ID: 961221610

View in Genome Browser
Species Human (GRCh38)
Location 3:125205404-125205426
Sequence TTTCACTCCAGTTTCTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961221605_961221610 7 Left 961221605 3:125205374-125205396 CCCTGCCTAACTCATTTCAGTGA 0: 1
1: 0
2: 0
3: 28
4: 251
Right 961221610 3:125205404-125205426 TTTCACTCCAGTTTCTAGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 192
961221606_961221610 6 Left 961221606 3:125205375-125205397 CCTGCCTAACTCATTTCAGTGAA 0: 1
1: 0
2: 1
3: 25
4: 162
Right 961221610 3:125205404-125205426 TTTCACTCCAGTTTCTAGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 192
961221607_961221610 2 Left 961221607 3:125205379-125205401 CCTAACTCATTTCAGTGAAGAAC 0: 1
1: 0
2: 2
3: 14
4: 203
Right 961221610 3:125205404-125205426 TTTCACTCCAGTTTCTAGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961221610 Original CRISPR TTTCACTCCAGTTTCTAGGT GGG Intronic
900660633 1:3780986-3781008 TTTCACCCCAGTTTTTTTGTTGG - Exonic
901918884 1:12521782-12521804 TTTCACTCCTGTTGCCAGGCTGG + Intergenic
904072966 1:27816282-27816304 TTTCACTCTTGTTGCTAGGCTGG - Intronic
906150687 1:43585763-43585785 GTCCAGTCAAGTTTCTAGGTTGG + Intronic
908429297 1:64040385-64040407 TTTCACTTAAATTTCTAAGTGGG - Intronic
911624083 1:100101098-100101120 TATCACTCCATTTTATAAGTGGG + Intronic
913421194 1:118671381-118671403 TTTGCCTCCAGTTTCAATGTTGG - Intergenic
914813513 1:151046888-151046910 TTTCATTCCAGTTGCTGGGACGG + Exonic
915376805 1:155403287-155403309 TTTCACTCCATTGCCTAGGCTGG - Intronic
916217384 1:162409077-162409099 TCTCACTCCAGCTCCTAGGCTGG - Intronic
920006645 1:202838136-202838158 TGTCACCTCAGTTTCTAGTTTGG + Intergenic
920360014 1:205408373-205408395 TTCCACTCCAGTTCCTCAGTTGG - Intronic
920635347 1:207696891-207696913 TTTCACTCCAGTGAGAAGGTGGG - Intronic
921598888 1:217085926-217085948 TTGCAATTCAGTTTTTAGGTTGG - Intronic
922434521 1:225590644-225590666 GGGCACTCCAGTTTCTAGCTCGG - Intronic
923981574 1:239329476-239329498 TTTCAGTTCAGTCACTAGGTGGG + Intergenic
1063588608 10:7375228-7375250 TTACACTCCAGCTTCTAGTAAGG - Intronic
1064839556 10:19575446-19575468 TTTCATTCCACTGTCTAGCTGGG - Intronic
1065531510 10:26674867-26674889 TTTCACTCTGTTTTCCAGGTTGG - Intergenic
1066929184 10:41735374-41735396 CTTCTTTCCAGTTTCTATGTGGG - Intergenic
1068462239 10:57343170-57343192 TTTCACTTCTTTTTCTAGATGGG - Intergenic
1068901671 10:62276748-62276770 TTTCACTCAAGTTTTTTGATTGG + Intergenic
1072242898 10:93513972-93513994 TCTCACTCTATTGTCTAGGTTGG + Intronic
1072243010 10:93514800-93514822 TTTCACTGGAGTTTCCAGGCTGG + Intronic
1072456881 10:95584277-95584299 TTAGACTAGAGTTTCTAGGTGGG + Intergenic
1074880673 10:117655346-117655368 TTTCTCTCCAGTCTCAAGGTTGG + Intergenic
1074912343 10:117923008-117923030 GTTCACTCAAGTTTCTCTGTGGG + Intergenic
1079634725 11:22722117-22722139 TTTCAGATTAGTTTCTAGGTAGG - Intronic
1083252478 11:61477392-61477414 TTTCACTCCCGGCTCTACGTGGG - Intronic
1085341137 11:75732351-75732373 CTTCCCTCCAGCTTCTAGTTGGG - Intronic
