ID: 961219407

View in Genome Browser
Species Human (GRCh38)
Location 3:125187803-125187825
Sequence GCTCATTCTGTACCTTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 160}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961219404_961219407 -6 Left 961219404 3:125187786-125187808 CCTGGAAGGCCTCTCCTGCTCAT 0: 1
1: 0
2: 2
3: 16
4: 242
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219394_961219407 21 Left 961219394 3:125187759-125187781 CCACCCCTCCTCATGCTGATTCC 0: 1
1: 0
2: 3
3: 28
4: 352
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219402_961219407 -1 Left 961219402 3:125187781-125187803 CCCTGCCTGGAAGGCCTCTCCTG 0: 1
1: 0
2: 4
3: 45
4: 481
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219390_961219407 27 Left 961219390 3:125187753-125187775 CCACCCCCACCCCTCCTCATGCT 0: 1
1: 0
2: 24
3: 192
4: 1616
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219395_961219407 18 Left 961219395 3:125187762-125187784 CCCCTCCTCATGCTGATTCCCCT 0: 1
1: 0
2: 1
3: 37
4: 448
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219392_961219407 23 Left 961219392 3:125187757-125187779 CCCCACCCCTCCTCATGCTGATT 0: 1
1: 1
2: 3
3: 41
4: 403
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219396_961219407 17 Left 961219396 3:125187763-125187785 CCCTCCTCATGCTGATTCCCCTG 0: 1
1: 0
2: 0
3: 28
4: 299
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219401_961219407 0 Left 961219401 3:125187780-125187802 CCCCTGCCTGGAAGGCCTCTCCT 0: 1
1: 0
2: 19
3: 161
4: 956
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219397_961219407 16 Left 961219397 3:125187764-125187786 CCTCCTCATGCTGATTCCCCTGC 0: 1
1: 0
2: 2
3: 25
4: 251
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219391_961219407 24 Left 961219391 3:125187756-125187778 CCCCCACCCCTCCTCATGCTGAT 0: 1
1: 2
2: 3
3: 41
4: 396
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219389_961219407 28 Left 961219389 3:125187752-125187774 CCCACCCCCACCCCTCCTCATGC 0: 1
1: 1
2: 20
3: 173
4: 1685
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219388_961219407 29 Left 961219388 3:125187751-125187773 CCCCACCCCCACCCCTCCTCATG 0: 1
1: 3
2: 22
3: 210
4: 1647
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219403_961219407 -2 Left 961219403 3:125187782-125187804 CCTGCCTGGAAGGCCTCTCCTGC 0: 1
1: 0
2: 4
3: 43
4: 327
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219398_961219407 13 Left 961219398 3:125187767-125187789 CCTCATGCTGATTCCCCTGCCTG 0: 1
1: 0
2: 2
3: 49
4: 353
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
961219393_961219407 22 Left 961219393 3:125187758-125187780 CCCACCCCTCCTCATGCTGATTC 0: 1
1: 1
2: 1
3: 37
4: 321
Right 961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961219407 Original CRISPR GCTCATTCTGTACCTTTGTC AGG Intronic
901120117 1:6884542-6884564 CCCAATTCTGTACCTTTATCAGG + Intronic
