ID: 961235154

View in Genome Browser
Species Human (GRCh38)
Location 3:125359954-125359976
Sequence CAGCTGGCACAACTGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961235145_961235154 -3 Left 961235145 3:125359934-125359956 CCAGCACAGGCCCGCCCATGCAG 0: 1
1: 0
2: 3
3: 15
4: 210
Right 961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG 0: 1
1: 0
2: 1
3: 35
4: 260
961235141_961235154 19 Left 961235141 3:125359912-125359934 CCACCAGCTGCTAAGTGCACCGC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG 0: 1
1: 0
2: 1
3: 35
4: 260
961235142_961235154 16 Left 961235142 3:125359915-125359937 CCAGCTGCTAAGTGCACCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG 0: 1
1: 0
2: 1
3: 35
4: 260
961235144_961235154 0 Left 961235144 3:125359931-125359953 CCGCCAGCACAGGCCCGCCCATG 0: 1
1: 0
2: 2
3: 19
4: 229
Right 961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG 0: 1
1: 0
2: 1
3: 35
4: 260
961235140_961235154 27 Left 961235140 3:125359904-125359926 CCGCTGCTCCACCAGCTGCTAAG 0: 1
1: 0
2: 0
3: 17
4: 271
Right 961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG 0: 1
1: 0
2: 1
3: 35
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961235154 Original CRISPR CAGCTGGCACAACTGGGCCT GGG Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
901070001 1:6512349-6512371 CAGGGGGCACATCTGGGGCTGGG - Intronic
902597768 1:17520840-17520862 CAGCTGGGAAAACTGAGGCTTGG + Intergenic
902943225 1:19815162-19815184 CAGCTGGCGCCGCTGGGACTTGG + Exonic
903227159 1:21900267-21900289 CAGCTGACTCAACCGGGCCCAGG + Intronic
903831412 1:26177529-26177551 GAGCTGGCAGAGCTGGGCCATGG + Exonic
903884360 1:26532241-26532263 TACGTGGCAGAACTGGGCCTGGG - Intronic
904111301 1:28128601-28128623 CAGGAGGCAAAACTGGTCCTGGG + Intergenic
904687527 1:32271531-32271553 TAGCTGGCACCACTGAGCCCAGG - Intronic
904702428 1:32365906-32365928 CAGGTGGCACAGCTGGGCTAAGG + Intronic
905092478 1:35440652-35440674 CAGCTGGCAGACACGGGCCTGGG + Intronic
907247152 1:53115620-53115642 CAGTTGGCAGAGCTGGGACTAGG - Intronic
912977366 1:114342684-114342706 CTGCTGGCACCACTGGCGCTGGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
920047914 1:203145603-203145625 CAGGTGGCAGAGCTGGGACTGGG - Intronic
920733023 1:208505694-208505716 CAGCTGAAACCACTGGGCCTTGG + Intergenic
921340870 1:214133040-214133062 CAGATGGCAAAACTGGGTATGGG + Intergenic
922012145 1:221599573-221599595 CAACTGGCACAGCTGGCACTGGG - Intergenic
922058652 1:222066243-222066265 CAGCTAGCAAAACTGAGACTTGG - Intergenic
922291630 1:224213504-224213526 CCACTGGCACCGCTGGGCCTAGG - Intergenic
922675385 1:227546220-227546242 CTGCAGGAACAACTGGTCCTTGG + Intergenic
1063600371 10:7475388-7475410 CGGCAGGAACAACTGGCCCTGGG + Intergenic