1086781299 11:90909638-90909660 TCTCACTCTATTTTCTAGGATGG - Intergenic
1087148236 11:94833727-94833749 TTTCAGTACAGTTTCTGGGGAGG + Intronic
1090821810 11:130349414-130349436 TCTCACTCAGGTTTCTAGCTTGG - Intergenic
1094457012 12:30646477-30646499 TTGCACTCCAGCTTCTAGCCAGG + Intronic
1096073927 12:48790098-48790120 TTTCACTCCAGGATGTACGTAGG + Intergenic
1096716870 12:53496636-53496658 TATAACAACAGTTTCTAGGTAGG + Intronic
1097519410 12:60648339-60648361 TTTCACTTCTGTTTATAGATGGG - Intergenic
1098319205 12:69223936-69223958 ATTCTCTCCAGATTCTAAGTTGG - Intergenic
1098372956 12:69779659-69779681 TTTCACTGCACATTCTAGCTAGG + Intronic
1098609163 12:72433429-72433451 TTTGACTCTAGTTTATGGGTGGG + Intronic
1100190541 12:92186444-92186466 TTTCTCTTCAGTTTCTGGATTGG + Intergenic
1100708388 12:97227390-97227412 TCTCACCCCATTTTCTAGTTGGG - Intergenic
1103507282 12:121450116-121450138 TTTCACTCTATTGTCTAGGCTGG - Intronic
1105338101 13:19493796-19493818 CTCAACTCCAGTTTGTAGGTAGG + Intronic
1105770092 13:23601229-23601251 TTTCCCTCTAGTTTCTTGGAGGG - Intronic
1106022655 13:25929977-25929999 GTTCTCTCCAGCTTGTAGGTAGG + Intronic
1110226155 13:73121948-73121970 TTTCACTCCTGTTTCCAGGCTGG + Intergenic
1110400551 13:75085790-75085812 TTGCACTGCAGTTTGTATGTAGG + Intergenic
1116159027 14:41243213-41243235 TTGCACTGGAGGTTCTAGGTAGG - Intergenic
1116400214 14:44497325-44497347 TTTCAGTACTGTTTCTAGGTAGG - Intergenic
1119354290 14:73992560-73992582 TGTCGCTCCAGTTACTAGGGAGG + Intronic
1121287796 14:92749806-92749828 TTTCTCTCAAGTTTCTTGGGAGG - Intergenic
1121617195 14:95320580-95320602 TGTGACTCCAGCTTCTAGGAAGG + Intergenic
1125638521 15:41209935-41209957 TTTCACTCTTGTTGCTAGGCTGG + Intronic
1126032403 15:44512164-44512186 TTTCACTCTGTTGTCTAGGTTGG - Intronic
1130028475 15:80290554-80290576 CTTCTCTCAATTTTCTAGGTAGG - Intergenic
1131614735 15:94004533-94004555 TTTCACTCCATTGTCCAGGCTGG + Intergenic
1136332527 16:29589736-29589758 TCTCACTCCAGTGCCCAGGTTGG - Intergenic
1137855606 16:51791532-51791554 CTTCACAGCAGTTTCTAGATTGG - Intergenic
1139274272 16:65713000-65713022 TTTCCCCCCAGTTTCTGGGAGGG + Intergenic
1141491660 16:84378017-84378039 TTGCACTTGAGTTTCAAGGTGGG - Intronic
1145085478 17:19934980-19935002 TTTCACTCCATTGTCCAGGCTGG - Intronic
1146821503 17:35986523-35986545 TTTCCCTGCAGGCTCTAGGTTGG + Intronic
1147291581 17:39447824-39447846 TTTCACTCCAGGGTCTATTTTGG + Exonic
1147345701 17:39792398-39792420 TTTTTCTTCAGTTTCTAAGTAGG - Intronic
1150167427 17:62957293-62957315 TTTCATTACAATTACTAGGTTGG + Intergenic
1150756673 17:67921009-67921031 TTTCACTACATTGTCTAGGCTGG - Intronic
1151256677 17:72882824-72882846 TCTCACTCTAGCTTCCAGGTTGG + Intronic
1151418921 17:73984848-73984870 TTTCATTCCTGGTTCCAGGTTGG - Intergenic
1151682067 17:75627518-75627540 TTTCACTACAGATTCAGGGTGGG + Exonic
1152175393 17:78783381-78783403 TTTTACTCCCGTTTTTTGGTTGG - Intergenic
1152394059 17:80021220-80021242 TTTCACTCTTGTTTCCAGGCTGG - Intronic
1153247437 18:3087025-3087047 TTTCACTACAGTTGCCAGGGTGG - Intronic
