ID: 961226325

View in Genome Browser
Species Human (GRCh38)
Location 3:125251518-125251540
Sequence ATTAGGATAGTGATCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961226325_961226328 20 Left 961226325 3:125251518-125251540 CCATCAGTGATCACTATCCTAAT 0: 1
1: 0
2: 1
3: 19
4: 173
Right 961226328 3:125251561-125251583 CCTTATGAACTTCACATGAATGG 0: 1
1: 0
2: 2
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961226325 Original CRISPR ATTAGGATAGTGATCACTGA TGG (reversed) Intronic
906192502 1:43906723-43906745 ATAATGATAGTGATGACAGAAGG - Intronic
906462609 1:46047650-46047672 GTTAGGATAGTCCTCCCTGAGGG - Intronic
907537820 1:55180976-55180998 ATTAGCATGGTGAGAACTGAAGG - Intronic
907802098 1:57779168-57779190 ATTAGGATAGTCTTCTCTGGGGG + Intronic
909779243 1:79521841-79521863 ATTGAGATAATGAGCACTGATGG + Intergenic
912131739 1:106611265-106611287 ATCAGGGTGGTGATCGCTGAAGG + Intergenic
916249965 1:162728444-162728466 GTGAGGATAGTGATTATTGAGGG + Intronic
919335791 1:196231058-196231080 ATTGGGGTAGTGGTTACTGAAGG - Intronic
921157998 1:212453096-212453118 ATTTGGAGAGTGAGCAGTGAGGG - Intergenic
921276064 1:213521441-213521463 ATCAGGATGGTGATTGCTGATGG + Intergenic
921402457 1:214740883-214740905 ATGAGGATGGTGATTGCTGAAGG + Intergenic
1064837440 10:19549450-19549472 ATTAGGGTGGTGATTGCTGAAGG - Intronic
1066130288 10:32386512-32386534 ATTGAGAGAGTGAACACTGATGG - Intergenic
1069005349 10:63311758-63311780 ATTTAGACAGTGATTACTGATGG + Intronic
1074219787 10:111425260-111425282 ATTAAGATAGTCATCAATTAAGG - Intergenic
1074982051 10:118627513-118627535 ATTAGCACAGTGAGCACTCATGG + Intergenic
1075431664 10:122388787-122388809 ATTAGGATAGTGGTTGCTGAAGG + Intronic
1078093352 11:8281454-8281476 ATTTGGCTAGGGACCACTGAGGG + Intergenic
1081828650 11:46085406-46085428 ATTAGAGCAGTGATGACTGAGGG - Intronic
1082956722 11:58877690-58877712 AATAACATAGAGATCACTGATGG + Intronic
1082972705 11:59040500-59040522 AATAACATAGAGATCACTGATGG + Intronic
1082977163 11:59084397-59084419 AATAACATAGAGATCACTGATGG + Intergenic
1083135315 11:60668913-60668935 ATTAGGGTGGTGTTTACTGAAGG - Intergenic
1087064758 11:94017614-94017636 ATCAGGATGGTGGTCACTGAAGG - Intergenic
1090230139 11:125096596-125096618 AGTTGGAAAGAGATCACTGATGG - Exonic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1092014595 12:5148100-5148122 ATTAGGAATGTGTTGACTGAAGG - Intergenic
1095763968 12:45873868-45873890 ATCAGGATAGTGGTTGCTGAAGG + Intronic
1095767388 12:45911918-45911940 ATTCAGATAGTGGTTACTGATGG - Intergenic
1096130226 12:49153008-49153030 ATCAGGGTAGTGATTGCTGAAGG - Intergenic
1096586072 12:52620757-52620779 ATTAGGAAAGTGATCAGAGAAGG - Intergenic
1097554789 12:61123103-61123125 ATTTTGCTAGTGATCACTAAGGG - Intergenic
1098485338 12:71014904-71014926 ATAAGGACAGTGATCATTGAGGG + Intergenic