902293359 1:15449516-15449538 GCTCATGCTGTTCCCTTGGCTGG - Intergenic
904935701 1:34128161-34128183 GCTCAATCTGGACCTTTTTGAGG + Intronic
907923377 1:58933379-58933401 TCTGAGTCTGTATCTTTGTCTGG + Intergenic
910693986 1:89993512-89993534 TCTCCTTCTGTACATTTCTCAGG - Intergenic
911285462 1:95986700-95986722 GCTCATGTTGTTCCTTTGCCTGG - Intergenic
912731016 1:112103755-112103777 TCTCTTTCTGTATCTTTGTGTGG + Intergenic
913253099 1:116928690-116928712 GCTTATTCTAAACCTTTGTCAGG + Intronic
914240304 1:145848659-145848681 GCTCATTCTGCACCTTTCCAGGG - Exonic
916082843 1:161246448-161246470 TTTCATTCTGTTCCTTTCTCTGG + Intergenic
919612242 1:199759661-199759683 ACTCATCCTGTACCTCTGCCAGG + Intergenic
920775637 1:208934208-208934230 GCTTATTCTGTACCTTTAATGGG + Intergenic
921188124 1:212686883-212686905 GCTCCTTCAGTGCCTCTGTCAGG + Exonic
921406161 1:214781677-214781699 GCTAATTCTGTACTTCTGTGGGG + Intergenic
923080496 1:230649237-230649259 GCTCATTCTAAACCTTTATTTGG - Intronic
923642178 1:235775207-235775229 GCTCATACTCTACCTATGTAAGG + Intronic
1063552397 10:7045429-7045451 GTTCATCCTTTGCCTTTGTCTGG + Intergenic
1064604739 10:17026863-17026885 GCTTTTTCTGTGCCTATGTCAGG - Intronic
1070643937 10:78188426-78188448 TCTCATTCTGTACCTCAGGCTGG - Intergenic
1071911231 10:90236330-90236352 TCTCTTTCTGTACATTTCTCTGG + Intergenic
1072033167 10:91540481-91540503 GCTCATTCTGAATCTCTGTGGGG - Intergenic
1072988964 10:100171450-100171472 GTTCATGCTGTACTCTTGTCTGG - Intronic
1073005827 10:100323566-100323588 GCTCACTCTGTATCTTTATGGGG + Intronic
1079051386 11:17163428-17163450 TCTCATTCTGTAGCCTTGGCTGG + Intronic
1080187179 11:29503982-29504004 CCTAATTCTGTAACTTTCTCTGG + Intergenic
1081967716 11:47179568-47179590 GCTCATACTGAGCTTTTGTCTGG + Exonic
1083110234 11:60399338-60399360 GCTCATGCTTTATCTTTGCCAGG - Intronic
1085540409 11:77262639-77262661 GCTGATTCTGTTCCTCTGTGGGG - Intronic
1088085041 11:105967885-105967907 TTTCATTTTGTACCTTTTTCAGG + Intronic
1091505077 12:1059797-1059819 GTTGTTTCTGTACCCTTGTCTGG + Intronic
1091762663 12:3097472-3097494 GCTCATTCTTTACCTCTGGGAGG + Intronic
1093535912 12:20222805-20222827 GTTCTTTCTATACCTTTGTTGGG - Intergenic
1093787804 12:23213059-23213081 GTTCATTCACTTCCTTTGTCTGG + Intergenic
1094587370 12:31789866-31789888 GCCCATCCTGTACCATAGTCTGG + Intergenic
1095229795 12:39726191-39726213 GCATATTCTGCACCTGTGTCCGG - Intronic
1095395781 12:41761064-41761086 GCTCAGTCTTTACATTTTTCAGG - Intergenic
1097576310 12:61396765-61396787 GCTCATTGTAAAGCTTTGTCAGG - Intergenic
1098982121 12:76967663-76967685 GCTCAGTCTGAAGCTTTGCCAGG + Intergenic
1099317191 12:81098864-81098886 GCTTAGTTTGTACCTCTGTCAGG + Intronic
1099560842 12:84173073-84173095 GCTCATTCTGCCCCCTTGTCTGG + Intergenic
1099828577 12:87811355-87811377 GCTGGTGCTGTTCCTTTGTCTGG - Intergenic
1103830151 12:123772570-123772592 GCTCCATCTGGACCTTTGCCAGG + Intronic
1104967311 12:132514071-132514093 GCTCATTCGGGATCCTTGTCTGG + Intronic
