ID: 961235072

View in Genome Browser
Species Human (GRCh38)
Location 3:125359185-125359207
Sequence CTGGAGACTCAGAGTGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961235072_961235077 30 Left 961235072 3:125359185-125359207 CCTTCAACACTCTGAGTCTCCAG 0: 1
1: 0
2: 5
3: 34
4: 308
Right 961235077 3:125359238-125359260 ACAGATGTAGAAGTTAAGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 323
961235072_961235075 3 Left 961235072 3:125359185-125359207 CCTTCAACACTCTGAGTCTCCAG 0: 1
1: 0
2: 5
3: 34
4: 308
Right 961235075 3:125359211-125359233 TCTTTCATTATTAAATTTGGTGG 0: 1
1: 0
2: 1
3: 46
4: 641
961235072_961235076 26 Left 961235072 3:125359185-125359207 CCTTCAACACTCTGAGTCTCCAG 0: 1
1: 0
2: 5
3: 34
4: 308
Right 961235076 3:125359234-125359256 CTAAACAGATGTAGAAGTTAAGG 0: 1
1: 0
2: 1
3: 22
4: 216
961235072_961235074 0 Left 961235072 3:125359185-125359207 CCTTCAACACTCTGAGTCTCCAG 0: 1
1: 0
2: 5
3: 34
4: 308
Right 961235074 3:125359208-125359230 AGATCTTTCATTATTAAATTTGG 0: 1
1: 0
2: 2
3: 39
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961235072 Original CRISPR CTGGAGACTCAGAGTGTTGA AGG (reversed) Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
901781617 1:11598228-11598250 CTGGAGTCCCACAGTGTTGAAGG + Intergenic
904398969 1:30243370-30243392 CCTGAGACTCAGAGAGGTGAGGG + Intergenic
904990990 1:34592448-34592470 ATGGATACTCAGAGTGGTGAGGG - Intergenic
905235417 1:36542911-36542933 CTGGAGGCTGTGAGTGGTGATGG + Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906789516 1:48646267-48646289 AAGGAGGCTCAGAGTGATGACGG + Intronic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
909317804 1:74246471-74246493 CTGGAAACTGAGAATGTTGATGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915600996 1:156923309-156923331 CTTGAGACTCTGAGTCTTCAAGG - Intronic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916983627 1:170166891-170166913 CTGGAGGATCAGAGTTTTGTGGG - Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
920955087 1:210612253-210612275 CTGGAGATTGAGGGTGGTGATGG - Intronic
921536262 1:216352306-216352328 CTAGAAACTCAGAGAGATGATGG + Intronic
921951511 1:220934917-220934939 CTGGAGACTCAGCTCGTTTAAGG + Intergenic
923220655 1:231889603-231889625 CTGGAGACCCTGAGAGGTGAAGG + Intronic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923737345 1:236623291-236623313 CTGGAGGCTCTCAGTTTTGATGG - Intergenic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
923822014 1:237455225-237455247 TTGGAGACTACGAGGGTTGATGG + Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1064921226 10:20521029-20521051 CCGGAGACTCAAAATGTTGAGGG + Intergenic
1065008759 10:21403108-21403130 CATGGGACTGAGAGTGTTGAAGG - Intergenic
1067824565 10:49560865-49560887 CTGAAGACCCAGAGAGTTCAGGG - Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068046635 10:51894455-51894477 CTGGAGACAGACAGTGGTGATGG + Intronic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069550811 10:69362748-69362770 CTGGAGCCTCCGAGTGCAGATGG + Intronic
1071576124 10:86727962-86727984 CTAGAAAATCAGAGTGTTAAGGG - Intronic
1071619449 10:87105840-87105862 CTGGGGTCTAAGAGAGTTGAAGG - Intronic
1073081377 10:100863110-100863132 CATGGGAGTCAGAGTGTTGAGGG + Intergenic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076715971 10:132363875-132363897 CTGGAGGCTGACAGTGTTTAGGG + Intronic