1064180891 10:13113576-13113598 CATCTGTTACAACTGTGCCTGGG + Intronic
1065284803 10:24176986-24177008 CAGCTGGCACCACCGGCCCCGGG - Intronic
1065721418 10:28631587-28631609 CAGCTGGCACAGGAGGACCTGGG + Intergenic
1066006759 10:31153007-31153029 GAGCTGGGTCAACTGGGGCTAGG + Intergenic
1066116214 10:32242733-32242755 CAGCAGGCACACCTGCGCCTTGG - Intergenic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1069784932 10:70981728-70981750 CAGGGGGCAGAACTAGGCCTGGG - Intergenic
1070820036 10:79349101-79349123 CAGCTGGTAAGACAGGGCCTGGG + Exonic
1070892521 10:79952296-79952318 GAGCTGGCACAAGTGCACCTGGG - Intronic
1071038474 10:81277306-81277328 AAGCTGTCACAACTGGGGCATGG - Intergenic
1071474873 10:86017554-86017576 GAGCAGGCACAACTGGGTCATGG + Intronic
1072188297 10:93061964-93061986 GAGCTGGAACTTCTGGGCCTGGG - Intronic
1073663831 10:105508000-105508022 CATCTGGCACAACTGAGTGTAGG - Intergenic
1074238127 10:111606993-111607015 CAGCTGGCTCAACTTTCCCTAGG + Intergenic
1075027768 10:118999159-118999181 CAGCTGGAACAACTCAGGCTGGG + Intergenic
1075316485 10:121457639-121457661 CAGCTTTCCCACCTGGGCCTTGG - Intergenic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1075816269 10:125266925-125266947 CACCTGGCAGAGCTGGCCCTGGG + Intergenic
1076520275 10:131076880-131076902 CAGCTGGCATCACTGGGGCCAGG + Intergenic
1076520506 10:131078111-131078133 CAGCTGGCACCACTGGGGCCAGG - Intergenic
1076652491 10:131999420-131999442 GAGCTGGCAGGACTGAGCCTTGG + Intergenic
1077183922 11:1228189-1228211 CAGCCGGCAGCCCTGGGCCTGGG + Intronic
1081330512 11:41794278-41794300 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1083260236 11:61518636-61518658 CAGCTGGTGCCACTGGGCCACGG + Exonic
1084275556 11:68049452-68049474 CAGGTGGCACAACTGGCACTGGG + Intronic
1084400054 11:68938293-68938315 GAGCTGGCAGAACTGGCCCAGGG - Exonic
1086074991 11:82841144-82841166 CAGCAGGAATAACAGGGCCTGGG + Intronic
1088154773 11:106790104-106790126 CAGATGGCATCTCTGGGCCTTGG - Intronic
1088535434 11:110855242-110855264 CAGCTGTCACAACTGCACATGGG - Intergenic
1090578383 11:128133228-128133250 GCTCTGGCACAACTGTGCCTGGG - Intergenic
1090653623 11:128826188-128826210 CAGCAGGCAGAGCAGGGCCTAGG + Intergenic
1090820167 11:130334977-130334999 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091466854 12:692255-692277 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1092122651 12:6055456-6055478 GGGCTGGGACAACTGGGTCTGGG - Intronic
1096090227 12:48894529-48894551 CTGGTGCCACATCTGGGCCTGGG - Intergenic
1096111754 12:49033168-49033190 CAGCTGGCACAGCAGGGTCAGGG - Exonic
1096220454 12:49825754-49825776 CTGCTGGCTCTCCTGGGCCTGGG - Intronic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097698627 12:62798646-62798668 GATATGGCACATCTGGGCCTGGG + Intronic