1106448659 13:29860109-29860131 GCTCATTCAGTTCCTGAGTCAGG + Intergenic
1106582440 13:31029700-31029722 GCTCATTCCTTACCTATTTCTGG + Intergenic
1108448956 13:50541086-50541108 GAGCATTCTGTATTTTTGTCTGG + Intronic
1109252925 13:60042233-60042255 GGTCATTCTGTACTTTTATTTGG + Intronic
1109916123 13:68987351-68987373 GCTTATTCTGTACTTTTCTTTGG - Intergenic
1111350971 13:87031174-87031196 GCTCATTCTCTGCCTTTTTTAGG - Intergenic
1116949601 14:50867146-50867168 CCACATTCTATACCTTTTTCTGG + Intronic
1119773184 14:77234179-77234201 GCTGCTTCTGCAGCTTTGTCAGG - Intronic
1121158073 14:91705798-91705820 GCTCATTGTCTACCCTGGTCTGG - Intronic
1125917192 15:43498892-43498914 CCTCATGCTGTTCCTATGTCAGG - Intronic
1125934283 15:43621204-43621226 GTTTATTCTGTACCAGTGTCTGG - Intergenic
1125947386 15:43720670-43720692 GTTTATTCTGTACCAGTGTCTGG - Intergenic
1127421053 15:58806385-58806407 TCTCACTCTGTCACTTTGTCTGG + Intronic
1127429853 15:58894002-58894024 ACTCATTCTGTTTTTTTGTCTGG - Intronic
1128192487 15:65716191-65716213 TCTCCTACTTTACCTTTGTCTGG + Intronic
1129151141 15:73688524-73688546 GCTCATGCTGTACCCTGGGCAGG + Intronic
1129686717 15:77690242-77690264 GCTCATCCTGAACCTTTAACTGG - Intronic
1132038978 15:98508791-98508813 ATTCACTCTGGACCTTTGTCAGG - Intronic
1133450512 16:5900127-5900149 GCTTATATTGTACCTTTGTTTGG + Intergenic
1134585497 16:15406894-15406916 TCTCATTCTGTCGCTTAGTCTGG - Intronic
1135612140 16:23877603-23877625 TCTCTTTCTGTGCATTTGTCTGG + Intronic
1135790467 16:25389602-25389624 GCTGATTCAGTTCCTTTGTGGGG + Intergenic
1135814712 16:25621982-25622004 GCACATTCTGTTCCTTTTGCTGG + Intergenic
1136869748 16:33795666-33795688 GATCATACTTTACCTTTGCCAGG + Intergenic
1137844923 16:51677829-51677851 GCACTTTCTGTACCTTTTTCAGG + Intergenic
1203102424 16_KI270728v1_random:1320389-1320411 GATCATACTTTACCTTTGCCAGG - Intergenic
1144507353 17:15843841-15843863 GCTCATTCTATGCCCTTGCCTGG - Intergenic
1144778744 17:17797502-17797524 GCTGTTTCTGTGCCCTTGTCTGG - Exonic
1145119249 17:20241861-20241883 GCTCATTCTATGCCCTTGCCTGG - Intronic
1145171478 17:20661446-20661468 GCTCATTCTATGCCCTTGCCTGG - Intergenic
1151125618 17:71841628-71841650 GCACATTCTGTATCTGTGCCTGG - Intergenic
1152010862 17:77714557-77714579 GCTCTTTCTGTAGCTTTTTAAGG + Intergenic
1154312551 18:13278555-13278577 GCTTATTCTGTCTCATTGTCAGG + Intronic
1155437915 18:25832393-25832415 TATCATTCTGTAGCTTTGTATGG + Intergenic
1155749964 18:29410001-29410023 GCTCCTTCTGTATCTTCGTGTGG + Intergenic
1158199672 18:54925862-54925884 GCTGATTCTTTCCCTTAGTCTGG - Intronic
1158491040 18:57910045-57910067 TCCCCTTCTGTCCCTTTGTCAGG + Intergenic
1159205468 18:65244947-65244969 GCACATTTTGTACCTTTTTGTGG - Intergenic
1159371958 18:67539483-67539505 GCTCATCCTGTTCCTATGTTTGG + Intergenic
1162493030 19:11005873-11005895 GCTCACTCTGTCAATTTGTCCGG + Intronic
1163441950 19:17326739-17326761 GCCCATTCTGTAGCTTTCTGAGG + Intronic
1164067231 19:21727344-21727366 CCACATTCTGTACATTTGTAGGG + Exonic