1099307024 12:80970355-80970377 ATTAGGCCATTGATCAGTGATGG + Intronic
1099592723 12:84616364-84616386 ATTAGGATTGTGGTTGCTGAAGG - Intergenic
1100759878 12:97795678-97795700 ATTATGAAAGTGATAAATGAAGG + Intergenic
1107543397 13:41414248-41414270 ATTAGGATGGTCATCTTTGAGGG + Intergenic
1108844875 13:54665892-54665914 ATCAGGATGGTGATTGCTGAAGG + Intergenic
1110829662 13:80016313-80016335 ATCAGGATAGTGGTTGCTGAAGG - Intergenic
1111675010 13:91376230-91376252 ATCCTGATATTGATCACTGATGG - Intergenic
1111834095 13:93365709-93365731 AGTGGGAAAGTGATCTCTGAAGG + Intronic
1113874995 13:113588663-113588685 GTGAGGAGAGTGATCAGTGATGG + Intronic
1114886054 14:26852900-26852922 ATCAGGGTAGTGATTGCTGAAGG + Intergenic
1115362951 14:32524264-32524286 ATCAGGATAGTGGTCACTTTTGG + Intronic
1115462922 14:33682195-33682217 ACTACCATAGTGATCTCTGATGG + Intronic
1116277177 14:42850310-42850332 ATTAGGATGGTGGTTGCTGAGGG + Intergenic
1117269702 14:54130287-54130309 ATCAGGATAGTAGTTACTGAAGG - Intergenic
1117926651 14:60787462-60787484 ATCAGGATGGTGATTGCTGAAGG + Intronic
1125099431 15:35893765-35893787 ATAAGGGTAGTGATTGCTGAAGG + Intergenic
1125822523 15:42644630-42644652 ATCAGGATAGTGATTGCTGAAGG + Intronic
1125886623 15:43234466-43234488 ATAAGGAAAGTGAGCACAGATGG - Intronic
1127307909 15:57726174-57726196 ATCAGGGTTGTGATCGCTGAAGG - Intronic
1130318407 15:82817114-82817136 ATCAGGGTGGTGGTCACTGAAGG + Intronic
1135939190 16:26806147-26806169 ATTAGAAAGGTGATCACAGAAGG - Intergenic
1138668565 16:58594344-58594366 AATAGAATAGTGGTCACTAAGGG + Intronic
1140252611 16:73307388-73307410 ATGAGGATAGTGAGCACTGAAGG + Intergenic
1142503073 17:344808-344830 ATGAGAATAGTGATGACTGATGG - Intronic
1144761311 17:17709130-17709152 ATTATGACAATGATGACTGATGG + Intronic
1146359984 17:32166384-32166406 ATTAGGGTGGTGATTCCTGAAGG + Intronic
1147231341 17:39020900-39020922 ATTAGGGTAGTGGTTGCTGAAGG - Intergenic
1150198997 17:63333784-63333806 ATTAGGGTGGTGATTGCTGAAGG - Intronic
1150780901 17:68121291-68121313 ATTATGATAGCCATCACTGTGGG - Intergenic
1153121855 18:1738339-1738361 ATAAGGAAAATGGTCACTGATGG - Intergenic
1156102495 18:33614019-33614041 ATCAGGATAGTGGTTGCTGAAGG + Intronic
1156127117 18:33919473-33919495 ATTATGGAAGTGACCACTGAAGG - Intronic
1156321118 18:36023699-36023721 ATTAGGGTGGTGATTGCTGAAGG - Intronic
1156692878 18:39729494-39729516 ATTAGGAAAATGAACCCTGAAGG - Intergenic
1157193930 18:45605041-45605063 ATTATGATGATGATCACTGCGGG - Intronic
1158156697 18:54433740-54433762 ATTAGAATAGGAATCACTGAAGG - Intergenic
1159186019 18:64975430-64975452 CTTAGGGTGGTGGTCACTGAAGG + Intergenic
1159656993 18:71042029-71042051 ATTAGGGTAGTGGTTGCTGAAGG - Intergenic
1159883884 18:73885913-73885935 AGTAGAATAGTGATCACTAGGGG - Intergenic
1160313242 18:77817429-77817451 ATTAGGATGGTGGTCCCTAAGGG - Intergenic