1101605261 12:106243637-106243659 CAGCAGGCACAAGTGGGTCCTGG - Intronic
1101758336 12:107638998-107639020 CAGCTGGGGCTACTGGGTCTGGG + Intronic
1103187331 12:118970429-118970451 CAGATGGCAAAACTGAGACTGGG + Intergenic
1103781077 12:123399175-123399197 CTGCTTGCACATCTGGCCCTGGG - Intronic
1103827881 12:123754565-123754587 CTGCTGGCACTACAGGGCATTGG - Intronic
1104422203 12:128645407-128645429 CAGGTGCCATGACTGGGCCTGGG - Intronic
1104579886 12:130003447-130003469 CAGCGGGCAAAGCAGGGCCTTGG - Intergenic
1105021850 12:132822017-132822039 CAGGTGGCACCAGTGGGCCCGGG + Exonic
1106770566 13:32957496-32957518 CAGCTGGCCCAGCTGGGGCTGGG + Intergenic
1107986313 13:45779562-45779584 CAAATGGCAGAGCTGGGCCTGGG - Exonic
1108597459 13:51961761-51961783 CAGCTGGCAGAGTTGGGCCCAGG + Intronic
1113031505 13:105998217-105998239 CAGCTGTCAAGACAGGGCCTCGG + Intergenic
1113598549 13:111551660-111551682 CAGCTGGCACAGGTGTGCCCTGG - Intergenic
1113812968 13:113153490-113153512 CAGCAGGCACAGCTGGGTCCAGG + Intergenic
1113914577 13:113863047-113863069 CACCTGGCAGAACGGGGCCGCGG + Intronic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1117953030 14:61101564-61101586 CCGTTGTCAGAACTGGGCCTTGG + Intergenic
1118822036 14:69352131-69352153 CAGCTGCCACTGCTGGGCCTGGG - Exonic
1119549770 14:75500052-75500074 GAGCTGGCAGGACTGGGCTTTGG + Intergenic
1120931486 14:89853135-89853157 CAACTGGCACAAATAGGCTTGGG + Intronic
1121324214 14:93010490-93010512 CTGCTGGCCCACCTGGGCCTCGG - Intronic
1122103500 14:99432829-99432851 TGGCTGTCACACCTGGGCCTGGG - Intronic
1122660348 14:103290770-103290792 CAGCTGGCCTGGCTGGGCCTTGG - Intergenic
1123125813 14:105945256-105945278 CTGCAGGGATAACTGGGCCTTGG + Intergenic
1123406397 15:20021675-20021697 CTGCAGGGATAACTGGGCCTTGG + Intergenic
1123515727 15:21028323-21028345 CTGCAGGGATAACTGGGCCTTGG + Intergenic
1123687373 15:22808471-22808493 CAGGTGGCACAACTGATGCTGGG + Intronic
1123699319 15:22902843-22902865 CAGCAGGCAGGACTGGGCCGTGG + Intronic
1125517695 15:40331905-40331927 CATCTGTCAAAAATGGGCCTGGG + Intronic
1127284011 15:57517002-57517024 CAGCTGCCAAAGCTGGGCCTGGG - Intronic
1127895600 15:63296157-63296179 CAGCTGGCACAAGTGGGAGTCGG - Intronic
1128019962 15:64381553-64381575 CCGCTGTCACCACTGGGCATTGG - Intronic
1128336798 15:66791872-66791894 CAGCTGCCAAAACAGTGCCTTGG + Intergenic
1128447938 15:67781309-67781331 CAGCTGGCACAACTGTAAATAGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129812809 15:78524372-78524394 GAGCTGGCACAACTGGGACGTGG + Intronic
1130808536 15:87352767-87352789 CAGCTGGGATCACTGAGCCTAGG + Intergenic
1130907173 15:88249032-88249054 CTGCTGGGAAAACTGGGCTTAGG + Intronic