1155068006 18:22285338-22285360 TATCATTCCATTTTCTAGGCTGG - Intergenic
1156663283 18:39374527-39374549 TTCCACTCCAGTCTCTTGCTTGG + Intergenic
1159174430 18:64814843-64814865 TCTCACTTCTCTTTCTAGGTGGG + Intergenic
1163651070 19:18518156-18518178 TTTCACTCTTGTTGCTAGGCTGG - Intronic
1163869981 19:19812684-19812706 TTTATCTGCAGATTCTAGGTAGG + Intronic
926860001 2:17299747-17299769 TTTCACTCCAGCTTTTAGCATGG + Intergenic
929010709 2:37441310-37441332 TATCAGTCCAGCTTCTAGGGAGG + Intergenic
929361876 2:41101666-41101688 GGTCACCTCAGTTTCTAGGTGGG - Intergenic
931254218 2:60555828-60555850 TTTCCCTCCAGTTTGTGGGAGGG + Intergenic
931265667 2:60657967-60657989 TATCACACCAGTTTTAAGGTAGG + Intergenic
931312648 2:61096668-61096690 TGTCACTCCAGCTACTAGGGAGG - Intronic
931591901 2:63893531-63893553 TTTCTCTCCATTATTTAGGTTGG - Exonic
932289170 2:70560887-70560909 TTTCACCCATGTTTCTATGTGGG + Intergenic
932633599 2:73368685-73368707 TTACACTCCAATTTCTAACTGGG + Intergenic
932663883 2:73680662-73680684 TTTTACTCCAGTGTCTATGGAGG - Intergenic
932684638 2:73857765-73857787 TTCCACTTCAGTTCCTGGGTAGG - Intronic
933383446 2:81581075-81581097 TTTCTCTACAGTTTTTAGTTTGG - Intergenic
933449420 2:82428011-82428033 TTTCACTTCAGTTTCAAGCCGGG - Intergenic
934619056 2:95793075-95793097 TTTGACCCCAGATTCTAGGCTGG - Intergenic
934641835 2:96031482-96031504 TTTGACCCCAGATTCTAGGCTGG + Intronic
935348489 2:102131959-102131981 TGTCACTGCTGTTTCTTGGTAGG - Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
937887001 2:126906826-126906848 TTTCACTTCTGTTTGTAGTTTGG + Intergenic
938594817 2:132777272-132777294 ATTCACCCCTGTTTCTAGGAAGG + Intronic
939267105 2:139888309-139888331 CATCACTCCAGTTCCTAGGGAGG + Intergenic
939693545 2:145295530-145295552 TTTCACTTCAGATTTTAGTTGGG - Intergenic
940291369 2:152080468-152080490 TTTCTCTCTAGTTTCAGGGTGGG + Intronic
942386869 2:175451953-175451975 TCTTACTCCAGTTTATAGCTTGG + Intergenic
943800413 2:192050593-192050615 TTTAACTTCAGTTTGCAGGTTGG + Intronic
944892167 2:204128645-204128667 TTGCACTACAGATTCGAGGTTGG + Intergenic
946960842 2:224984230-224984252 TCTCTCTCCAGTTTCTAACTGGG - Intronic
948185770 2:236020137-236020159 CATCACCCCAGTTTATAGGTGGG - Intronic
1169181703 20:3574775-3574797 TTTCACCCCACTTTCTGGGTGGG + Intronic
1169546244 20:6653849-6653871 TTTCAATGCAGTTTTTAGGAAGG + Intergenic
1171497309 20:25564876-25564898 TGTCTCTTCAGTTTTTAGGTAGG - Intronic
1173126319 20:40339390-40339412 TTACACTCCAGTTTCCCTGTGGG + Intergenic
1174704811 20:52644508-52644530 TTTATCTCCAGTTTACAGGTTGG - Intergenic
1177326354 21:19594678-19594700 TCTCATTACAGTTTATAGGTAGG + Intergenic
1178253977 21:31033599-31033621 TTTCACTGAAGTTTCAGGGTGGG - Intergenic
1178717876 21:34983201-34983223 TTTCACTGTAGCTTCTAGGAAGG + Intronic
1179812833 21:43883383-43883405 TTTCTCTCCAGTTTACAAGTAGG + Intronic
1181064084 22:20297487-20297509 TGTGACCCCAGTTTCTAGGCTGG - Intergenic
952235576 3:31476183-31476205 TTTCAATCCATTTTTTCGGTAGG + Intergenic