1076832985 10:133006258-133006280 CTGGAGACACAGGGTTTTGTGGG + Intergenic
1077826577 11:5816236-5816258 CTGGAGATGGAGAGTGGTGATGG + Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1080462948 11:32471633-32471655 GTGGAGACTCAGAGGGTTTTAGG + Intergenic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080688754 11:34537890-34537912 CTGGGGACTCAGGGAGTTGTTGG + Intergenic
1081248059 11:40794471-40794493 ATGGAGAATCAGAGATTTGATGG - Intronic
1082094719 11:48120174-48120196 CTTGAGACTGAGAGGTTTGAAGG + Intronic
1082183830 11:49154960-49154982 CTGGAGAGTCTGAGTGGTGAGGG + Intronic
1082616609 11:55368640-55368662 CTTAAGACTCAGAGTTTGGAAGG + Exonic
1082626391 11:55491870-55491892 CTTAAGACTCAGAGTTTGGAAGG + Intergenic
1082784092 11:57307370-57307392 CTGACGACTCAGGCTGTTGACGG - Intronic
1082799864 11:57406556-57406578 CTAGTGACTCAGAGTGGTTAAGG + Intronic
1083169452 11:60914359-60914381 CTGGAGAGTCCGAGTGGGGAGGG + Intronic
1083224974 11:61279233-61279255 CTCAAGACTCAGCGTGTTGCGGG + Intronic
1083862755 11:65432846-65432868 CTAGAGACTCAAAGTGGGGAGGG - Intergenic
1084547301 11:69820801-69820823 CTGGAGCCTCAGACTCTTGATGG + Intergenic
1085705198 11:78780866-78780888 CTGAAAACTCACAGTGCTGATGG - Intronic
1086682526 11:89690389-89690411 CTGGAGAGTCTGAGTGGTGAGGG - Intergenic
1086806835 11:91254350-91254372 CTGGAGATAGAGAGTGATGATGG - Intergenic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1091821155 12:3476101-3476123 CTGGAAACTCAGTGTTTAGAGGG - Intronic
1092207519 12:6624355-6624377 CTGGAAACAGAGAGTGGTGACGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1096628903 12:52912833-52912855 GTGGACACTCAGAGAGCTGATGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1098552683 12:71780964-71780986 CTGGACACCCAGAGTGCTAAAGG - Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1100354316 12:93814691-93814713 CTGGAGGCTCAGAGAGTTGGTGG - Intronic
1100867040 12:98868146-98868168 CTGGACACTCAGAGTCTAGAAGG + Intronic
1101242117 12:102848910-102848932 CTGGAGAGGCTGAGTGTAGACGG + Intronic
1101270383 12:103137397-103137419 AGGGGAACTCAGAGTGTTGATGG + Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1103932813 12:124459537-124459559 CAGGAGACTCAGATTGCTGAGGG - Intronic
1104583629 12:130029568-130029590 TTGCAGACTCAGAGTGGTGTGGG - Intergenic
1108059578 13:46519262-46519284 CTCGAGACTTAGAGATTTGAAGG + Intergenic
1108278229 13:48833459-48833481 CTGAAGGCTCAGATTGTTGTTGG + Intergenic
1108432726 13:50370551-50370573 CTGGAGACGTATAGTGGTGATGG + Intronic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111343753 13:86922854-86922876 CTGGAGCCTCAGAGCTTAGATGG - Intergenic
1111442233 13:88294971-88294993 TTGGAGGCTCAGGGTGTTTAGGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1113335577 13:109373057-109373079 CTGTAGGCTCAGAGGGTTGGAGG + Intergenic
1113668806 13:112160987-112161009 ATGGAGAGTCAGAGAGCTGAAGG - Intergenic
1113703364 13:112406174-112406196 CTGGAGACACATGGTGGTGATGG - Intronic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1116354567 14:43912658-43912680 CAGGAGAGACAGAGTGTTGCGGG - Intergenic
1118231383 14:63953676-63953698 CTGGTGACAGAGAGTGGTGATGG - Intronic
1118383960 14:65239804-65239826 CTGGAAGCTCAGAGGGTTGTCGG - Intergenic
1118820581 14:69342862-69342884 CTGCAAACTCAGAGTGTTCAGGG - Intronic