1130909408 15:88260875-88260897 GAGCTGGCAGATCTGGGCTTGGG + Intergenic
1130993401 15:88890231-88890253 CAGATGGCAGGTCTGGGCCTTGG - Intronic
1131062856 15:89414868-89414890 AAGGTGCCACAACTGTGCCTTGG - Intergenic
1132761467 16:1510506-1510528 CAGCTGGGACACCCGGGCCTTGG - Exonic
1132806510 16:1777539-1777561 CAGCTGGCACAGCTGAGGCAAGG + Intronic
1133271483 16:4612836-4612858 CAGATGGCACAACTGAGACTTGG + Intronic
1136247496 16:28984324-28984346 CATCTGCCACAGCTGGCCCTGGG + Exonic
1136280241 16:29204105-29204127 CAGCAGCCACAAGTGGGACTCGG - Intergenic
1136548113 16:30966555-30966577 AAGCAGGCACAGATGGGCCTGGG + Intronic
1139604646 16:68009470-68009492 CAGCTGGGACAGCTGGTGCTGGG - Intronic
1139779537 16:69339424-69339446 CCGCTCGCGCCACTGGGCCTCGG + Exonic
1140469897 16:75208055-75208077 CAGAGGGCAAGACTGGGCCTAGG + Intergenic
1141825646 16:86477904-86477926 CTGCTGGCAGAGCTGGGCTTCGG + Intergenic
1141941265 16:87277766-87277788 CAGCCTGCACTAATGGGCCTAGG + Intronic
1142485918 17:247614-247636 CAGCTGGGACTACTGTACCTGGG + Intronic
1142674833 17:1507288-1507310 CAGCTGCCTCCCCTGGGCCTTGG - Intronic
1143501902 17:7344038-7344060 CAGCTGGTGCAACTGGGCACAGG - Exonic
1144320034 17:14107113-14107135 CAGCTGTCACAAGTGGGGGTGGG - Intronic
1144835790 17:18156067-18156089 GAGCTGGCACAATGGGGCCAAGG + Intronic
1145242077 17:21245901-21245923 CAGTGGCCACAGCTGGGCCTTGG - Intronic
1147864433 17:43543427-43543449 CAGCTGGTCCATCTGTGCCTGGG - Intronic
1147872891 17:43600102-43600124 CATCTGGCTCAACTGGATCTAGG + Intergenic
1150216926 17:63476457-63476479 CGGCCGGCACACCTGGGGCTTGG - Intergenic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151732732 17:75920852-75920874 CACCTGTGACACCTGGGCCTGGG - Intronic
1152439058 17:80294225-80294247 CAGCTGGCACAGATGGCCCTTGG - Intronic
1152650023 17:81488397-81488419 CAACAGGCACAACTCGGCCCCGG - Intergenic
1152650041 17:81488452-81488474 CAACAGGCACAACTCGGCCCCGG - Intergenic
1157292051 18:46416708-46416730 CAGCTGGGACAGATGGGTCTAGG + Intronic
1161038579 19:2098356-2098378 CAGCAAGCTCACCTGGGCCTGGG + Intronic
1161263020 19:3347994-3348016 CAGCCGGCCCCACTGTGCCTGGG - Intergenic
1162918781 19:13888463-13888485 CCGTTGGCACACCTGAGCCTGGG - Intronic
1163266117 19:16223545-16223567 TAGCTGGCACCACAGGGCCTGGG + Intronic
1166350848 19:42197392-42197414 CAGCTGGCTCCACCAGGCCTTGG + Intergenic
1166917618 19:46206267-46206289 CAGCTGGCCCTCCTTGGCCTTGG - Intergenic
1167053580 19:47095106-47095128 CAGCAGGCAATCCTGGGCCTGGG - Intronic
1168100087 19:54136996-54137018 TAGCTGGCAGAAGTGGGACTTGG - Intergenic
1168324579 19:55531384-55531406 CAGCTGGCCCAGGTGGCCCTTGG - Intronic
925409399 2:3631467-3631489 CACTGGGCACAGCTGGGCCTGGG - Intronic