1167872573 19:52384883-52384905 GCACATTCTTTACATTTGTAAGG - Exonic
926152033 2:10430561-10430583 CCTCAGTCTCTTCCTTTGTCCGG + Intergenic
930121305 2:47763261-47763283 TCTCATTCTGTAGCTTAGGCTGG + Intronic
931843949 2:66183234-66183256 GCTCATTGTGCATCATTGTCAGG + Intergenic
933940779 2:87243452-87243474 ACACATTCTCCACCTTTGTCTGG + Intergenic
934976298 2:98805173-98805195 TCTCATTCTGTTTCTTGGTCTGG + Intronic
936352360 2:111722560-111722582 ACACATTCTCCACCTTTGTCTGG - Intergenic
941655965 2:168145171-168145193 GCTCATGCCGTTTCTTTGTCTGG - Intronic
944584315 2:201160169-201160191 GCTCAGTCTGTGCCTGTGGCTGG + Intronic
945377913 2:209100855-209100877 GATTATTCTGTATCTTTGTATGG - Intergenic
946353230 2:219169076-219169098 CCTCATGCTGCACCTTTGTAGGG - Exonic
946864922 2:224034363-224034385 GCTCCTTCTGTACCTCTGCCTGG - Intronic
947777068 2:232721538-232721560 GCTCATTCTATTCCTTTATTAGG + Intronic
948025373 2:234772192-234772214 GCTCATTGTGTTAGTTTGTCAGG - Intergenic
948332654 2:237182366-237182388 TCTCATACTCTACCTTTATCTGG - Intergenic
1169552181 20:6712451-6712473 GCTCATTTTGAACCTTCGCCAGG - Intergenic
1169718007 20:8642779-8642801 TCTAATGCTGTACCTTTTTCTGG + Intronic
1169934961 20:10873492-10873514 GCCCATTCTTTACATCTGTCAGG + Intergenic
1171503972 20:25618348-25618370 GTTCATGCTGTTCCTCTGTCTGG - Intronic
1173142523 20:40496563-40496585 GTTCATTCTGTACTTGTCTCTGG - Intergenic
1174188121 20:48721423-48721445 GCTCACTCTTCATCTTTGTCAGG - Intronic
1174568043 20:51481091-51481113 GCACATTCTGTACCTTTTGTAGG - Intronic
1174943925 20:54963937-54963959 GCACATGCTGTTCCTTTGTTTGG - Intergenic
1178404384 21:32312365-32312387 GGTCCTTCTGTACCTTTGTTAGG + Exonic
1179347288 21:40570401-40570423 GCTCCTTCTGTCCTTCTGTCGGG - Intronic
1180583543 22:16864832-16864854 TCTCATTCTGTCCCTTAGGCTGG - Intergenic
1182192840 22:28481592-28481614 TCTCATTCTGTAACTTTGTTGGG - Intronic
1182640875 22:31766318-31766340 ACTCATTCTGTATTTTAGTCTGG - Intronic
1184309113 22:43629746-43629768 GCACATTCTGTTCCTTTGCTTGG - Intronic
1184455487 22:44607515-44607537 GCTCTTTCTGTGCCTCTCTCTGG - Intergenic
1184551860 22:45208963-45208985 GCCCATTGTGTGCCTTTGGCAGG - Intronic
956050556 3:65243751-65243773 GTTCCTTCTGTAGCTCTGTCTGG + Intergenic
958963346 3:100532285-100532307 GCTCCTTCTGCATCTTTGGCTGG + Intronic
961219407 3:125187803-125187825 GCTCATTCTGTACCTTTGTCAGG + Intronic
961415354 3:126752820-126752842 GCTCCTTCTTTACATTTTTCTGG - Intronic
962397695 3:135031337-135031359 TCTCACTCTGTAGCCTTGTCTGG + Intronic
967472924 3:189884020-189884042 GCTCTTGCTGTACATTTGACTGG + Intronic
969291678 4:6244146-6244168 GCTCAGTCTGTGTCTGTGTCTGG + Intergenic
970118601 4:12727032-12727054 CCTTATTCTGTACATTTTTCAGG + Intergenic
973248680 4:48038867-48038889 GCTCATTGTGTACCCTGGACAGG + Exonic
974671223 4:65032674-65032696 GTTCATTCTGTTCCTATTTCTGG - Intergenic
975920244 4:79378647-79378669 CCACATTCTGTTCCTTTCTCCGG - Intergenic
976269193 4:83213770-83213792 GCACATGCAGTACCTTTGCCTGG - Intergenic
977960391 4:103078217-103078239 GTTAATTCTGTAACATTGTCAGG - Intronic
979374590 4:119931465-119931487 TCTCAGCCTGTACCTTTTTCTGG + Intergenic
979527520 4:121732938-121732960 TCACAGTCTGTGCCTTTGTCAGG + Intergenic
980339689 4:131529002-131529024 GCTCATTCTGAACCTTATTTTGG - Intergenic
981808072 4:148740268-148740290 GCCCAGTCTGTACCTTTTTATGG - Intergenic
984666582 4:182435623-182435645 GCTCCTTCTGGGCCTTTATCTGG - Intronic
986132824 5:4946686-4946708 GCTCCTTCTGTACCTTTACCAGG + Intergenic
988365683 5:30295230-30295252 ACTCCTTCTGTAACTTCGTCTGG - Intergenic
989474158 5:41855654-41855676 GCTTATTCTATCCCTGTGTCAGG + Intronic
999008972 5:148014095-148014117 ACTCATTCTGTACCCTTGCTTGG - Intergenic
1000387869 5:160692675-160692697 GCTGATTCTGTTCCTATGTGGGG - Intronic
1001282068 5:170393241-170393263 GCTCAGTCTGTACCCCTCTCTGG + Intronic
1003141507 6:3475292-3475314 GCTGATTATGTGCATTTGTCTGG + Intergenic
1003143543 6:3491427-3491449 GCTCCTTCTGGCCCTTTCTCAGG - Intergenic
1007688479 6:43681911-43681933 GCTCATTCTGCATCTTGGTTAGG - Intronic
1008117236 6:47566060-47566082 GCTTGTTGTATACCTTTGTCTGG + Intronic
1011454091 6:87528035-87528057 GCACATCCTGTACATTTGCCTGG + Intronic
1015962239 6:138661630-138661652 TCTCATTCTGTCGCTTAGTCTGG - Intronic
1016494011 6:144639037-144639059 TCTCATTCTGTCCCTTAGGCTGG - Intronic
1016708358 6:147140182-147140204 TCTCATTCTGTTCCCTAGTCTGG - Intergenic
1016798649 6:148145344-148145366 GTTCATTCTGTACCTATTTTTGG - Intergenic
1021960723 7:25870525-25870547 GGTCATTCTCTTCTTTTGTCTGG + Intergenic
1023313038 7:38907246-38907268 GCTCATGCTGTTCCTTTTTGAGG - Intronic
1025863497 7:65356962-65356984 GCACATTCTTTACATTTGTATGG - Intergenic
1030354313 7:108525960-108525982 GATCGTTCTGGACCCTTGTCCGG - Intronic
1031858019 7:126945130-126945152 GCTCCCTGTGTACCTTTGTCAGG - Intronic
1036697572 8:10987904-10987926 GCTCACTCTGCACCTCTCTCAGG + Intronic
1041460121 8:58102213-58102235 GCTCATTCTGTAACTGAGGCAGG - Intronic
1045870382 8:106920329-106920351 TCTCTTTCTTTGCCTTTGTCTGG - Intergenic
1045966026 8:108025552-108025574 TCTCATTCTGTCCCTGTGGCTGG + Intronic
1048847891 8:138617058-138617080 GCTCATTCTTTACCATTTGCAGG + Intronic
1053823109 9:41990269-41990291 GTTCATTCTGTATCTGTGTGTGG + Intronic
1054607464 9:67197097-67197119 GTTCATTCTGTATCTGTGTGTGG - Intergenic
1058163595 9:101595575-101595597 CATCCTTCTGTACCTTTTTCAGG + Intronic
1062453635 9:136625891-136625913 ACTCATTCTGTGCCTGGGTCAGG - Intergenic
1186656289 X:11615188-11615210 TTTCATTCTGCACCTTTCTCAGG + Intronic
1187113757 X:16328294-16328316 GCACATCCTGTATCTTTGGCAGG + Intergenic
1198644077 X:138787571-138787593 GCACATTCTGTACATGTATCTGG - Intronic
1202268860 Y:23050367-23050389 TCTCATTCTTTACATTTGTAGGG - Intergenic
1202421852 Y:24684107-24684129 TCTCATTCTTTACATTTGTAGGG - Intergenic
1202448934 Y:24985971-24985993 TCTCATTCTTTACATTTGTAGGG + Intergenic