1118906243 14:70025496-70025518 CTGGAGACTCAGAGTACTATGGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119986877 14:79148219-79148241 CTGGAAGCTCAGAGGGTTCATGG + Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120789020 14:88562558-88562580 CTGCAGAGTCAAAGAGTTGACGG + Intergenic
1120929233 14:89831647-89831669 CTGGAGAATGAGAATGGTGAAGG + Intronic
1121323333 14:93005552-93005574 ATGGAGTCACAGAGTGTTGGAGG - Intronic
1122477349 14:102019986-102020008 CTGGAGACCCTGCCTGTTGAAGG + Exonic
1122532269 14:102436754-102436776 CCTGAGCCTCAGAGTCTTGAGGG + Intronic
1122880170 14:104687269-104687291 CTGGAGGTACAGAGGGTTGAGGG + Intergenic
1125710353 15:41780337-41780359 CTTCAGACTCAGAGGGTTGGTGG - Intronic
1127077320 15:55339848-55339870 CTGGTGACTCAGGGTGGGGAAGG + Intronic
1128063409 15:64749187-64749209 CGGGGGACCCAGAGTGTTAATGG + Intronic
1130101354 15:80896648-80896670 CTGGAATCACAGATTGTTGAAGG + Intronic
1130361790 15:83194461-83194483 CTGGAGATAGAGAGTGGTGATGG + Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1139370454 16:66465586-66465608 CTGGAGATGGATAGTGTTGATGG - Intronic
1139407654 16:66731796-66731818 CTGGAGAATCATAGTGTTGCTGG - Intronic
1139460000 16:67114152-67114174 CTGAAGGCTCACTGTGTTGAAGG + Intronic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142808779 17:2385670-2385692 CGGGAGAAGCAGGGTGTTGAGGG + Exonic
1143148367 17:4790672-4790694 CTGGAGACTCAGCGTGTGTTTGG - Intergenic
1143580458 17:7822536-7822558 AGGGAGACTGAGAGTGTTGAGGG - Intronic
1144708907 17:17387761-17387783 CTGGAAACTCAGAGAGGTTAGGG - Intergenic
1145294557 17:21578081-21578103 CTCCAGACTCAGAGAGGTGATGG - Intergenic
1145369276 17:22295095-22295117 CTTCAGACTCAGAGAGGTGATGG + Intergenic
1145978813 17:28999480-28999502 CTGGAGACCCGGATTGTTGTTGG + Intronic
1147119772 17:38329210-38329232 CAGGAAGCTCAGAGTGTTCAGGG - Exonic
1147669421 17:42168181-42168203 AGGGAGACCCAGAGTATTGAGGG - Intronic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1152799907 17:82326031-82326053 CTGGACGCTCTGAGTGTTCAGGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154064506 18:11094476-11094498 CAGGAGACTCAGACAGTTGTAGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1155552107 18:26975432-26975454 ATGGAGACTCGGAGTGGTGGGGG - Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1157870387 18:51225129-51225151 ATGGAGAGTTACAGTGTTGATGG - Intergenic
1158416693 18:57255066-57255088 CTGGAAACTCAGAGTGATTCAGG - Intergenic
1158496650 18:57961014-57961036 CTGGAGACACATGGTGGTGATGG + Intergenic
1158944862 18:62439216-62439238 CTGGCGACTGAGCCTGTTGAAGG - Intergenic
1159710646 18:71754663-71754685 CTGTAGACTGAGAGTGTGGTTGG - Intronic
1160361984 18:78291099-78291121 CTGGAGATACATAGTGATGATGG - Intergenic
1160898794 19:1416364-1416386 CTGGAGACCAAGGGTGATGATGG + Intronic
1163057706 19:14733643-14733665 CTACAGACTAAGAGTGTTTAAGG - Exonic
1163489628 19:17609591-17609613 CTGGAGACTCTGTCTGGTGAAGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1165555325 19:36626094-36626116 GTGAAGACTCACAGTGTTAATGG + Intronic
1167655895 19:50763969-50763991 TTGGGGACTAAGAGAGTTGAAGG + Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
1168479450 19:56706787-56706809 ATGAAGACTCAGGGTGTGGAGGG - Intergenic
926386937 2:12344812-12344834 CTGGAGACAGACAGTGGTGATGG - Intergenic