927873018 2:26635581-26635603 CGTCTGGCTCAACTTGGCCTTGG + Intronic
927946420 2:27137673-27137695 CAGCTGGACCACCAGGGCCTGGG + Exonic
927966083 2:27269592-27269614 CTGCTGTCACAACTGTGCTTTGG - Intronic
928991602 2:37237814-37237836 CAGCTGGTGGAACTGGGCCCAGG + Exonic
929742633 2:44619962-44619984 CAGCGGGCAAGACTGGGCATGGG - Intronic
930217808 2:48714931-48714953 CAACTGGCATAAATGGGACTAGG + Intronic
933834171 2:86232296-86232318 CAGCAGGCACAACTGGACCTGGG - Intronic
933971192 2:87471169-87471191 CAGCTGGGACACCTGTGCGTGGG - Intergenic
934845291 2:97658351-97658373 CACCTGGGACACCTGTGCCTTGG + Intronic
936322537 2:111479020-111479042 CAGCTGGGACACCTGTGCGTGGG + Intergenic
936452048 2:112641121-112641143 GAGCTGAGAAAACTGGGCCTTGG + Intergenic
940031464 2:149266965-149266987 CAGCTGGTAGAACAGGGTCTGGG - Intergenic
942922303 2:181390780-181390802 CATGTGGCACAACTGGGACCAGG - Intergenic
943510367 2:188818783-188818805 CAGCTGACATAACTTGGACTGGG + Intergenic
944903725 2:204241950-204241972 CAGATGGCACAATTTGTCCTTGG + Intergenic
1169125212 20:3122314-3122336 CAGATGGCTCAGCTGGGCCCAGG + Exonic
1170705222 20:18738458-18738480 CAGCTGGCTCAACTCTGCCGGGG + Intronic
1173198970 20:40939857-40939879 CATCTGGCATAACTGAGACTTGG + Intergenic
1173665031 20:44757199-44757221 CAGCAGGTACAGCTGGGCTTGGG + Intronic
1173864487 20:46305580-46305602 CAGCTGGCACTGCATGGCCTGGG - Intronic
1174040614 20:47697105-47697127 TAGCTGGCAAAAGTGGGCCTGGG - Intronic
1174185353 20:48702493-48702515 CACCTGGCACAAGGGGGGCTGGG - Intronic
1174309178 20:49637221-49637243 CAGCTGTCAGAACAGGGCCTCGG + Intronic
1176946456 21:14988173-14988195 CAGCTGAAAAAACTGAGCCTCGG - Intronic
1178488880 21:33035406-33035428 CAGCTGGCAGAGCTTGGCCAAGG - Intergenic
1178871314 21:36379237-36379259 CAGCTGGAGCATTTGGGCCTCGG - Intronic
1179393327 21:41013812-41013834 CAGCTGGCCAAACTTGGCCATGG + Intergenic
1179822312 21:43943949-43943971 AAGCTGCCACCACTGGGCCCAGG - Intronic
1180593239 22:16957925-16957947 CAGCTGTCACCACAGGGCCATGG + Intergenic
1180951920 22:19724303-19724325 CAGCTTGCGCTGCTGGGCCTTGG + Exonic
1181076126 22:20378177-20378199 CTGCTGACTCTACTGGGCCTCGG + Intronic
1181820603 22:25472463-25472485 CACCTGGCACAATTGGCCCTGGG + Intergenic
1181843286 22:25684122-25684144 AAGGTGACACAACAGGGCCTGGG - Intronic
1182500549 22:30743588-30743610 CTGCTGGCACAGCTGGGCTCAGG + Intronic
1183581152 22:38727418-38727440 CAGCTGGAACTAGGGGGCCTGGG - Intronic
1184102639 22:42348894-42348916 CAGCTGCCAGACCTGAGCCTTGG + Intergenic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
950204866 3:11071484-11071506 CAGCCGGCACCACCGGCCCTAGG - Intergenic
950424754 3:12919125-12919147 CTGCTTGGACACCTGGGCCTGGG + Intronic
