ID: 961219396

View in Genome Browser
Species Human (GRCh38)
Location 3:125187763-125187785
Sequence CAGGGGAATCAGCATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961219396_961219407 17 Left 961219396 3:125187763-125187785 CCCTCCTCATGCTGATTCCCCTG 0: 1
1: 0
2: 0
3: 28
4: 299
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961219396 Original CRISPR CAGGGGAATCAGCATGAGGA GGG (reversed) Intronic
900114420 1:1022406-1022428 CAGGGTGATCCGCATGAGGCTGG - Exonic
901214845 1:7549423-7549445 CGGGGGAATAAGGATGAGGGAGG - Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902519764 1:17009620-17009642 TAGGAGGATCAGCATGAGGCCGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903183791 1:21618492-21618514 CAGGGGACTCAGCGAGATGAGGG - Intronic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904810617 1:33161292-33161314 CAGAGGGAGCCGCATGAGGAAGG + Intronic
904834646 1:33327419-33327441 GAGGGTATTCTGCATGAGGAAGG + Intronic
905343534 1:37295628-37295650 CAGGAGAGTCAGGATGAGTACGG + Intergenic
905851768 1:41280036-41280058 CAGGGGCATCTGCAGGAGAAGGG - Intergenic
905975709 1:42172230-42172252 TAGGGGAATTTGCAGGAGGAGGG - Intergenic
907433559 1:54429422-54429444 CTCGGGAAGCTGCATGAGGAGGG + Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908152480 1:61316585-61316607 CAGGGTTATCAGCATTCGGAGGG - Intronic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
908640528 1:66218056-66218078 CTGGGGAATCAGCATTAGCCTGG + Intronic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
912228967 1:107770061-107770083 AAGGGGACTGAGCATGAGGTGGG - Intronic
912549939 1:110479055-110479077 CAGGGCCATCAGCATGGGGCAGG + Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915945064 1:160143823-160143845 GGGTGGGATCAGCATGAGGAAGG - Intergenic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
920960949 1:210663657-210663679 TAGGGGAATCTGCAGGGGGAAGG - Intronic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921392474 1:214630496-214630518 CAGGTGCATCAGCCTGATGATGG - Intronic
921598982 1:217087306-217087328 AATGTGAATCAGCATGAGAATGG - Intronic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG + Intergenic
923627219 1:235623771-235623793 CTGGGGAGACAGCATGATGAGGG - Intronic
1062838331 10:650729-650751 CAGGGAAGTGAGCATGAGGGGGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067984972 10:51133173-51133195 AAAGGGAATCTGCATGTGGATGG + Intronic
1068161085 10:53264947-53264969 CAGGGGAATCAGTCAGAGGGAGG - Intergenic
1069902932 10:71716212-71716234 CAGGGCGATGAGCATGGGGAGGG + Exonic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1072425976 10:95331249-95331271 CAGGGAAATCAGGATGGGGTGGG - Intronic
1074120295 10:110489068-110489090 CAGTAGAATCAGCATGACCAGGG + Intergenic
1074300357 10:112227570-112227592 GATGGGAACCAGCATGATGAGGG - Intergenic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG + Intronic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075894694 10:125984637-125984659 CAGAGTCATCAGCATGAGGCTGG + Intronic
1076824838 10:132961667-132961689 CAGGGGAGCCAGCATGTGGTAGG - Intergenic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079787077 11:24686850-24686872 TCGGGGAAGCAGCATGAGCAGGG - Intronic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1080832294 11:35906835-35906857 GAGGGGACTTAGCATGAGAATGG - Intergenic
1081159037 11:39731478-39731500 CAGGGGAAGCATCATGGGAAAGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082986943 11:59177228-59177250 CATGGGAATCTGCATGTGAATGG - Intronic
1084199086 11:67543424-67543446 CTGGGGTACCAGCATGGGGAGGG + Intergenic
1085394935 11:76202467-76202489 CATGGGCACCAGCATGAGGTGGG - Intronic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086193739 11:84111782-84111804 CATGGGGAACAGCATGAGTACGG + Intronic
1087277647 11:96176446-96176468 CAGGGGACTCATCTTGAGGTAGG + Intronic
1089269916 11:117295036-117295058 AAGGGGAATTAGCAGAAGGAGGG - Intronic
1089910230 11:122091437-122091459 CAGAGGAATACACATGAGGAAGG + Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090893828 11:130951478-130951500 AAGGGGCATCAACATGAGCATGG - Intergenic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1094701235 12:32872621-32872643 CAGGGGAACCAGCCTGGGCAGGG - Intronic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1098440973 12:70517947-70517969 CAAGAGAATCAGCATGTGAAGGG + Exonic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1098957850 12:76705979-76706001 TAGGGGAATAAGCTTGATGAGGG - Intergenic
