488 CATTGTTTTTTAGAACTCAGTGG + Intronic
994162149 5:96568659-96568681 CTTTATTTCTTAGTAATCAGAGG - Intronic
997942423 5:138170083-138170105 CATAATGTTTTAGAAGTCAAGGG - Intronic
998770634 5:145540664-145540686 CATTTTTTCTAAGAAGTCAATGG + Intronic
1000933074 5:167275923-167275945 CATTATCTCTTTGAATTCTCAGG + Intergenic
1004117863 6:12788751-12788773 TATTAGCTCCTAGAAGGCAGAGG - Intronic
1005416484 6:25605340-25605362 TATTATACCTAAGAAGTCAGAGG - Intronic
1005983206 6:30853194-30853216 CATTATCTCTTGGAAGTGAATGG + Intergenic
1007499744 6:42287694-42287716 GATCATCTCTTGGAAGTGAGTGG - Intronic
1008068491 6:47075395-47075417 CATTTTCTCTCAGAAGTTGGAGG + Intergenic
1008274176 6:49524384-49524406 CATTATCTCTTACCGGTCACTGG + Intronic
1008813022 6:55528137-55528159 CATTATCTCTTCAAAATGAGCGG + Intronic
1008890494 6:56483354-56483376 CATTATCTCTAAGACATCCGTGG - Intronic
1012115750 6:95295955-95295977 CATTAACTCTTAGAAATAAGAGG - Intergenic
1013085381 6:106852412-106852434 CAGTCTCTCTGAGAACTCAGAGG - Intergenic
1014232262 6:118916865-118916887 CAATATCTCTTAGATTTGAGGGG + Intronic
1014370858 6:120605848-120605870 CATTATTGCTTAGGTGTCAGAGG + Intergenic
1014873304 6:126623829-126623851 CATTATTTCAAAGAAGTCATGGG - Intergenic
1015857377 6:137639582-137639604 CATTATTTCCTAGAAGTCTCAGG + Intergenic
1016877924 6:148882056-148882078 CATGGTTTCTTAGAACTCAGAGG - Intronic
1017718792 6:157230604-157230626 CCTTATCTCTTAGGAGAAAGAGG - Intergenic
1020424547 7:8049402-8049424 TATTATCTCTTTGAAATCAAAGG + Intronic
1020551862 7:9616514-9616536 AATTGTCTATTAGAATTCAGTGG + Intergenic
1021359891 7:19699114-19699136 TATTTTCTATTAGATGTCAGTGG - Intronic
1023859168 7:44206934-44206956 TATTAACTCTTTGAAGTCAGAGG + Intronic
1024486892 7:49929423-49929445 CACTTTCTTTGAGAAGTCAGAGG - Intronic
1024560271 7:50639007-50639029 TATTATCACTTAGAAGTTGGAGG + Intronic
1027531444 7:79338857-79338879 CATTATCCCTTAGCAGGAAGTGG - Intronic
1028060946 7:86314554-86314576 CATTATATCTGAGAAATCAGGGG - Intergenic
1032370526 7:131346004-131346026 CATTTTCTCAGAGAAGTCATAGG + Intronic
1038140243 8:24837233-24837255 CATTATTTCTGACAAGTCAAAGG + Intergenic
1041465263 8:58152058-58152080 CCTTGTCTCTTTGAACTCAGTGG - Intronic
1043027093 8:75083735-75083757 CATTGACTCCAAGAAGTCAGTGG + Intergenic
1043224798 8:77712439-77712461 AATTCTTTCTTTGAAGTCAGTGG + Intergenic
1043480224 8:80645320-80645342 CATTGTCACTTAAAAGTCATGGG + Intronic
1043621923 8:82204401-82204423 CATTAACTGCCAGAAGTCAGAGG + Intergenic
1044089053 8:87976715-87976737 TATTATCTCTTATTACTCAGAGG + Intergenic
1045525392 8:102937078-102937100 AATTATATCTTTGAAGTCACAGG + Intronic
1046258460 8:111732874-111732896 CATTTTCTCTGAGAGGGCAGGGG + Intergenic
1047987517 8:130250169-130250191 GAATATCTCTTGGAGGTCAGAGG - Intronic
1047994567 8:130321538-130321560 AAGTATCCCTTAGAAGTCAGGGG + Intronic
1051378482 9:16430213-16430235 CCTTAACATTTAGAAGTCAGAGG + Intronic
1051662394 9:19437991-19438013 CATTACCTCTGAAAAGTCAAAGG + Intronic
1052489916 9:29152568-29152590 CATTTTCACTTATAAGTGAGAGG + Intergenic
1052574421 9:30273641-30273663 CATTAACTTTTAGAAGTGATGGG + Intergenic
1052675325 9:31614843-31614865 CATAAACTCTTAGAACCCAGTGG + Intergenic
1053191863 9:36078233-36078255 CCTTATTTAATAGAAGTCAGAGG - Intronic
1054764227 9:69029810-69029832 CAGTTTCTCTGAGAACTCAGAGG + Intergenic
1054894918 9:70298416-70298438 CATAATCTGATAGAAGACAGTGG - Intronic
1055472007 9:76621293-76621315 CAGTTTCTCCTAGAATTCAGGGG + Intronic
1058881770 9:109291604-109291626 AACAATCTCTTAGAAATCAGAGG + Intronic
1061399869 9:130362534-130362556 TATTAACTCTTTGAAGTCCGTGG + Intronic
1202787631 9_KI270719v1_random:44204-44226 AATCATCTCTTAAAAATCAGGGG + Intergenic
1186856760 X:13634526-13634548 TATTATCTCTTAGGATTCTGTGG - Intergenic
1187951450 X:24474863-24474885 CTTTAGCTCTTAGAAGGTAGCGG + Intronic
1188531690 X:31148100-31148122 CATTATCTCCTTGAGGGCAGCGG - Intronic
1188599407 X:31942888-31942910 CATTATTTCATAGTAGTCTGGGG + Intronic
1189959900 X:46314467-46314489 GATTACCTCCTAGAAGTCAAGGG + Intergenic
1190855324 X:54288625-54288647 CATTATATCTCAGAGGGCAGTGG - Intronic
1190857550 X:54311807-54311829 CATTAACTGCTAGAAGTCAAAGG + Intronic
1192285020 X:69726525-69726547 CATTATATATTAAAAGTTAGAGG - Intronic
1196055663 X:111352136-111352158 CTCTATGTCTTAGATGTCAGTGG - Intronic
1197136876 X:123071671-123071693 CCTTATCTCATGGAAGTTAGAGG + Intergenic
1197311692 X:124913108-124913130 CAGTATCTCTTTTAAGTCAATGG - Intronic
1197539233 X:127734762-127734784 CATGATCTCTGATAAGTCAAAGG - Intergenic
1199204572 X:145133718-145133740 CATTATCTCTGAGAATTAAGTGG - Intergenic
1201180732 Y:11342009-11342031 CATCATCTCTTAAAAGTCAATGG - Intergenic
1201530242 Y:14983788-14983810 AATTTTTTCTTAGAATTCAGGGG + Intergenic
1201541699 Y:15111875-15111897 CATTATAACTTTGAGGTCAGAGG + Intergenic
1201589462 Y:15599075-15599097 CATTATCTCTTTTAATTCAGGGG - Intergenic
1201932167 Y:19362484-19362506 CATTGTCTCTTAGTACTCATTGG - Intergenic