950704715 3:14772710-14772732 CTCCTGGCCCAACCGGGCCTGGG + Intronic
950785026 3:15427406-15427428 CAGCCAGCCCCACTGGGCCTCGG + Exonic
951228800 3:20152261-20152283 CAGCTGACAAAACTGGGACTGGG - Intronic
951753768 3:26066670-26066692 CTGCTGGGATAAATGGGCCTGGG - Intergenic
952651256 3:35729376-35729398 CAGCTGCCACACCTGAGACTAGG - Exonic
953694536 3:45147133-45147155 CAGGTGGCACACCTGCGGCTGGG - Intergenic
954258072 3:49419969-49419991 GAGGTGGCAGAACTGGGCTTGGG - Intronic
954855143 3:53637761-53637783 CAGCAGGCAGAACTGAGTCTCGG - Intronic
954914973 3:54140895-54140917 CAGCTGAGAAAACTGGGGCTTGG + Intronic
957894484 3:86403582-86403604 AAGCTGACACAACTTGTCCTGGG + Intergenic
958785447 3:98593007-98593029 AGCCTGGCACACCTGGGCCTGGG + Exonic
961234912 3:125357623-125357645 CAGCTGGCCCAATCGGGCCTGGG + Intronic
961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG + Intronic
962341967 3:134593463-134593485 GAGCTGGCAGAACTGGGGTTAGG + Intergenic
966807484 3:183818472-183818494 CACCTGGCACTGCTGGGTCTTGG + Intronic
968745394 4:2357283-2357305 CAGCTTGCTCACCTGGGCCCGGG + Intronic
968803120 4:2756011-2756033 TACCTGGCGCATCTGGGCCTCGG + Exonic
969600977 4:8176242-8176264 CAGCTGCCCCACCTGAGCCTCGG - Intergenic
969617642 4:8262818-8262840 CAGCACCCACAGCTGGGCCTGGG + Intergenic
969721414 4:8894594-8894616 CCTCTGGCACAACCAGGCCTGGG - Intergenic
973901009 4:55471676-55471698 CAGCTGTCACTTCTGTGCCTAGG - Intronic
977416654 4:96742618-96742640 CAGCTGGCATTGCTGGCCCTGGG + Intergenic
977885148 4:102245141-102245163 CGGCTGGCACCGCTGGCCCTGGG + Intergenic
980493424 4:133560324-133560346 CAGCTTCCACAGCTGGGACTAGG + Intergenic
982162228 4:152581676-152581698 CAGCTAGCACAACTAGGGCTTGG + Intergenic
982189063 4:152834933-152834955 CAGCTGGCACAGCTGGGATGTGG + Intronic
983871847 4:172832730-172832752 CACCTGGAACAACTGGGCCGCGG + Intronic
984852554 4:184167029-184167051 CAGCTGCCCCACCTGTGCCTGGG + Intronic
987234365 5:15928188-15928210 CCGCTGGTACAACCTGGCCTGGG + Exonic
989373577 5:40735419-40735441 CAGTTGGCTCAACTTGGACTTGG + Intronic
989849671 5:46193756-46193778 CACCTGGCTCAAATGGTCCTAGG + Intergenic
992706448 5:79399357-79399379 CACCTGGCACAACTAGGAGTAGG + Intronic
995723866 5:115165566-115165588 CAGCTGCCATCACTGGGACTTGG - Intronic
995915581 5:117241513-117241535 CAGCTAGCTCAAATGGGCCCAGG + Intergenic
997463483 5:134071383-134071405 CAGCTGGCGCGGCTGGGCCCAGG - Intergenic
997474343 5:134133978-134134000 CAGGTGGCAAAGCTGGACCTGGG + Intronic
997866941 5:137472137-137472159 CTGCTGGCAGCACTGGGCCAGGG - Intronic
998148007 5:139741183-139741205 GAGTTGGCACCCCTGGGCCTGGG + Intergenic
998500700 5:142630259-142630281 CAGCTAACACAGCTGGGACTAGG - Intronic
