ID: 961236866

View in Genome Browser
Species Human (GRCh38)
Location 3:125375018-125375040
Sequence CGCGCGGGGGGAGCGCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 10, 3: 70, 4: 540}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961236866_961236879 9 Left 961236866 3:125375018-125375040 CCGCCGCGCGCTCCCCCCGCGCG 0: 1
1: 0
2: 10
3: 70
4: 540
Right 961236879 3:125375050-125375072 CCCCCTCCCCCGCCCTCCCCCGG 0: 1
1: 3
2: 36
3: 374
4: 2162
961236866_961236885 15 Left 961236866 3:125375018-125375040 CCGCCGCGCGCTCCCCCCGCGCG 0: 1
1: 0
2: 10
3: 70
4: 540
Right 961236885 3:125375056-125375078 CCCCCGCCCTCCCCCGGGCCCGG 0: 1
1: 0
2: 13
3: 129
4: 1216
961236866_961236893 25 Left 961236866 3:125375018-125375040 CCGCCGCGCGCTCCCCCCGCGCG 0: 1
1: 0
2: 10
3: 70
4: 540
Right 961236893 3:125375066-125375088 CCCCCGGGCCCGGGCCTGCCAGG 0: 1
1: 0
2: 6
3: 56
4: 700
961236866_961236881 10 Left 961236866 3:125375018-125375040 CCGCCGCGCGCTCCCCCCGCGCG 0: 1
1: 0
2: 10
3: 70
4: 540
Right 961236881 3:125375051-125375073 CCCCTCCCCCGCCCTCCCCCGGG 0: 1
1: 1
2: 32
3: 322
4: 2165
961236866_961236887 16 Left 961236866 3:125375018-125375040 CCGCCGCGCGCTCCCCCCGCGCG 0: 1
1: 0
2: 10
3: 70
4: 540
Right 961236887 3:125375057-125375079 CCCCGCCCTCCCCCGGGCCCGGG 0: 1
1: 1
2: 19
3: 154
4: 1411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961236866 Original CRISPR CGCGCGGGGGGAGCGCGCGG CGG (reversed) Intronic