1161184656 19:2908790-2908812 AATAGGAGAGTGATAACTGAAGG - Intronic
1164490069 19:28702190-28702212 ATCAGGATAGTGGTTGCTGAAGG + Intergenic
1165803773 19:38568120-38568142 ATAAGGATAGTGAGCAGGGAAGG - Intronic
925547150 2:5029123-5029145 GCTAGGATAATGATCAGTGATGG + Intergenic
927580779 2:24244544-24244566 CTTTGGCTAGTGATCCCTGAAGG - Intronic
928351857 2:30564975-30564997 ATTAAAATAGTGTTCACTTATGG - Intronic
929866976 2:45726393-45726415 ATCAGGGTAGTGATTGCTGAAGG - Intronic
930570667 2:53082205-53082227 AATAGAATAGTGATTACCGAAGG + Intergenic
930969286 2:57375139-57375161 AGTAGAAAAGTGATCCCTGATGG + Intergenic
931017302 2:57998087-57998109 ATTAGGGAAGTAATAACTGAAGG + Intronic
932071541 2:68625695-68625717 ATTAGGAGAGAGATGACTAAAGG - Intronic
935156677 2:100489169-100489191 ATAAGAAAAGTGATCACTAAAGG - Intergenic
936798684 2:116239693-116239715 ATGAGGATAGTTTTTACTGAAGG - Intergenic
937678213 2:124615132-124615154 ATTAGGATGGTGGTTGCTGAAGG + Intronic
938799186 2:134745029-134745051 GTGAGGATAGTGAGAACTGATGG + Intergenic
939907304 2:147932580-147932602 ATGAGGATAGTGGTGAGTGAAGG + Exonic
940443356 2:153746285-153746307 ATTAGGATAGTGGTAACTTTTGG - Intergenic
941122365 2:161545647-161545669 TTCAGGATAGTGGTAACTGAGGG + Intronic
942861039 2:180612547-180612569 ATTAAGGTAGTTACCACTGAAGG + Intergenic
943087693 2:183332950-183332972 ATCAGGATGGTGGTTACTGAAGG - Intergenic
943246889 2:185465643-185465665 ATTAGGGTGGTGATTGCTGAAGG + Intergenic
944916597 2:204367227-204367249 AATAGGAAAATGATCACTCAAGG - Intergenic
945651991 2:212573926-212573948 ATTAGGCTGCTGATTACTGAAGG + Intergenic
947139770 2:227010216-227010238 ATAAGGTTAGTGATCATTTAAGG + Intronic
947522441 2:230857736-230857758 ATTAGGATAGTGGTTACTCATGG + Intergenic
1174527541 20:51185580-51185602 ATTAATGAAGTGATCACTGAGGG - Intergenic
1178798818 21:35772670-35772692 ATCAAGATAATAATCACTGAAGG + Intronic
1179395286 21:41034083-41034105 ATCAGGTTGGTGGTCACTGAAGG + Intergenic
1180051467 21:45333427-45333449 ATGTGGACAGTGATGACTGATGG - Intergenic
1181784110 22:25213785-25213807 ATTTGGAAAGTGATCCCAGAGGG - Intergenic
1182075721 22:27494233-27494255 ATGAGGAGAGTGATGCCTGAGGG + Intergenic
1182605548 22:31500326-31500348 ATCAGGGTAGTGATTGCTGAAGG - Intronic
1182893434 22:33838652-33838674 ATTAGGATAGAAATCGCTAAAGG - Intronic
949833117 3:8238008-8238030 ATTAGGAATGTGATTACTTAAGG + Intergenic
955111528 3:55955409-55955431 ATTAGAGTAGTGATCACTTCTGG - Intronic
956960803 3:74398297-74398319 ATCAGGGTGGTGATCACGGAAGG - Intronic
959281005 3:104340142-104340164 ATCAGGATTGTGATTGCTGAAGG + Intergenic
959600181 3:108173288-108173310 TTGAGGATAGTGATTACTGTGGG + Intronic
960222282 3:115128009-115128031 ATTGGGACAGTGATCACTGGTGG + Intronic
961092313 3:124124675-124124697 ATCAGGATAGTGGTTGCTGAAGG - Intronic
961226325 3:125251518-125251540 ATTAGGATAGTGATCACTGATGG - Intronic