999109517 5:149106316-149106338 CAGCTGGAACATCAGGGCCAGGG - Intergenic
1000630943 5:163590272-163590294 CAGGAGGCTCAACTGAGCCTAGG - Intergenic
1002524171 5:179806439-179806461 CACCTGGCGCACCTGGGCGTCGG - Intronic
1002581482 5:180211798-180211820 CAGGTGCCACCACTGGGCCCTGG + Intergenic
1002634916 5:180602536-180602558 CAGCCCGCACACCTGCGCCTGGG - Exonic
1003664954 6:8102271-8102293 CGGCTGGCGCCTCTGGGCCTCGG - Intronic
1005317911 6:24621987-24622009 CTGGTGGCAGCACTGGGCCTGGG + Intronic
1007075592 6:39064303-39064325 CAGCAGTCAGAACTGGGTCTCGG - Intronic
1007097572 6:39223308-39223330 CAGCTGCCACTGCGGGGCCTTGG - Intronic
1007697645 6:43743953-43743975 TTCCTGGCACAGCTGGGCCTGGG - Intergenic
1009340025 6:62542049-62542071 CAAGTGTCACATCTGGGCCTGGG + Intergenic
1009427041 6:63525707-63525729 CAGCTGCTACCACTAGGCCTGGG - Intronic
1009739267 6:67723153-67723175 CAGCTGGCACCACCGGCCCCAGG + Intergenic
1010032732 6:71288273-71288295 CAGCTGCCACAACTGTACTTAGG - Intergenic
1010270361 6:73910088-73910110 CAGCTGGCACCACCGGCCCTGGG + Intergenic
1012169608 6:96002219-96002241 GAGCTGTCACAGCTTGGCCTGGG - Intergenic
1014843880 6:126252211-126252233 GAGCTGGGACAGCTGGGACTTGG + Intergenic
1017440225 6:154457992-154458014 CAGCTGGCAGGATTTGGCCTGGG - Intronic
1017703563 6:157098797-157098819 CGGCTGGCACAGCTCAGCCTGGG - Intronic
1019693696 7:2432644-2432666 CAGCCGGAACAGCCGGGCCTTGG - Exonic
1020236645 7:6361045-6361067 CAGCTGGGCCAGCAGGGCCTGGG - Intergenic
1020761143 7:12269447-12269469 GGGCTGCCACAACTGTGCCTGGG - Intergenic
1022574752 7:31486718-31486740 AAGGTGGCAGAACTGGCCCTAGG - Intergenic
1022949907 7:35328248-35328270 CTGTGGGCACAACTGTGCCTTGG - Intergenic
1023330878 7:39115476-39115498 CAGCAGGCTCTACTGGGCCCAGG - Intronic
1025190544 7:56892571-56892593 CAGATGGCAGGACTGTGCCTGGG + Intergenic
1025198318 7:56948259-56948281 CAGCTGGAAGCACTGGGCGTCGG + Intergenic
1025673631 7:63628674-63628696 CAGCTGGAAGCACTGGGCGTCGG - Intergenic
1025681397 7:63684349-63684371 CAGATGGCAGGACTGTGCCTGGG - Intergenic
1026048021 7:66921414-66921436 CAGCTGGCCCGGCTGGGCCCGGG + Exonic
1026051045 7:66946857-66946879 CATATGGGACACCTGGGCCTTGG + Intronic
1026765559 7:73157313-73157335 CAGCTGGGTCACCTGGGCCTGGG - Intergenic
1027042032 7:74967006-74967028 CAGCTGGGTCACCTGGGCCTGGG - Intronic
1027081609 7:75235348-75235370 CAGCTGGGTCACCTGGGCCTGGG + Intergenic
1027668737 7:81071210-81071232 CAGCTGGCACCACTGGCCCCAGG + Intergenic
1029390194 7:100269929-100269951 CAGCTGGGTCACCTGGGCCTGGG + Intronic
1031381614 7:121093047-121093069 CAACTGGCACAACTTAGACTAGG + Intronic
1032844600 7:135741729-135741751 CAGGAGGATCAACTGGGCCTGGG + Intronic