952885666 3:38009798-38009820 TTCCCCTTCAGTTGCTAGGTGGG + Exonic
956307812 3:67845669-67845691 TTTAAATCCATCTTCTAGGTTGG - Intergenic
956357077 3:68405668-68405690 TCTCACTCCATTGCCTAGGTTGG - Intronic
958424092 3:93961745-93961767 TTTCATTCCATTTGCTAGCTAGG + Intronic
960217022 3:115052425-115052447 TCTCACTCCATTACCTAGGTTGG - Intronic
960289327 3:115864300-115864322 TTGCACTCCAGTTCCCAGCTGGG + Intronic
961221610 3:125205404-125205426 TTTCACTCCAGTTTCTAGGTGGG + Intronic
963225527 3:142858039-142858061 TTCCACTCCAATTTCAAAGTTGG + Intronic
965113780 3:164460860-164460882 TTTAAATAGAGTTTCTAGGTTGG - Intergenic
965346406 3:167556448-167556470 TTTCACTCCACTGTCTAAGTAGG - Intronic
965521740 3:169674925-169674947 TTTCACTCTTGTTTCCAGGCTGG + Intergenic
965901848 3:173651151-173651173 TTTAGCTCCCATTTCTAGGTGGG + Intronic
968284010 3:197497659-197497681 TTTCATTCCCGTCTCTAGCTGGG + Intergenic
968658952 4:1791147-1791169 TTGCTCTCCAGCTTCTGGGTGGG - Intergenic
969589207 4:8111983-8112005 TTTCACTGCAGTTTCAAGATTGG + Intronic
970428850 4:15969970-15969992 TTTCACTACATTTTCCAAGTTGG + Intronic
970849025 4:20579459-20579481 ATTCAGCCCAGTTTCTAGGCCGG + Intronic
971706589 4:30051138-30051160 TATAACCCCAGTTTCTAGGAAGG + Intergenic
977083682 4:92566861-92566883 TTTCACTGCAGTGGTTAGGTAGG + Intronic
979640839 4:123011855-123011877 TTTCTCTCCACTTTCCAGGGGGG - Intronic
980957165 4:139441037-139441059 TTTTCCCCCAGTTGCTAGGTTGG + Intergenic
981973306 4:150692246-150692268 TTTCACTCTATTGTCTAGGCTGG + Intronic
982034805 4:151335147-151335169 TTTCACCCCATCTGCTAGGTTGG - Intergenic
983370629 4:166853000-166853022 TTTAACCTCAGTTTCTAGGCTGG + Intronic
983898915 4:173112555-173112577 TTTCACTCAATTCTCTTGGTAGG - Intergenic
984190258 4:176596881-176596903 TTTCTCTCTAGTTCTTAGGTGGG + Intergenic
984799309 4:183698850-183698872 TTTCTCTGCAGTTTCCAGCTTGG - Intronic
986249070 5:6039457-6039479 TTTCACTGCAGTTTCCTGTTAGG - Intergenic
989850548 5:46203876-46203898 TTTCTTTGCAGTTTCTGGGTAGG + Intergenic
992374527 5:76175168-76175190 TTTAAGTCCAGTTTCCATGTTGG + Intronic
992705734 5:79390088-79390110 TTTCACTCTAGTGCCTAGGCTGG - Intronic
995346328 5:111123077-111123099 TTTCACTCCATTGCCTAGGCTGG - Intronic
995850536 5:116540756-116540778 TTTCACTCCAGTGTCTTCCTTGG + Intronic
996302659 5:122007532-122007554 TTGCACACCAGCTTCTAGGCTGG - Intronic
996477324 5:123936642-123936664 TCTCACTTCTGTTTCTAGCTGGG - Intergenic
996782200 5:127199443-127199465 TTGCATTCCATTTTCTTGGTAGG - Intergenic
997310529 5:132876455-132876477 TATCACTAGAGTTTCTGGGTGGG + Exonic
997639494 5:135439466-135439488 TTCCCCTCCAGCTTCTGGGTAGG - Intergenic
998229808 5:140353736-140353758 TTTCACTCCATTGCCTAGGCTGG + Intergenic
998619099 5:143774700-143774722 TTTCACTCCCTTTTCTAAGGAGG - Intergenic
998648794 5:144093915-144093937 TTTCAAATCATTTTCTAGGTGGG + Intergenic
998707147 5:144775471-144775493 TTTCATTATAGTTTCTAGCTTGG - Intergenic
1000023443 5:157338715-157338737 TTGCTTTCCAGTTTCTATGTTGG - Intronic
1002333609 5:178462858-178462880 TTTCACACCAGTTTCCATTTTGG - Intronic