961980600 3:131074064-131074086 ATCAAGACAGTTATCACTGAGGG - Intronic
963376563 3:144473627-144473649 ATTAGGGTCGTGAGCACTGTTGG + Intergenic
965235778 3:166119716-166119738 ATTAGGGTAGTGGTTACTGAAGG - Intergenic
965407535 3:168288761-168288783 AGTATCGTAGTGATCACTGAGGG + Intergenic
965860539 3:173144424-173144446 ATCAGGATGGTGATTGCTGATGG + Intergenic
970255484 4:14165180-14165202 ATTAGGATGGTCAGAACTGAAGG - Intergenic
971188786 4:24406931-24406953 AAGAGGATACTGATCCCTGAGGG - Intergenic
971646378 4:29210523-29210545 ATTAAAATAATAATCACTGAAGG - Intergenic
974162722 4:58160826-58160848 ATTAGAAAGGTGATTACTGATGG - Intergenic
976310701 4:83609201-83609223 AGTAGAATAGTGATTACTAAAGG - Intergenic
976433118 4:84986697-84986719 ATCAGGGTAGTGATTGCTGAAGG - Intergenic
977224723 4:94381976-94381998 ATCAGGGTGGTGGTCACTGAAGG + Intergenic
977238992 4:94543596-94543618 AATAGAATGGTGGTCACTGATGG - Intronic
981305267 4:143240552-143240574 ATTAGACTAGTCCTCACTGATGG + Intergenic
981815032 4:148820856-148820878 ATTAGTTTAGTGCTCAGTGATGG + Intergenic
982118409 4:152116556-152116578 ATTTGGAGAGTGAACACTGGAGG - Intergenic
984198086 4:176684343-176684365 ATTCTGAAAGTGAACACTGAAGG + Intronic
992538289 5:77734855-77734877 ATTAGGATGGTGGTTGCTGAAGG - Intronic
993318835 5:86446547-86446569 ATCAGGGTAGTGATTGCTGAAGG + Intergenic
994458226 5:100041794-100041816 CTTAGGACAGGTATCACTGAGGG + Intergenic
996673327 5:126145388-126145410 ATTAGGGTAGTGGTTGCTGAAGG - Intergenic
997317944 5:132953629-132953651 ATTAGGATGAGGATCACTGGAGG - Intronic
999902051 5:156095346-156095368 ATTTTGATAGAGATAACTGAAGG + Intronic
999948700 5:156625602-156625624 AGTGGGTTTGTGATCACTGAAGG - Intronic
1000923153 5:167162229-167162251 TCTAAGATAGTGATCACTGATGG + Intergenic
1000925197 5:167185571-167185593 TCTATGATAGTGATCGCTGATGG - Intergenic
1003320281 6:5045018-5045040 ACAAGGATGATGATCACTGAAGG - Intergenic
1005046108 6:21644018-21644040 ATCAGGGTAGTGATTGCTGAAGG - Intergenic
1006778268 6:36613749-36613771 ATCAGGATTGTGGTCGCTGAAGG - Intergenic
1009454434 6:63839233-63839255 AGTAGAATAGTGATTACTAAAGG - Intronic
1011096081 6:83664905-83664927 ATTAGGATGGTGGTTGCTGAAGG - Intronic
1011391435 6:86858228-86858250 AGTAGAATGGTGATTACTGAAGG - Intergenic
1011558100 6:88589620-88589642 ATCAGGATGGTGATCAGAGAAGG - Intergenic
1011911657 6:92448528-92448550 ATTAAGATAGTAATCACCAATGG + Intergenic
1012053549 6:94374917-94374939 ATGAGGATAGGAAGCACTGATGG - Intergenic
1013203057 6:107919976-107919998 ATCAGGATAGTGGTTACTGAAGG - Intronic
1013573519 6:111454568-111454590 AATAGAATAGTGTTTACTGAGGG - Intronic
1014210797 6:118705989-118706011 ATTAGCACAGTGCTCACTGTGGG - Intronic
1014678703 6:124400820-124400842 ATTAGGAGAGTGAGCATGGAAGG - Intronic
1015233845 6:130947896-130947918 ATTAGGATATTGATGAATTATGG + Intronic