1033478590 7:141715770-141715792 CAAGTGGCAGAACTGGGACTTGG - Intronic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1035338254 7:158143849-158143871 CAGCAGGCACCACAAGGCCTGGG + Intronic
1037896197 8:22657949-22657971 CAGGAGGCCCAACTGGGCTTCGG + Intronic
1039527603 8:38231000-38231022 CAGCTGGCACCAATGGGCTGGGG + Intronic
1040659540 8:49554738-49554760 CACATGGCACAACTGGCACTGGG + Intergenic
1040802859 8:51363090-51363112 CAGGAGGCAAAACTGGGCCAGGG - Intronic
1041706051 8:60847340-60847362 CACATGGCACAACTGGAACTAGG - Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042321746 8:67482915-67482937 CAGCTAGAATAACTGGGCGTGGG - Intronic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1049031626 8:140042529-140042551 CAGCTGAGATAACTGGGACTTGG + Intronic
1049441961 8:142613684-142613706 CGGCTGGTACTGCTGGGCCTCGG + Exonic
1049595432 8:143481210-143481232 CTGGTCGCACCACTGGGCCTGGG - Intronic
1050774219 9:9239759-9239781 CAGGAGTCACAACTGGGCCAGGG - Intronic
1050913643 9:11104812-11104834 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1055209032 9:73766837-73766859 CAGCTGTCAAAACTGGGGCGAGG + Intergenic
1056958483 9:91101515-91101537 CATCTGGGACAACTGGGCAGGGG - Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1057511651 9:95684847-95684869 CTGCTGGCAAATCTGGGGCTGGG - Intergenic
1059395083 9:114029025-114029047 CACCTGCCACAGCTGTGCCTGGG + Intronic
1060661672 9:125408399-125408421 CAGCTGCCACCGCTGGGCCTCGG + Intergenic
1061198886 9:129124817-129124839 CAGGTGGAAAAACTGGGCCAGGG - Intronic
1061487450 9:130927507-130927529 CAGCTGGCACAGATGGGGCCTGG + Intronic
1061970159 9:134040522-134040544 CGGGTGGCACAACAGGGACTCGG + Intronic
1062004093 9:134230649-134230671 CAGCTGGCGACACTGGGCCTTGG + Intergenic
1062406591 9:136399763-136399785 CAGGAGGCGGAACTGGGCCTGGG - Intergenic
1062436789 9:136549963-136549985 CTGCAGGCACCCCTGGGCCTGGG - Intergenic
1186858919 X:13652286-13652308 CGGCAGTCACAGCTGGGCCTTGG + Intergenic
1188111997 X:26204902-26204924 CAGCTGGCCCCACTGGCCCCGGG + Intergenic
1188809702 X:34638189-34638211 CTACTGGCAGACCTGGGCCTGGG - Intronic
1189471947 X:41321622-41321644 CAGCAGGGACACCTGGGCCAAGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191130477 X:57002967-57002989 ATGCTGGCCCAACTGGCCCTGGG + Intergenic
1192758171 X:74067262-74067284 CAGCAGGGACACCTGGGCCAAGG + Intergenic
1195672972 X:107484585-107484607 CAGCTGGCTCCCCTGGGGCTAGG + Intergenic
1196422399 X:115536534-115536556 CAGCTGGCATATCTAGTCCTGGG - Intergenic
1200519716 Y:4195710-4195732 CAGCTGGCACAACCAGCCCTGGG - Intergenic
1200684132 Y:6245042-6245064 CAGCGGGCACAGCTTGGCCCTGG - Intergenic
1201048503 Y:9909344-9909366 CAGCGGGCACAGCTTGGCCCTGG + Intergenic
1202115877 Y:21468425-21468447 CAGCGGGCACAGCTTGGCCCTGG + Intergenic