926697738 2:15782485-15782507 CTGGAGAATCAGGGTGGTCAGGG - Intergenic
927654659 2:24935250-24935272 CCAGAGCCTCAGAGTGGTGATGG + Intergenic
927758896 2:25732559-25732581 CTGGAGACGGACAGTGGTGATGG - Intergenic
927803355 2:26121916-26121938 CTGGAGACACAAACTGTTCACGG - Intronic
929123412 2:38501836-38501858 CTGGAGGCTGAGGGTGTTCATGG - Intergenic
929913033 2:46108496-46108518 GTGGAGACTCAGAGAGGTCAAGG + Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933232941 2:79830066-79830088 CTGGAGACTGAGAGAGACGAGGG + Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
936502215 2:113075108-113075130 CTGCAGAATGAGAGTGCTGATGG - Intronic
937871266 2:126787932-126787954 CAGGACACTCAGAGAGGTGAAGG - Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939020075 2:136948013-136948035 ATGTAAACTCAGAGTGCTGATGG - Intronic
939065604 2:137479839-137479861 CTTGGGACTCAGAGTTTTGTGGG + Intronic
940854796 2:158721701-158721723 CTGGAGATGGATAGTGTTGATGG + Intergenic
944743474 2:202634648-202634670 CTGGGGACTCAGACTCTGGAAGG - Intergenic
945691085 2:213037058-213037080 CTGCAGACTCATGGTGTGGAAGG + Intronic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
948290540 2:236821002-236821024 GTGGAGACTGAGTGTGCTGATGG - Intergenic
1170701394 20:18706964-18706986 CTGGAGACCCCGTGTGCTGAGGG + Intronic
1171239270 20:23551840-23551862 CTGGAGATGCAGAGAGTTGGGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174172379 20:48625619-48625641 CTGGAGACCCATAGAGCTGATGG - Exonic
1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG + Intronic
1177728867 21:25002571-25002593 CAGGAGACTCAGGTTATTGAAGG + Intergenic
1178741678 21:35207222-35207244 CTGCAGACCCTGAGTGCTGAGGG + Intronic
1178805330 21:35834531-35834553 CTGGAGCCTCAGAGAGTTCAGGG - Intronic
1179057999 21:37953847-37953869 ATGGAGACACAGAGAGCTGAAGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1181264760 22:21624462-21624484 CTGGGGACTCAGAGTGTTTCTGG - Intergenic
1182233704 22:28859164-28859186 CTGGAGATTGACAGTGATGATGG - Intergenic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1185413984 22:50699859-50699881 CTGGTGGCTTAGAGTGTGGAAGG + Intergenic
949680823 3:6512539-6512561 CTGGAGCCTCTGAGTGTTTGTGG - Intergenic
949878734 3:8645081-8645103 CTAGAGAGTCAGACTGATGAGGG - Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950007083 3:9698370-9698392 CTGGAAACTCAGGGTTTTGTAGG - Intronic
950128047 3:10522783-10522805 CTGGAGGCTCAGAGAGGTAATGG + Intronic
950140523 3:10612061-10612083 CTGGAAGCTCAGAGTGTGGTTGG - Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950453132 3:13076686-13076708 ATTTAGAGTCAGAGTGTTGACGG - Intergenic
950456768 3:13097369-13097391 CTGGAGACTCAGTGACTGGAGGG - Intergenic
950633715 3:14300675-14300697 CTTAAGGCTCAGAGAGTTGAAGG + Intergenic
952123536 3:30273397-30273419 ATGGAGACTGGGAGGGTTGAGGG - Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952654698 3:35771173-35771195 ATGGGAAGTCAGAGTGTTGATGG + Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953964534 3:47293190-47293212 CTGGAGACAGATAGTGGTGATGG + Intronic
954895352 3:53970559-53970581 CTGGAGACTAGCAGTGTAGATGG + Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960639478 3:119812336-119812358 CAGGAGACTCAGAAGGTTTAGGG - Intronic
961173573 3:124816174-124816196 CTGGAGCCTCAGTGTCCTGAAGG - Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961643871 3:128382066-128382088 CAGGAGACTCAGAGAGGAGAGGG - Intronic