1101181169 12:102219599-102219621 CTGGGGAATCTGCATGGGAAAGG + Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1103185443 12:118953164-118953186 CAGAGGACTCAGAATAAGGAAGG + Intergenic
1104602775 12:130164126-130164148 CAGGGGAATGAGCACGAAGCCGG - Exonic
1104928793 12:132327787-132327809 GAGGTGAATCCCCATGAGGAGGG - Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1113431479 13:110255318-110255340 CAAGTGTATTAGCATGAGGAGGG + Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114665960 14:24377358-24377380 CAGGGGAATCGGTATCAGCAGGG - Exonic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117424666 14:55580965-55580987 CACGGAAAGCAGCATGAGGGGGG + Intronic
1117601944 14:57385259-57385281 GAAGGAAATCAGCATTAGGATGG + Intergenic
1118776266 14:68976268-68976290 CAGGGGAGTGAGTGTGAGGAGGG - Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123614994 15:22137541-22137563 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1124009005 15:25820432-25820454 CAGGAGAATCAACATCAGTATGG - Intronic
1126504805 15:49392362-49392384 CAGTGGAATGTGCATGGGGAAGG + Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1131827215 15:96331338-96331360 CGGGGGAATCAGCATGAAAGTGG - Exonic
1202987239 15_KI270727v1_random:429304-429326 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133390258 16:5404356-5404378 CAGGGGATTCATCATTTGGAGGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1135798980 16:25474903-25474925 AAGGGAAATCAGCATGGGTACGG - Intergenic
1136048552 16:27634490-27634512 GTGGGGTATCAGCATCAGGAAGG + Intronic
1138308658 16:56004085-56004107 CAGGTGAACCACCCTGAGGACGG - Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141961592 16:87412771-87412793 CACGGAATTCAGCATGCGGATGG + Exonic
1142313157 16:89325901-89325923 CAAGGGCATGAGCATGACGACGG + Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1142772699 17:2110812-2110834 CAGAGGAATCAATATCAGGAGGG + Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1147529967 17:41266310-41266332 CTTGGGAATCAGCTTGAGGGAGG + Exonic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1152325165 17:79631802-79631824 CAGGGGGAGCAGCCTGAGGGTGG - Intergenic
1152490840 17:80632298-80632320 CACAGGGATCCGCATGAGGAAGG - Intronic
1152796668 17:82310949-82310971 CACGGGAACCAGCATGAGCCGGG + Intergenic
1153110569 18:1581303-1581325 AAGGGGACTCAGCATCAGAAAGG - Intergenic
1153999804 18:10473606-10473628 CAGGGGAATCAACATGTTGAAGG - Intronic
1154099975 18:11463890-11463912 CAGAAGAATGAGTATGAGGAAGG - Intergenic
1155060584 18:22224588-22224610 CAGGGGATTCAGGATCAGGGTGG + Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1157187077 18:45549692-45549714 CAAGGGAGTCTGCAAGAGGAAGG + Intronic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1158939768 18:62396541-62396563 AAGGGAAATAAGCATGGGGAAGG - Intergenic
1159327575 18:66943151-66943173 CAGGGTCATCAGCATGCAGATGG - Intergenic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1163438871 19:17311532-17311554 CAGGGGCCTCAGGGTGAGGAGGG - Intronic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1166593916 19:44027602-44027624 CAGGGGCATCAGCAGGGAGAAGG - Intronic
1166837727 19:45677543-45677565 CAGGGCAATCGGCAAGGGGAGGG + Intronic
1167162292 19:47776101-47776123 CAGGGGGATCAGACTGAGGTGGG + Intergenic
1167334372 19:48875549-48875571 CACGGGAATCCGGATGGGGAGGG - Intronic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1168701363 19:58441462-58441484 AAGTGGAATAAGCATGAGTAGGG + Intergenic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
926259544 2:11245754-11245776 CAGTGGGATCAGAATGAGGTTGG - Intronic
926653782 2:15376056-15376078 TAGGGGAACTAGAATGAGGAGGG + Intronic
926725850 2:15997305-15997327 CAGGGCCACCAGCATCAGGAAGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
930021517 2:47004659-47004681 GAGGGGAATGAGCAGGAGAAGGG + Intronic
930106087 2:47640563-47640585 AAGGGAAATCAGCGTGAGGCAGG + Intergenic
930126086 2:47797993-47798015 CAGGGAAAGCAGCATTATGAAGG - Intronic
930659698 2:54041385-54041407 CAAGGGCATCAGAATGATGAGGG + Intronic
931829257 2:66034097-66034119 CATGGGTATCAGGGTGAGGAAGG + Intergenic
931855706 2:66299737-66299759 GAGGGGAGCCAGCATGGGGAGGG + Intergenic
932124154 2:69128129-69128151 CAGGAGAATCAGCCTGAACATGG + Intronic
932753591 2:74389094-74389116 CCTGGGAAACAGCATTAGGAAGG + Intronic
933919487 2:87030320-87030342 CAGGTAAATCAGCACGAGGGAGG + Intergenic
934003507 2:87739587-87739609 CAGGTAAATCAGCACGAGGGAGG - Intergenic
934993731 2:98938644-98938666 GAGGAGACTCAGCATGAGAAGGG + Intergenic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
936867117 2:117087527-117087549 TTGGGGAGTCAGCATGATGAGGG - Intergenic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
938378122 2:130822027-130822049 CCGGGGAGTGTGCATGAGGAGGG + Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
938937274 2:136138071-136138093 CACTGTTATCAGCATGAGGATGG - Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939322628 2:140644079-140644101 CTGGGGAATCAGCACGCAGAGGG - Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
946336791 2:219042983-219043005 CAAGGGATTGAGCCTGAGGAGGG + Intergenic
947590162 2:231380828-231380850 CAGGGAAATCAGCATTTGGCTGG + Intergenic
948055076 2:235005051-235005073 CAGGGGGATCTGCAGGCGGATGG - Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948701755 2:239765049-239765071 CGGGGGAATCAGCACCAGGCTGG - Intronic
1170673100 20:18453326-18453348 CCAGGGTATCAGCATCAGGAAGG - Intronic
1171225690 20:23440293-23440315 CAGGGCAATCAGCAGCAGCAGGG - Exonic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1172422497 20:34829079-34829101 CAGGGGGATCAGCATGTGCAAGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173720616 20:45254499-45254521 CAGGGCAAGCAGCACCAGGAAGG + Exonic
1174121877 20:48271957-48271979 CAGGGGAAACAGCTTGAGATTGG - Intergenic
1175523356 20:59617219-59617241 CATGGGAATAGGTATGAGGAGGG - Intronic
1176347501 21:5763357-5763379 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176354315 21:5883941-5883963 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176497326 21:7561098-7561120 AAGGGGAATCAGCAAGGAGATGG + Intergenic
1176541822 21:8161427-8161449 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176560773 21:8344472-8344494 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1183620095 22:38967130-38967152 CAGGGGAATCAGCAGGACAGGGG + Intronic
1183713012 22:39517507-39517529 AAGGGGAATCAGCTTCAGGATGG + Exonic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1203246762 22_KI270733v1_random:77846-77868 AAGGGGAATCAGCAAGGAGATGG - Intergenic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
949628125 3:5891088-5891110 CAGAGGAATTAGGATGAAGATGG - Intergenic
949973721 3:9434821-9434843 TAGGGGAATGAGCAGGGGGAAGG + Exonic
950045248 3:9945176-9945198 TAGAGGAATCAGCCTTAGGAGGG + Intronic
951201171 3:19876445-19876467 GATGGGAATCAGCAGCAGGATGG + Intergenic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
953233522 3:41085612-41085634 CAGGGGCATAGGCATGTGGATGG - Intergenic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
955981243 3:64529742-64529764 CAGGGGCATCAGCATCACCAGGG + Intronic
956371775 3:68571020-68571042 CAGGTAAAGCAGCATGAGGGAGG - Intergenic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
959476243 3:106815487-106815509 CAGGGGACTCAGCATCTGGAGGG - Intergenic
960390853 3:117075923-117075945 CAGGGAAAAAAACATGAGGATGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
963272683 3:143301379-143301401 CAGAGAAATCAGCAAGAGGGCGG + Intronic
966937843 3:184725577-184725599 CAGGGGAAGCTGCATCAGGACGG - Intergenic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
968962392 4:3752252-3752274 CAGTGGAGTGTGCATGAGGAAGG - Intergenic
969294523 4:6262012-6262034 CAGGGAACTGAGCATGGGGAGGG - Intergenic
969702002 4:8772916-8772938 CAGGGGAACTAGAATAAGGAAGG - Intergenic
969918704 4:10515341-10515363 GAGAGAAATCAGGATGAGGATGG - Intronic
970377366 4:15472865-15472887 CAGGGGAATTAGCATGTTAAAGG - Intronic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973742642 4:53933234-53933256 CAGTCCAATCAGCGTGAGGAAGG + Intronic
974062974 4:57052316-57052338 CAGGGGTGTCAGTCTGAGGAAGG + Intronic
974886784 4:67828997-67829019 GAGAGGAATGAGCATGAGCATGG - Intronic
976964433 4:91018714-91018736 GAGGGGGTTCAGCATGAGAAAGG - Intronic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978448613 4:108804911-108804933 CTGAGGTATCTGCATGAGGATGG + Intergenic
980913533 4:139014577-139014599 CAGGGGAATCAGCAAAATCATGG + Intergenic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
981978924 4:150768270-150768292 TAGAGGAATCAACATGAGGAAGG + Intronic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
985119925 4:186630297-186630319 CAGGTGAGTAAGTATGAGGAAGG + Intronic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG + Intergenic
992912295 5:81407927-81407949 CAGGAGAATGAGCATTAGCAGGG + Intergenic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
995752165 5:115463706-115463728 CAAGAAAATAAGCATGAGGAAGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998554743 5:143112303-143112325 AATGGGGATCAGCATTAGGAAGG + Intronic
999597785 5:153224201-153224223 CAGCGGAATCAGCATCATGTGGG + Intergenic
1000686742 5:164259230-164259252 CAGGGGAATCTCCATGAAGCTGG - Intergenic
1001106717 5:168860786-168860808 CAGGGGAAACAGCTTAAGAATGG - Intronic
1001628880 5:173159987-173160009 CATGGGGATCAGCAGGATGATGG + Exonic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1003427846 6:6009120-6009142 CAGGTGGATAAGCAGGAGGAAGG - Intergenic
1003637321 6:7844683-7844705 CACGTGAACCAGCCTGAGGAGGG + Intronic
1004543460 6:16573759-16573781 CAGGGACAAAAGCATGAGGAAGG - Intronic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1006919871 6:37620283-37620305 CAGTTCCATCAGCATGAGGAAGG + Intergenic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1021930832 7:25579746-25579768 TCGGGGAATCAGTCTGAGGATGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG + Intronic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1023860362 7:44214652-44214674 CAGCGGGATCAGGATGGGGATGG - Intergenic
1024385680 7:48748795-48748817 CAGGCGAAGCAGCATGGGGGAGG + Intergenic
1026467368 7:70665959-70665981 CAGAGGAGTCAGCATCAAGAAGG + Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1031291688 7:119945699-119945721 TAGGGGATTCAGCATCAAGAAGG - Intergenic
1033679675 7:143582169-143582191 CAGAGAAATGAACATGAGGAGGG - Intergenic
1033692160 7:143747274-143747296 CAGAGAAATGAACATGAGGAGGG + Intergenic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034356150 7:150451882-150451904 CAGGGCAACCATCAAGAGGAAGG - Intronic
1034817145 7:154182387-154182409 CATGGCAACCAGCATGAGGAGGG - Intronic
1035781596 8:2232379-2232401 TAGGGGGGTCAGCATGCGGAGGG + Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1037328936 8:17724725-17724747 CAAGAGAATGGGCATGAGGAGGG - Intronic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1037569724 8:20148062-20148084 CAGAGGAACCTGCATGGGGAAGG + Exonic
1039839033 8:41280468-41280490 CAGGGCATTCAGCTTGAGGCCGG - Intronic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1044536773 8:93365924-93365946 CAGGGATATTAGCAAGAGGATGG + Intergenic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1048661314 8:136605132-136605154 AAAGGGAATCAGTATGAGCATGG - Intergenic
1049553505 8:143271341-143271363 CAGGCCTATCAGCATGAAGAGGG - Intronic
1049845174 8:144797280-144797302 CAGGGGAAACTGGGTGAGGAGGG - Intergenic
1050105746 9:2164624-2164646 CATGGAAATCAGCATCAGCAAGG - Intronic
1051689448 9:19694906-19694928 CAGGGAAATCAACTTGATGAGGG - Intronic
1051689628 9:19696386-19696408 CAGGGAAATCAACTTGATGAGGG + Intronic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1053511676 9:38693198-38693220 CATGGGAATGAACATCAGGAAGG - Intergenic
1053523225 9:38803182-38803204 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054195453 9:62027601-62027623 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG + Intergenic
1057318245 9:93986441-93986463 CAGGGGACTCAGGATGATTAAGG - Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1059696188 9:116732517-116732539 CGGGGGAATCGTCATGGGGAAGG - Intronic
1059837019 9:118166690-118166712 GAGGGGAATAATCAGGAGGAAGG - Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1203463096 Un_GL000220v1:60908-60930 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1186342878 X:8662109-8662131 CAGGGGCATCAGCCTGATGCAGG - Intronic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187880166 X:23839371-23839393 CAGGGGAGTCTGCTTGAGGCTGG + Intronic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1189118759 X:38370936-38370958 CATGGCACCCAGCATGAGGAAGG - Intronic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192288066 X:69759806-69759828 CTGGGGAATAAGGATAAGGAAGG + Intronic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1199489252 X:148380490-148380512 CAGGGGAGTCAGCACCAAGAAGG + Intergenic
1200238878 X:154483333-154483355 CTGGGGATTCTGCATGAAGATGG - Intergenic
1200247699 X:154534735-154534757 CCGGGGACCCAGCATGAGGCAGG - Intronic