1004014774 6:11722402-11722424 TTTCACACCAGTTCATAGATTGG + Intronic
1004309282 6:14530171-14530193 TTTCACTCTTGTTTCCAGGCTGG + Intergenic
1004331353 6:14724831-14724853 GTTCACTCCAGATTCTATGGTGG + Intergenic
1006845444 6:37058209-37058231 TCTGACTCCAGTGTCTATGTTGG + Intergenic
1007199607 6:40095699-40095721 TTTCACTGCAGGTCCTAAGTTGG - Intergenic
1007257579 6:40539591-40539613 TGTCATTCAAGTTTCAAGGTGGG + Intronic
1007805146 6:44438141-44438163 TTTCACTCTATTGTCCAGGTTGG + Intronic
1008927019 6:56897751-56897773 TTGCCCTCCAGCTTCTAGGTAGG + Intronic
1008937455 6:57007256-57007278 TCTCACTCCATCTTCTAGGCTGG - Intronic
1010100846 6:72106563-72106585 TATCACAGAAGTTTCTAGGTAGG + Intronic
1011912467 6:92458164-92458186 TTTCTCTCCAGTTTGTAGAAAGG - Intergenic
1017237113 6:152128073-152128095 TTTCACTCCAATTTCCAGCAAGG - Intronic
1018193274 6:161330129-161330151 TTTTTCTCCTGTTTCTAGGATGG + Intergenic
1018777169 6:167028243-167028265 TTTCCCTCCTGTTTCTGAGTGGG + Intronic
1021869141 7:24986420-24986442 CTTCACTCCAGTTTGTAGGGTGG - Intergenic
1027907841 7:84209138-84209160 TTTCATTCCAGATTCTATGCAGG - Intronic
1029692890 7:102194228-102194250 TTTCACTTCAGTTACCAGTTTGG - Intronic
1033083610 7:138321430-138321452 TTTCACTCTATTGTCCAGGTTGG - Intergenic
1033465229 7:141583437-141583459 TTTCTCTCCACTTTCTTGGGAGG - Intronic
1037204378 8:16296536-16296558 TCTCACTCCAGTCTCTAGGTAGG - Intronic
1039062402 8:33582033-33582055 TCTCACTCCATTGTCCAGGTTGG + Intergenic
1039686063 8:39802485-39802507 ATTCAGTTCAGTTTATAGGTGGG - Intronic
1041941637 8:63394634-63394656 TTTCACCTCAGCTTCTTGGTGGG - Intergenic
1042895478 8:73662644-73662666 TTTCACTCCTGTTGCCAGGCTGG + Intronic
1043588877 8:81803848-81803870 TCTCAATCTGGTTTCTAGGTGGG + Intronic
1043812877 8:84764465-84764487 TTTCACTTCAGTTTCTATTAGGG + Intronic
1044583148 8:93842681-93842703 TCTCACTCCATTTCCCAGGTGGG + Intergenic
1046380640 8:113445363-113445385 TTTCACTCCATCTCCCAGGTTGG - Intergenic
1049029127 8:140020594-140020616 TCTCACTCCATTGTCCAGGTGGG - Intronic
1052550137 9:29937874-29937896 TTTGTCTTCAGTTACTAGGTGGG + Intergenic
1052745818 9:32440236-32440258 TTTCACTCTATTGTCTAGGCTGG - Intronic
1055472586 9:76627932-76627954 TTTCCTTCCAGTTTCTAGGCTGG + Intronic
1055764365 9:79645603-79645625 TTTCCCTGCAGTTTCAAGTTTGG - Intronic
1056859617 9:90168096-90168118 TGACACTCCAGTTTCTGGCTAGG - Intergenic
1059512661 9:114864157-114864179 TTTCACTCTTGTTGCCAGGTTGG + Intergenic
1059653884 9:116339598-116339620 TTTCCCTCCATTTTCTAGTGTGG + Intronic
1186421334 X:9429345-9429367 TTCCCCTCCAGCTTCTAGTTGGG - Intergenic
1192540910 X:71972062-71972084 TTTCACTCTTGTTTCCAGGCTGG + Intergenic
1192598375 X:72436018-72436040 TTTCTCTCCATTGTCTAGATTGG - Intronic
1192705968 X:73528798-73528820 TTTCTCTCCACTTTCCAGGGGGG + Intergenic
1192817030 X:74604659-74604681 TTTGTCTCTAGTTTCTATGTAGG - Intronic
1197852333 X:130876256-130876278 TTTCACTCCATTTTATGGTTGGG - Intronic
1202590663 Y:26479893-26479915 TCTCACTCCGTTTTCCAGGTTGG - Intergenic