962195311 3:133357763-133357785 TTGGGGACTCAGAGTGTAGGGGG + Intronic
962599539 3:136980891-136980913 CTGGAGACTCAGATCCTTTAAGG + Intronic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
963740710 3:149077796-149077818 CAGGGGCCTTAGAGTGTTGAAGG + Intronic
966997341 3:185296044-185296066 CTGGAGTCTCACTGTGTTGCTGG - Intronic
967844428 3:194032722-194032744 CTGGAGGCTGAGGGTGTTGGGGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972629711 4:40832761-40832783 ATGGAGCTGCAGAGTGTTGAGGG - Intronic
972993178 4:44847472-44847494 CTGGAGACTGAGAATGGTAAAGG - Intergenic
974276656 4:59729183-59729205 CTAGAGACTCAGAGTGATCTTGG - Intergenic
976260049 4:83136778-83136800 CTGGGGACCCAGAGTGTGAAGGG - Intronic
977492166 4:97729552-97729574 CTGCAGACTCTGAATTTTGAGGG + Intronic
977698064 4:99989512-99989534 CTGGAGACAGATAGTATTGATGG - Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
980658259 4:135818258-135818280 CTGGAGATAGAGAGTGGTGATGG + Intergenic
981168262 4:141588778-141588800 CTGGAGCCTCAGGGTTTAGAAGG - Intergenic
981891575 4:149744707-149744729 CTGGAGACTTAAAGTGGAGAGGG - Intergenic
982097088 4:151933190-151933212 CTGGAGACTCCAAATGTTCAGGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
984252254 4:177348565-177348587 CTGGGGACTCAGAGGATTGCAGG - Intronic
986351702 5:6886182-6886204 ATGGAGACTCAGGGGGTTGGGGG - Intergenic
987528249 5:19080777-19080799 CTGGAGACTCAGGGTCCTGGTGG + Intergenic
990550312 5:56869373-56869395 CTGGAGACACATAGTGGTGATGG + Intronic
993025618 5:82642452-82642474 CTGGAGACCCAGAGAGTCAATGG + Intergenic
993606772 5:90000640-90000662 CTGGTTAGTCAGTGTGTTGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
995991662 5:118247311-118247333 CTTGAGACCCCGAGTGCTGAGGG - Intergenic
996523723 5:124454967-124454989 CTGGCAACTGAGAATGTTGAGGG + Intergenic
996605637 5:125318320-125318342 CTGGAAACGGAGAGTGGTGATGG - Intergenic
999187518 5:149723364-149723386 CTGGAGACTGGGGGGGTTGAGGG - Intergenic
999956331 5:156706653-156706675 CTGGGGACTCTGATTGCTGAGGG - Intronic
1001397446 5:171427523-171427545 GTGGAGACTCAGAGAGGTTAAGG - Intronic
1001751136 5:174132327-174132349 CTGGGGACAGAGAGTTTTGAAGG - Intronic
1002520959 5:179793111-179793133 CAGGAAACTCAGAGTGGGGAGGG - Intronic
1003062038 6:2871246-2871268 CTGGAAACTCATATTGTAGATGG - Intergenic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1008441508 6:51536961-51536983 CTGAAGTCACAGAATGTTGAAGG - Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1014340989 6:120206547-120206569 CTGTAGACTGAGAGTGTGGTTGG - Intergenic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017233193 6:152094311-152094333 TAGGAGACCCAGAGTGTTCATGG - Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1022502612 7:30892180-30892202 CTGGGGACCCAGTGTGTTGCTGG + Exonic
1022631866 7:32093011-32093033 CTGGGGACTAAGAGGGTTCATGG + Intronic
1022644331 7:32216585-32216607 ATGGATATTCAGAGTGTTCAAGG - Intronic
1023089358 7:36603284-36603306 CAGGGGACCCAGATTGTTGACGG - Intronic
1023345364 7:39266096-39266118 CTGGTGAATCAGTGTGTTCATGG - Intronic
1026775327 7:73227504-73227526 GAGGAGACCCAGAGTGTTCAGGG + Intergenic
1027016184 7:74780875-74780897 GAGGAGACCCAGAGTGTTCAGGG + Intronic