1015746224 6:136512788-136512810 ATAAGGATAGTAGTCACTGAAGG + Intronic
1016635139 6:146280207-146280229 ATTTGGATAATGATCCCTGGTGG + Intronic
1016662252 6:146595336-146595358 CATAGGGTTGTGATCACTGAAGG + Intergenic
1019061646 6:169261732-169261754 ATTAAGGTAGTTAACACTGAAGG - Intergenic
1024786026 7:52908821-52908843 ATTAGGGCAGTGATTGCTGAAGG + Intergenic
1028667959 7:93368781-93368803 ATCAGAATAGTGATTGCTGAAGG - Intergenic
1030925258 7:115444307-115444329 ATAAAGATATTGATCACTTAAGG + Intergenic
1032637378 7:133724691-133724713 ATTAAGAAAGGGATCTCTGAAGG + Intronic
1037032290 8:14123747-14123769 ATTAGGATGGAGACCATTGAGGG - Intronic
1037096963 8:14997249-14997271 ATTAGGATTGTAATCAATTATGG + Intronic
1037327694 8:17710141-17710163 ATTAGGGTAGTGGTTGCTGAAGG + Intronic
1037826023 8:22161170-22161192 ATTAGGAAAATAATCACTGGGGG + Intronic
1038130482 8:24725280-24725302 ATTAGGGTTGTGATTGCTGAAGG - Intergenic
1038352502 8:26790426-26790448 ATTAGAATAGTGGTTACTGAAGG + Intronic
1040732225 8:50462425-50462447 ATTAGAGTAGTGGTTACTGAAGG + Intronic
1041055622 8:53983044-53983066 ATTAGGGTAGTGGTTATTGAAGG - Intronic
1041180363 8:55241269-55241291 ATGAGGATAGGGATCTATGAGGG - Intronic
1042045200 8:64643520-64643542 ATTAGGGTGGTGATTACTGAAGG + Intronic
1042697910 8:71578271-71578293 CTAAGGACAGTGATCCCTGATGG - Intronic
1043600776 8:81935306-81935328 ATTTGAAGAGTGATCACTGTTGG - Intergenic
1043862816 8:85340782-85340804 ATCAGGATAGTGGTTGCTGAAGG - Intronic
1043923118 8:86006374-86006396 ATTAGGACAGTGAAGACAGAAGG - Intronic
1045465385 8:102464731-102464753 ATTAGGGTGGTGGTTACTGAAGG + Intergenic
1046444328 8:114296989-114297011 ATTAGGATATTCATCATTGCTGG - Intergenic
1047322466 8:123800644-123800666 AATAGAAGAGTGATCACTAAAGG - Intronic
1048605113 8:135960056-135960078 ATCAGGGTAGTGATTGCTGAAGG - Intergenic
1051329976 9:16013946-16013968 ATCATGATGGTGATTACTGAAGG + Intronic
1055295364 9:74827684-74827706 ACTAGGAGAGTGAGCTCTGATGG + Intronic
1055547319 9:77392898-77392920 ATTAGGATAGGGATTGCTGAAGG + Intronic
1059798159 9:117722330-117722352 ATTGGGGAAGTGATCACTGACGG + Intergenic
1060147155 9:121262890-121262912 ATGAGGAAAGTGACCACAGATGG - Intronic
1185865562 X:3620760-3620782 AATAGCACAGTGATAACTGAAGG + Intronic
1189631389 X:42957590-42957612 ATTAGGAAAATGACGACTGAAGG + Intergenic
1191672689 X:63763290-63763312 ATTAAGTTTGTGATCTCTGATGG + Intronic
1192084412 X:68081751-68081773 ATCAGGATGGTGCTTACTGAAGG + Intronic
1193867152 X:86747719-86747741 ATCAGGGTGGTGGTCACTGAAGG + Intronic
1194588985 X:95772997-95773019 ATTAGGGTGGTGATTACTGAAGG - Intergenic
1197386148 X:125804981-125805003 ATCAGGGTGGTGATTACTGAAGG - Intergenic
1200798139 Y:7360715-7360737 ATTAGAACAGTGATAGCTGAAGG - Intergenic
1201735473 Y:17256113-17256135 AATAGGATGGTGAAAACTGAGGG - Intergenic