1027071844 7:75165062-75165084 GAGGAGACCCAGAGTGTTCAGGG - Intergenic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028937169 7:96478968-96478990 CTGGAGACAGTGAGTGTTAAAGG + Intergenic
1030326696 7:108227219-108227241 CTGGAAAGTCAGAGTGCTGATGG - Intronic
1032871929 7:135994991-135995013 CAGCAGACTCAGAGTGTGGCTGG + Intergenic
1035627034 8:1078139-1078161 CTGGAGGGCCAGCGTGTTGAGGG - Intergenic
1035833753 8:2727138-2727160 CTGGACACTCACAGTTTTGGGGG - Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1038397604 8:27258613-27258635 CTGGAGAACCAGAGGGGTGAGGG + Intergenic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039678420 8:39699987-39700009 CTGGACACTCAGAGTGCATAGGG + Intronic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1041181076 8:55248808-55248830 CTGGAGTCTCAGAGTGTCCCAGG + Intronic
1042867660 8:73369746-73369768 CTGGAAACTGATAGTGGTGATGG + Intergenic
1042921520 8:73924651-73924673 CTGGAGATACAGGGTGGTGATGG + Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047947077 8:129891109-129891131 CTGGAGTCTCAGACCTTTGAAGG - Intronic
1048069293 8:131004836-131004858 ATGGACACTCACAGGGTTGAAGG + Intronic
1048247278 8:132820439-132820461 CTGGAAACTTAGAGTCTAGAAGG + Intronic
1049600373 8:143504749-143504771 CAGGGGGCTCTGAGTGTTGAGGG - Intronic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1053048337 9:34937951-34937973 CGTGAGAATCAGAGTGTTGAAGG + Intergenic
1053301905 9:36958449-36958471 CTGGAGACTTGGAGGGTTGGTGG + Intronic
1053343510 9:37360734-37360756 CTGGAGACTCAGCCAGCTGAGGG + Intergenic
1053474458 9:38372066-38372088 TTTGAGACGCAGAGTGATGAAGG - Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1055782632 9:79835783-79835805 AAGGAAACTCAGAGTGTTGTGGG + Intergenic
1058704524 9:107627607-107627629 CTTGAAACTCAGAGAGGTGAAGG - Intergenic
1058911274 9:109522099-109522121 CTTGTGACTCAAAGTGTGGACGG + Intergenic
1058941330 9:109815477-109815499 CTGGTGACTCACTGTGCTGAGGG + Intronic
1058950897 9:109903004-109903026 CTGGAGCCTCAGAGATTTCATGG + Intronic
1058957395 9:109961765-109961787 CTGAAGGATCAGAGTGTTGTAGG + Intronic
1060364921 9:123001687-123001709 ACTGAGACTCAGAGAGTTGAGGG - Intronic
1060643697 9:125260579-125260601 CTGGAGACTCCCAGTATTGGAGG + Intergenic
1060809322 9:126601759-126601781 CTGGAGACAAATAGTGGTGATGG + Intergenic
1061206402 9:129166416-129166438 CTGGAGGCTCAGGGAGGTGAAGG + Intergenic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1186825035 X:13330747-13330769 CTGAACCCTGAGAGTGTTGAGGG + Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187577719 X:20576089-20576111 CTGTAGACCCAGAGAGTTCAGGG - Intergenic
1188445408 X:30249095-30249117 CTGGGTACTCAGAGAGGTGAAGG + Intronic
1191883633 X:65866523-65866545 CTGAAAACTCTGAGTGTTCAGGG + Intergenic
1192312064 X:70025259-70025281 CAGGAGACTCACATTCTTGAAGG + Intronic
1192445926 X:71211230-71211252 CCGAAGACTAAGAGAGTTGATGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195154998 X:102113914-102113936 TTGGAAACCCAGAGTGCTGAAGG + Intergenic
1196126595 X:112108455-112108477 CTGGAGAGGCAGACTGTTAAAGG - Intergenic
1196288098 X:113905937-113905959 CAGAACACTCTGAGTGTTGAAGG + Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199195834 X:145029259-145029281 CCAGAGGCTCAGAGAGTTGAAGG + Intergenic
1199482364 X:148311558-148311580 ACTGAGACTCAGAGAGTTGAAGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic